ID: 1085212231

View in Genome Browser
Species Human (GRCh38)
Location 11:74791525-74791547
Sequence CCTCTGGGGTGCCCAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085212220_1085212231 -2 Left 1085212220 11:74791504-74791526 CCCCCACAGCCTTCCTCCTGTCC 0: 1
1: 0
2: 5
3: 97
4: 858
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
1085212217_1085212231 29 Left 1085212217 11:74791473-74791495 CCTGCAGGCCTGTGCCAAGCTGC 0: 8
1: 25
2: 72
3: 140
4: 435
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
1085212219_1085212231 15 Left 1085212219 11:74791487-74791509 CCAAGCTGCTCTCAGCACCCCCA 0: 1
1: 0
2: 23
3: 88
4: 576
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
1085212223_1085212231 -5 Left 1085212223 11:74791507-74791529 CCACAGCCTTCCTCCTGTCCTCT 0: 1
1: 1
2: 12
3: 115
4: 996
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
1085212218_1085212231 21 Left 1085212218 11:74791481-74791503 CCTGTGCCAAGCTGCTCTCAGCA 0: 1
1: 8
2: 38
3: 112
4: 420
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
1085212222_1085212231 -4 Left 1085212222 11:74791506-74791528 CCCACAGCCTTCCTCCTGTCCTC 0: 1
1: 0
2: 5
3: 59
4: 633
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
1085212221_1085212231 -3 Left 1085212221 11:74791505-74791527 CCCCACAGCCTTCCTCCTGTCCT 0: 1
1: 0
2: 14
3: 102
4: 893
Right 1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085212231 Original CRISPR CCTCTGGGGTGCCCAAAGTC TGG Intronic
900704444 1:4071344-4071366 GCTCTGTGGTGCCAATAGTCTGG + Intergenic
902492070 1:16790147-16790169 CCTTTAGGGTGCCCCAAGGCAGG - Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903222203 1:21875231-21875253 CCCCTGGGGTCCCCAATGACAGG + Intronic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
911129422 1:94373838-94373860 CCTCTTGGGTGGCATAAGTCTGG + Intergenic
912093714 1:106114007-106114029 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
912132479 1:106619728-106619750 GCTCCTTGGTGCCCAAAGTCGGG - Intergenic
914370414 1:147019773-147019795 ACTATGGGGTGACCAAAGCCAGG + Intergenic
914484280 1:148093637-148093659 ACTATGGGGTGACCAAAGCCAGG - Intergenic
917848869 1:179043172-179043194 GCTCATTGGTGCCCAAAGTCCGG + Intronic
918749951 1:188259680-188259702 CCTCTTGGGTGGCATAAGTCTGG + Intergenic
920555109 1:206898937-206898959 CGTCTGGGGAGCCCAAACCCAGG - Intronic
922446447 1:225701898-225701920 CTATTGGGGTGCCCAAAGCCAGG - Intergenic
922765246 1:228152986-228153008 CCTCCAGGGTGCCCAAAATGAGG - Intronic
923528376 1:234792390-234792412 CCTTTAGGGTGCCCCAAGGCAGG + Intergenic
924757307 1:246953038-246953060 CCTCTGAGGTTCCCAATGGCTGG + Intronic
