ID: 1085212211

View in Genome Browser
Species Human (GRCh38)
Location 11:74791447-74791469
Sequence CAGTGCCCGGGCTGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085212204_1085212211 -7 Left 1085212204 11:74791431-74791453 CCCTGTACAGTACCCACAGTGCC 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212201_1085212211 11 Left 1085212201 11:74791413-74791435 CCTGTCACCATCAACCTGCCCTG 0: 1
1: 0
2: 4
3: 24
4: 285
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212199_1085212211 29 Left 1085212199 11:74791395-74791417 CCAGGAGCCTGTCTACTTCCTGT 0: 1
1: 1
2: 25
3: 186
4: 506
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212203_1085212211 -3 Left 1085212203 11:74791427-74791449 CCTGCCCTGTACAGTACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 204
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212205_1085212211 -8 Left 1085212205 11:74791432-74791454 CCTGTACAGTACCCACAGTGCCC 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212200_1085212211 22 Left 1085212200 11:74791402-74791424 CCTGTCTACTTCCTGTCACCATC 0: 1
1: 0
2: 12
3: 100
4: 539
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212198_1085212211 30 Left 1085212198 11:74791394-74791416 CCCAGGAGCCTGTCTACTTCCTG 0: 1
1: 16
2: 138
3: 282
4: 537
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155
1085212202_1085212211 4 Left 1085212202 11:74791420-74791442 CCATCAACCTGCCCTGTACAGTA 0: 1
1: 0
2: 0
3: 50
4: 1064
Right 1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG 0: 1
1: 0
2: 3
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085212211 Original CRISPR CAGTGCCCGGGCTGTGCCAT GGG Intronic
900353171 1:2246930-2246952 CCGTGCCCGGCCTGTGCCCATGG - Intronic
900395324 1:2451015-2451037 CAGGGCCAGGGCTGTGTCCTGGG - Intronic
900650604 1:3728273-3728295 CTGAGCCCAGGCTGGGCCATGGG + Intronic
900718511 1:4160276-4160298 CAGAGCCCTGCCTGCGCCATGGG - Intergenic
901033948 1:6325006-6325028 CAGTGCCCAGGCCGTGCTTTTGG - Intronic
901206949 1:7502925-7502947 CTGTGCCCAGGGTGAGCCATGGG - Intronic
901723165 1:11216788-11216810 CTGTGCCCAGGCTCTTCCATGGG + Intronic
902445720 1:16462658-16462680 CTGTGCCCAGACTGTCCCATAGG + Intergenic
902988502 1:20170475-20170497 CAGTGCCGGTGCTGTGCCAGGGG - Intronic
903174929 1:21575098-21575120 CAGTGCCTGGGCAGTGCCTGTGG - Intronic
903214906 1:21838586-21838608 CAGTGCCAGGGCTGTGCCAAAGG + Intronic
903864624 1:26389222-26389244 CAGTGCCATGACTGGGCCATGGG + Intergenic
904280236 1:29413757-29413779 CAGTGCCGGGGCTGTGACATGGG - Intergenic
908257911 1:62318129-62318151 CAGTGACCCGGCTGAGGCATGGG - Intronic
910016770 1:82534614-82534636 CAGTGCACTGGCTCTGCCAATGG - Intergenic