1065082782 10:22143759-22143781 CCTCTTGGGTGGCTTAAGTCTGG - Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1068157758 10:53223106-53223128 GCTCGTTGGTGCCCAAAGTCTGG + Intergenic
1069757556 10:70782442-70782464 CCTCTGGGCTGTCCACAGTCTGG - Intronic
1070096270 10:73340659-73340681 GCTCGTGGGTGCCCAAAGTCTGG + Intronic
1071510952 10:86262356-86262378 CTTCCTGGGTGCCCAAGGTCTGG - Intronic
1074156887 10:110807469-110807491 CCTCAGGGGTGCCCCCAGTGAGG - Intronic
1074248001 10:111713961-111713983 GCTCCTTGGTGCCCAAAGTCTGG + Intergenic
1076858760 10:133129825-133129847 CCTCTAGGGTGCCCCAGGACTGG - Exonic
1077012739 11:386068-386090 ACTCATTGGTGCCCAAAGTCTGG - Intergenic
1077217765 11:1402178-1402200 CCTCTGGAGAGCGCAAGGTCAGG - Intronic
1077670388 11:4151902-4151924 CTTAGGGGGTACCCAAAGTCAGG + Intergenic
1078874248 11:15378012-15378034 GCTCTTCGGTGTCCAAAGTCTGG - Intergenic
1081011040 11:37812530-37812552 GCTCATAGGTGCCCAAAGTCCGG + Intergenic
1082060854 11:47858850-47858872 CATTTGGGGAGCCCAAGGTCGGG - Intergenic
1083026527 11:59555861-59555883 CCTCCGGGGTCCGCAAAGGCTGG + Intergenic
1084653220 11:70501046-70501068 CCTCTGGGGAGCCCCAGGACAGG + Intronic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1085391965 11:76186800-76186822 GCTCTGGAGTGCCCACAGGCTGG - Exonic
1085809405 11:79666990-79667012 CCTCTGGGGGACCTAAAGTGAGG - Intergenic
1088648578 11:111937643-111937665 GCTCTGGGGTCCCCAAAGGATGG - Intronic
1090991326 11:131819570-131819592 CCTCTGGTGTGCCAACAGCCTGG - Intronic
1091573535 12:1712179-1712201 CCTCTTGGGTGGCATAAGTCTGG + Intronic
1091888185 12:4031702-4031724 CCTCGGGGCCGCCCAGAGTCGGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1100200895 12:92296878-92296900 CCTCTGGGGTTACTAAAGTTTGG + Intergenic
1100529842 12:95453041-95453063 CCTCTCGGGTGGCATAAGTCTGG + Intergenic
1103713362 12:122929217-122929239 CCTCAGGGGTGCCCCCAGCCCGG - Exonic
1104306536 12:127615200-127615222 CCTCTTGGGTGGCATAAGTCTGG - Intergenic
1104863312 12:131936936-131936958 CCTCTGGGGTGTCCTATGTCTGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1106462264 13:29981504-29981526 CCTCTGGTGGGCCCAGAGTCAGG + Intergenic
1106696397 13:32178420-32178442 CCTCTGGTGGACCCAAAGTAAGG + Exonic
1111202889 13:84962272-84962294 GCTCATTGGTGCCCAAAGTCCGG + Intergenic
1111842992 13:93473301-93473323 ACTCTTTGGTGCCCAAAGTATGG + Intronic
1112813693 13:103248952-103248974 CCTCTGGGGTTCCCACAGGCAGG + Intergenic
1114582428 14:23774582-23774604 CCTCAGGTGTGCACAAAGGCAGG + Intergenic
1118213601 14:63788033-63788055 GCTCGTGGGTGCCCAAATTCTGG + Intergenic
1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG + Intronic
1119420803 14:74506667-74506689 CCTGTGGGCTACCCAAGGTCTGG - Intronic
1119804020 14:77470558-77470580 CCGCTGGGGTGCAGGAAGTCAGG - Intergenic
1122122999 14:99564580-99564602 CCCCTGGGGGGCTCAGAGTCAGG - Intronic
1202903967 14_GL000194v1_random:58060-58082 TCTCTGGGGAGCCCAGGGTCAGG + Intergenic
1123888307 15:24749176-24749198 GCTCTTTGGTGACCAAAGTCTGG - Intergenic
1125533986 15:40432479-40432501 CCTCTGGGGGGACTACAGTCTGG - Intronic
1125643528 15:41251458-41251480 CCCCTGGGGTCCCCAACCTCTGG + Intronic
1126034797 15:44536566-44536588 CCTCTGGGGTCCCGGAAGCCCGG + Intergenic
1126071040 15:44864918-44864940 CCTCTTGGGTGGCATAAGTCTGG + Intergenic
1128707113 15:69844348-69844370 CCTCTGGGGTGCACACACTCAGG + Intergenic
1129671595 15:77610831-77610853 CCTCTGGGATGCCTCAAGGCTGG - Intergenic
1130051895 15:80490632-80490654 CCTCGGGGCTGCCCACAGCCTGG + Intronic
1130222156 15:82028748-82028770 CTTCTGGGGTGGCCAATGACAGG - Intergenic
1130311753 15:82762306-82762328 GATCTGGGGTGCCCCAAGCCTGG + Intronic
1131020459 15:89093534-89093556 CCTCTTGGACGCCCAAAGGCAGG - Intronic
1132781998 16:1632386-1632408 GCTCGGGGGTGCCCACAGGCAGG + Intronic
1133244482 16:4438774-4438796 CCTTTAGGATGGCCAAAGTCGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1137752755 16:50879221-50879243 CCTGATGGGTGCCCAAAGCCAGG - Intergenic
1137753853 16:50886194-50886216 CCTCTGGGGAGCACAAGGCCAGG + Intergenic
1138494282 16:57397965-57397987 CCTCTTGGGTGGCATAAGTCTGG + Intergenic
1139367429 16:66442050-66442072 CCTCTGGGCTGCCCTGGGTCAGG - Intronic
1140617360 16:76682514-76682536 GCACTGGGGAGACCAAAGTCAGG - Intergenic
1140708984 16:77658636-77658658 CCTCTGGGGTGAACAAACTAAGG - Intergenic
1142940728 17:3378269-3378291 ACTCTTTGGTGTCCAAAGTCTGG + Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1144797128 17:17899674-17899696 GCTCTGGGGAGCCCTCAGTCCGG + Intronic
1147863080 17:43535072-43535094 CCTGCGGGGTTCCCAAACTCTGG + Intronic
1148836207 17:50467173-50467195 CCCCTGGGGTGCCCAGTGTCTGG - Intronic
1149074263 17:52578126-52578148 CCTCTCGGGTGGCATAAGTCTGG - Intergenic
1151162006 17:72173827-72173849 CCCCTGGGTTGTCCAAAGACAGG + Intergenic
1151658978 17:75508716-75508738 CCTCTGGGATGCCCCAGGACTGG - Intronic
1152660449 17:81539639-81539661 CCTGTGGGGTGCTCCTAGTCAGG - Intergenic
1154340254 18:13496870-13496892 CCACTGGGGTGCCCAGGTTCGGG - Intronic
1155174434 18:23290259-23290281 GCTCTGGGATGCTCTAAGTCTGG - Intronic
1155475751 18:26234684-26234706 CCTCTTGGGTGGCGTAAGTCTGG + Intronic
1156160303 18:34350963-34350985 CCAGAGGGGAGCCCAAAGTCAGG - Intergenic
1159623813 18:70669396-70669418 GCTCCTTGGTGCCCAAAGTCTGG - Intergenic
1161117174 19:2504162-2504184 CCTCTGGGGAGCCCAAGCTATGG + Intergenic
1162907255 19:13831307-13831329 CTTTTGGGGTGCCCAAAGTGGGG - Exonic
1163016659 19:14459951-14459973 CCTCTGGGCTGTCAAAACTCAGG - Intronic