916187151 1:162144659-162144681 CAGAGGCCGGGCTGTACCCTGGG - Intronic
918066582 1:181105564-181105586 CAGCCCCCGGGCCGTGCCAGTGG + Intergenic
921162313 1:212481966-212481988 CAGTGCCTGGGCTGTGATAGAGG - Intergenic
1063499007 10:6536367-6536389 CTGAGCCCGGGCTCTGACATGGG + Intronic
1064480595 10:15736700-15736722 CATTGCCCGGGCTGTGTCCCTGG - Intergenic
1064544812 10:16439471-16439493 CAGTGCCAGGACTTGGCCATAGG + Intronic
1066370274 10:34814450-34814472 CAGTCCCCGGCCTGTGCCCCCGG + Intronic
1069857969 10:71452067-71452089 CAAGGCCCGCGCTGTGCCAGAGG + Intronic
1072408419 10:95176667-95176689 CTGTGACCTGCCTGTGCCATGGG + Intergenic
1073163220 10:101419546-101419568 CACCGCCAGGTCTGTGCCATGGG + Intronic
1074447075 10:113529528-113529550 CAATGCCCAGGCTTTGCCAAGGG - Intergenic
1075095258 10:119466953-119466975 TGGTGCCCTGGCTGTGCCTTGGG - Intergenic
1078840731 11:15073878-15073900 CAGCGCCCACGCTGAGCCATGGG - Intronic
1081946818 11:47003266-47003288 CAGTGCCAAGCCTGTGCCAATGG - Intronic
1083594091 11:63910839-63910861 GAGCACCCGGGCTGTTCCATAGG - Exonic
1083939152 11:65885912-65885934 AAGTGCCAGGGCTGTGCCATGGG + Intronic
1084802626 11:71555055-71555077 CAGGGCCAGGCCTGTCCCATGGG - Intronic
1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG + Intronic
1089781904 11:120879161-120879183 GAGAGCACGGGCTTTGCCATTGG - Intronic
1097057415 12:56258265-56258287 CGGAGCCCGGGCCGAGCCATGGG - Exonic
1100405206 12:94266892-94266914 CAGTGCCCGGGCTTTCCCTCGGG + Intronic
1102010687 12:109616647-109616669 CAGGCACCGGGCTGGGCCATGGG - Intergenic
1104619293 12:130298785-130298807 GAGTGCCAGGGCAGTGCCTTTGG + Intergenic
1104757264 12:131277029-131277051 AAGTCCCCGGGCTGAGCCAGAGG - Intergenic
1105278374 13:18949148-18949170 CAGGGCCCGGGAGGTGGCATTGG - Intergenic
1108017292 13:46089356-46089378 CAGTGCCTGAGCTTTGCCAATGG + Intronic
1119190000 14:72674776-72674798 CAGTGCCTGGACCTTGCCATTGG + Intronic
1119642721 14:76327128-76327150 CATTGCCCAGCCTGTGCCAATGG + Intronic
1120884788 14:89443365-89443387 CAGTGCCCTGCCTGTCCCAGGGG - Intronic
1122052683 14:99070770-99070792 CAGTGCCCTGACAGGGCCATGGG - Intergenic
1122236616 14:100334002-100334024 CAGTGCCCTGGCTGTGTCCCTGG - Exonic
1123063685 14:105605835-105605857 CTGTGCCCCGTCTATGCCATGGG + Intergenic
1123068858 14:105631352-105631374 CAGCCCCCTGGGTGTGCCATGGG - Intergenic
1123073014 14:105651310-105651332 CAGCCCCCTGGGTGTGCCATGGG - Intergenic
1123092936 14:105750080-105750102 CAGCCCCCTGGGTGTGCCATGGG - Intergenic
1123098415 14:105777179-105777201 CAGCCCCCTGGGTGTGCCATGGG - Intergenic
1128545000 15:68560932-68560954 AATTACCCGGGCTGTGCCATGGG - Intergenic