1163669556 19:18619448-18619470 CCTCTGTGGTGCCCAGAGCCTGG + Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165022569 19:32936294-32936316 GCTCATGGGTGCCCAAAGTCTGG - Intronic
1165334798 19:35162212-35162234 CCTCTGGGTTGCCTAGAGGCTGG + Intronic
1166803371 19:45471184-45471206 CCTCTGGGGTGAGCTGAGTCAGG - Exonic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1166897425 19:46032711-46032733 GCTCATCGGTGCCCAAAGTCTGG - Intergenic
1167425399 19:49427533-49427555 CCTCTGGGGTGCCCGCAGAGTGG - Exonic
925048140 2:789986-790008 GCTCCTTGGTGCCCAAAGTCTGG - Intergenic
926145778 2:10396497-10396519 CCTCTGTGGTCCACAAACTCAGG - Intronic
928077975 2:28282577-28282599 TCTCTGGCTTGCCCAAAGCCAGG + Intronic
928138583 2:28707814-28707836 CCTCTGTGTTGTCCAAAGTTTGG + Intergenic
929365429 2:41150111-41150133 CCTCTGGAGTGCCCAGAGAGAGG + Intergenic
930800512 2:55438308-55438330 ACTCGTGGGTGCCCAAAGTCCGG - Intergenic
931282216 2:60804501-60804523 GCTCCTCGGTGCCCAAAGTCCGG + Intergenic
935046912 2:99490438-99490460 CCACTGGGGAGCCCCAAGGCGGG - Intergenic
936432077 2:112473458-112473480 CCTCTGGGATGTCCATATTCAGG + Intergenic
939183688 2:138834484-138834506 CTGCTGGGGTTCCCAATGTCGGG - Intergenic
942585117 2:177466612-177466634 GCTCATTGGTGCCCAAAGTCTGG + Intronic
942616383 2:177795586-177795608 CTTCTTGGGTACCTAAAGTCAGG + Intronic
942868114 2:180699881-180699903 GCTCACTGGTGCCCAAAGTCTGG + Intergenic
943618106 2:190116705-190116727 CTTCTGGTGTGCCCAGAGTTGGG + Intronic
944362335 2:198871921-198871943 CATCTGAGATGCACAAAGTCAGG - Intergenic
944696114 2:202201723-202201745 CCCCTGGGGTGCACAAAGCTTGG + Intergenic
945907690 2:215613568-215613590 CCTCTGAGGTGCAGAAACTCGGG - Intergenic
946447788 2:219754575-219754597 ACTCTGGGGTGCTCAGAGTCAGG - Intergenic
948334974 2:237200678-237200700 GCTCATTGGTGCCCAAAGTCCGG + Intergenic
1170043629 20:12063892-12063914 CTTCTGGGGTTGCCAAAGACTGG - Intergenic
1170437535 20:16345956-16345978 CTTCTGGGGAGCCCAAAGGAGGG + Intronic
1170873423 20:20229370-20229392 GTTCTGTGGTTCCCAAAGTCAGG - Intronic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1171155185 20:22865491-22865513 CCTCTTGGGTCACCAGAGTCGGG - Intergenic
1172113633 20:32561498-32561520 CCTCTGGGGGGCCCAGAGCAGGG + Intronic
1172913516 20:38427491-38427513 CCTGTGGGATGACCCAAGTCAGG + Intergenic
1173157712 20:40628964-40628986 GTTCTGTGGTGCCCAAAGTATGG - Intergenic
1175889889 20:62311385-62311407 CCCCTGGGGTGCCCACCTTCCGG + Exonic
1176030698 20:63009823-63009845 CCCTGGGGGTGCCCAAAGACCGG + Intergenic
1176089525 20:63312733-63312755 CCTCTGAGGTGCCCAGGCTCAGG + Intronic
1176239412 20:64069006-64069028 CCTCTGGGGTGCCCACCCACTGG - Intronic
1176623337 21:9072828-9072850 TCTCTGGGGAGCCCAGGGTCAGG + Intergenic