1130686527 15:86042389-86042411 CAGTGTCAGGGCTGTGCCCTGGG + Intergenic
1132372173 15:101306704-101306726 GAGAGCCCTGGCTCTGCCATAGG - Intronic
1133770150 16:8863042-8863064 CAGTGCCTGTGCTGGGCCCTTGG - Intronic
1134534465 16:15014510-15014532 CAATGCATGGGCTGTGCCACAGG - Intronic
1135154710 16:20042400-20042422 TAGTGCCTGGAATGTGCCATGGG - Intronic
1139335538 16:66228366-66228388 TAGGGCCCTGGCTGTGCCCTGGG - Intergenic
1139861582 16:70026267-70026289 CAATGCATGGGCTGTGCCACAGG + Intergenic
1140670650 16:77275076-77275098 CAGTGATGGGGCTCTGCCATTGG - Intronic
1141921519 16:87138767-87138789 CACTGCCCTGCCTGTGCCCTGGG - Intronic
1142185313 16:88692087-88692109 GTGTGGGCGGGCTGTGCCATGGG - Intergenic
1142226666 16:88880945-88880967 CCGTGCCCGGGCACTGCCCTGGG - Intronic
1145768605 17:27476590-27476612 CATTGCCCGTGATGTGCCCTGGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1149606875 17:57931404-57931426 CAGTGCCCGGCATGTGGCAGTGG - Intronic
1150652591 17:67019676-67019698 CAGTCCCAGGGTTGGGCCATGGG - Intronic
1151830788 17:76548902-76548924 CAGTTCCCTGACTGTGCCTTGGG + Intronic
1151945150 17:77315685-77315707 CAGAGCCCGGCCAGTGCTATTGG + Intronic
1152723732 17:81935215-81935237 CAGTGCCCGAGCTCTCCCAGTGG + Intronic
1155516326 18:26626853-26626875 CAGTGCAAAGGCTGTGCAATGGG + Intronic
1161068802 19:2250501-2250523 CAGTGCCCGGGCCGTGGCGGGGG + Intronic
1165244868 19:34493116-34493138 CTGTGCCCTGGCAGTGCCAGGGG + Intronic
1168147751 19:54429382-54429404 GAGTGCCAGGGCCGGGCCATTGG + Intronic
1168324566 19:55531329-55531351 CAGTGCCAGGGGTGTGCCTGGGG + Exonic
926821415 2:16855268-16855290 CGGTGCCCGCGCTGTGCTCTTGG - Intergenic
929545088 2:42850538-42850560 CAGTGCAGGGGCTGGGCCAGGGG - Intergenic
929786697 2:44998722-44998744 CAGTGCCAGGGCTCTTCCCTGGG + Intergenic
934522887 2:95030968-95030990 CAGAGCCGGGACTGGGCCATGGG + Intronic
934732099 2:96665912-96665934 GAGGGCCTGGCCTGTGCCATTGG - Intergenic
936385429 2:112024479-112024501 CTGTGCCCTGGGTGTGCCAAGGG + Intronic
942916489 2:181314749-181314771 CAGAGCTTGAGCTGTGCCATAGG - Intergenic
946431803 2:219630244-219630266 CTGTGCCCAGGCAGTGCCCTGGG + Exonic
948086794 2:235257051-235257073 CAGTCCATGGGCTGTCCCATGGG + Intergenic
948499371 2:238380531-238380553 GAGTGGCCGGGCTGGGCCACTGG - Intronic
1171186691 20:23128146-23128168 CAGTGACCGGGCTGAGGGATGGG + Intergenic
1171411716 20:24952386-24952408 CAGTGTCCTGTCTGTGCCAGGGG + Intronic
1172303354 20:33864975-33864997 CAGCGGCTGGGCTGAGCCATGGG + Intergenic
1172593422 20:36133106-36133128 GAGGGCCCGAGCTGTGCCTTTGG + Intronic
1174121486 20:48268937-48268959 CTTTGCCCTGGCTGTGCCCTAGG + Intergenic
1174719602 20:52797864-52797886 CAGTGCCCAGGCCTTGCCACAGG + Intergenic
1175185283 20:57175812-57175834 CAGGGCCCAGGCTGTGCCTGTGG + Intronic
1175892674 20:62322449-62322471 CAGTGACCAGCCTGTGCCACAGG - Exonic
1176037430 20:63046640-63046662 CAGTGCCCAGGCTGGGACAAAGG + Intergenic
1176180141 20:63746097-63746119 GAGCGGCCGGGCTGGGCCATGGG + Exonic
1178478271 21:32956623-32956645 CAGTGCCCCAGCTGTGCTAAAGG + Intergenic
1178995959 21:37400056-37400078 CAGGGCCAGGGCTGTGCTTTAGG + Intronic
1181458417 22:23072137-23072159 CAGTGCCCTGGCTGTGCCCGAGG - Intronic
1181853529 22:25766888-25766910 CAGTTCACGGGCTGTGGCAATGG + Intronic
1182693499 22:32180032-32180054 CAGTCACAGGGCTGTGCCTTTGG - Intergenic
1183291587 22:37004976-37004998 CCGTGCCCGGCCTGTGACTTCGG + Intronic
1185116624 22:48941704-48941726 CAGTGCCCAGGATGAGCCAGTGG - Intergenic
949221142 3:1635371-1635393 CATTCCCTGGGCTGTGACATGGG + Intergenic
953179805 3:40584651-40584673 CAGAGGCCTGGCTGAGCCATTGG + Intergenic
953232306 3:41075911-41075933 CAGTGCCTGGGCTGGGCAAAAGG + Intergenic
954748318 3:52799499-52799521 CCGAGCCCTGGCTGTGCCACTGG - Intronic
954988366 3:54816074-54816096 CAGTTCCTCGCCTGTGCCATTGG + Intronic
962200958 3:133400575-133400597 AAGTGTCCAGGCTGTGCCAAGGG + Intronic
962208494 3:133455817-133455839 CAGTGCCCCGGCTGAGAAATTGG - Intronic
963049123 3:141126929-141126951 GAGAGCCCGGGCTGGGGCATGGG - Intronic
968578003 4:1376861-1376883 CAGTGCCAAGGCTGTGTCCTGGG + Intronic
968641256 4:1716262-1716284 CTGTGTCAGGGCTGTGCCCTGGG + Exonic
968956200 4:3721128-3721150 CAGAGCTTGGGCTGGGCCATGGG - Intergenic
969149622 4:5158290-5158312 CAGGACCCGCGCTGTGCCACTGG - Intronic
970268108 4:14312144-14312166 CAGGGTCTGGGCTTTGCCATAGG + Intergenic
972072423 4:35038401-35038423 CACTCCCCGGGCCGAGCCATCGG - Intergenic
975307784 4:72868502-72868524 CAGTGCTCGGGCTCTGCTAAGGG + Intergenic
978976319 4:114879232-114879254 TAGTCCCCAGGCTGTGCAATAGG + Intronic
982323936 4:154109415-154109437 CAGTGCCTGAGCTGTGCTAAGGG + Intergenic
984793176 4:183632928-183632950 CAGAGCCTGGCCTGTGCCACGGG - Intergenic
986482383 5:8202372-8202394 CAGTCCCTGGGCTGTGCTAGGGG + Intergenic
998405021 5:141869375-141869397 CAGGGCCTGGGCTGTGCCTCAGG + Exonic
998568227 5:143234729-143234751 CAGTGCCAGGGCTTTGTCCTGGG + Intergenic
1000047045 5:157530474-157530496 GAGGGGCCCGGCTGTGCCATGGG - Intronic
1001091008 5:168740958-168740980 CTTGGACCGGGCTGTGCCATGGG - Intronic
1001273284 5:170331814-170331836 CAGGGCTGGGGATGTGCCATGGG - Intergenic
1002318791 5:178362811-178362833 CATGGGCTGGGCTGTGCCATCGG - Intronic
1007423558 6:41733909-41733931 CAGTGCCAGGTCTGGGCCAATGG + Intronic
1015570529 6:134617130-134617152 CAGCGCCAGGCCTGTTCCATTGG - Intergenic
1016202549 6:141430186-141430208 CAGTGCCAGGGCAGTGCAAAAGG - Intergenic
1017043017 6:150322942-150322964 CTGTGCCCGGGCCATGCCAAGGG - Intergenic
1020059257 7:5140252-5140274 CCGTCCCAGGGCTGTGGCATGGG + Intergenic
1020090022 7:5333576-5333598 CAGGGCCTTGGCTGTGCAATGGG - Intronic
1020214593 7:6180024-6180046 CAGTGCTGGGGCTTTGCTATTGG + Intronic
1023841749 7:44102082-44102104 CTGTGCCCAGGCTCTGCCACGGG - Intergenic
1023876269 7:44287956-44287978 CAGTGCCTGGGCTGTGATATAGG + Intronic
1024235537 7:47394831-47394853 CAGTTCCCTGGTTGTGACATGGG + Intronic
1024827189 7:53404430-53404452 CTGTGCCCAGGGTGTTCCATTGG - Intergenic
1026889411 7:73973367-73973389 CGGTGCCCGGGAAGTGCCAGAGG - Intergenic
1026895905 7:74010004-74010026 CAGGGCATGGGCTGTGTCATAGG + Intergenic
1031494705 7:122432347-122432369 CAGTGCCTGGCCTGTCCCAAAGG - Intronic
1032159581 7:129500453-129500475 CAGTGGTCGAGGTGTGCCATGGG - Intergenic
1032957054 7:136983945-136983967 CAGTGCCCAAGCTCTGCCAAGGG - Intronic
1033589392 7:142797223-142797245 GAGTCCCCGGGCTGTGCTCTGGG + Intergenic
1034396670 7:150831240-150831262 AAATGCCCTGGCTGTGCCCTGGG - Intronic
1035665100 8:1374972-1374994 CAGCGCCCCGGCTGTGGTATTGG - Intergenic
1035755574 8:2028630-2028652 CAGTTCCCGGGCTGAGCCACTGG + Intergenic
1045064027 8:98429464-98429486 AGGTGCCTGGGCTGTGCCAGAGG - Exonic
1045859600 8:106800876-106800898 CAGTGCTCAGGCTGTCCCAGTGG + Intergenic
1047478450 8:125257886-125257908 CATTGCCTTGGCTGTACCATTGG - Intronic
1049013872 8:139906269-139906291 CTGTGCCCGGCCAGTGCCCTGGG + Intronic
1049219809 8:141424036-141424058 CAGGGCCAGGGCTGAGCCGTGGG + Intronic
1049775462 8:144401869-144401891 CTGTGCCAGGGCTGGGCCGTGGG - Intronic
1052817236 9:33111125-33111147 CTGTGCCCTGGCTGTGCCTTGGG + Exonic
1055271418 9:74563831-74563853 CACTGCCAGAGCTGTGCCAAAGG + Intronic
1057605208 9:96494032-96494054 CAGTAACCAGGCTTTGCCATAGG - Intronic
1057912616 9:99031678-99031700 CTGTGCCCTGGCAGAGCCATGGG + Intronic
1061371785 9:130201530-130201552 CAGTGCCAGGGCTGGGCCTGGGG + Intronic
1061412898 9:130430767-130430789 CAGAGCCTTGGCTGTGCTATTGG + Intronic
1061728580 9:132595704-132595726 CATTGACCAGGCTGTGCCCTGGG - Intronic
1061904357 9:133689049-133689071 GAGTGCCCAGACTCTGCCATGGG - Intronic
1061959985 9:133983034-133983056 CAGTGGCCGGGCTGGGACACCGG + Intronic
1062365322 9:136205462-136205484 CAGTGCCCAGGCCGTGCCCCGGG + Intergenic
1062561083 9:137142187-137142209 GAGTGGCCAGGCTGTGCCCTGGG - Intronic
1198986040 X:142455301-142455323 CAGTGATCAAGCTGTGCCATCGG - Intergenic
1200067583 X:153511455-153511477 CAGGGCCCCAGCTGTGGCATAGG + Intergenic