1177344948 21:19855717-19855739 GCTCATTGGTGCCCAAAGTCTGG + Intergenic
1180918313 22:19505092-19505114 CCTCTGCGGTGCCCATTCTCAGG + Intronic
1180950007 22:19716697-19716719 CCTCTGGGGAGGCCCAGGTCAGG - Intronic
1183535944 22:38401559-38401581 CCTGTGGGGAGCCCAAAGCTTGG + Intergenic
1185191116 22:49437017-49437039 CCCCTTGGGTGACCAATGTCTGG - Intronic
949756381 3:7415808-7415830 CCTCTATGTTGCCCAGAGTCTGG + Intronic
949878266 3:8641264-8641286 CCTTTGGGGTACTCCAAGTCTGG - Intronic
950413238 3:12852822-12852844 CCTCTTGGCTGGCCACAGTCAGG - Intronic
950448361 3:13051410-13051432 GCTCTGTGCTGCACAAAGTCAGG + Intronic
955089219 3:55732773-55732795 CCTATCAGGTGGCCAAAGTCTGG + Intronic
957405956 3:79775505-79775527 CCCCTGAGGAGCCCACAGTCAGG + Intergenic
958584522 3:96069261-96069283 GCTCCTTGGTGCCCAAAGTCTGG + Intergenic
960170402 3:114454337-114454359 CCCCAGGGGTGCACAAAGACAGG + Intronic
962832835 3:139159196-139159218 CCTCTGGAGACCCCAAAGTTAGG - Intronic
963483310 3:145904118-145904140 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
963868445 3:150387478-150387500 GCTCTGTGGTGTCCAAAGTGAGG - Intergenic
964975522 3:162614871-162614893 GCTCGTTGGTGCCCAAAGTCTGG + Intergenic
965063092 3:163806541-163806563 CCTCTTGGGTGGCATAAGTCTGG - Intergenic
965147820 3:164928550-164928572 CCTCTGGGGTCCACACAGACTGG + Intergenic
965924347 3:173958850-173958872 GCTCATTGGTGCCCAAAGTCTGG + Intronic
966465436 3:180226828-180226850 ACTCTGGGGTCCCCAGAGTTTGG + Intergenic
967684840 3:192407990-192408012 CCTCTGGGGAGCCCACTCTCCGG + Intronic
967731117 3:192907866-192907888 CCTCTGGCATGCCCATACTCAGG - Intronic
968548004 4:1208341-1208363 CCTCTGGGGTGGCCCAAGCAGGG - Intronic
968814986 4:2817621-2817643 CCCCTGGGGTGGCCAAAGGCCGG - Intronic
968905371 4:3448349-3448371 CCCCTGGGGAGCCCAGAGCCTGG + Intronic
969204647 4:5634324-5634346 CCCCTGCGGTGCCCAGACTCAGG - Intronic
969682974 4:8653375-8653397 CCTCTGTGATGCCCCAACTCCGG - Intergenic
970257803 4:14187068-14187090 CCTCTGGGGAGCGCTAAGACTGG + Intergenic
970371548 4:15412139-15412161 CCTCTGGGGTGATCAGAGCCAGG - Intronic
970959600 4:21856919-21856941 GCTCCTCGGTGCCCAAAGTCTGG - Intronic
971578816 4:28307992-28308014 CCTCTTGGGTGGCATAAGTCTGG - Intergenic
971876885 4:32319089-32319111 GCTCATTGGTGCCCAAAGTCTGG + Intergenic
975176930 4:71299866-71299888 CTGCTGGGGTGACCAAAGTAGGG + Intronic
975901874 4:79163113-79163135 CATCTGTGTTGCCCAAATTCAGG + Intergenic
976129637 4:81870765-81870787 GCTCATCGGTGCCCAAAGTCTGG - Intronic
978747394 4:112209481-112209503 CCTCTTGGGCGGCAAAAGTCTGG - Intergenic
979010735 4:115365666-115365688 GCTCGTTGGTGCCCAAAGTCTGG - Intergenic
979364109 4:119800036-119800058 TCTCTTGGGTTCCTAAAGTCAGG + Intergenic
980703102 4:136457626-136457648 GCTCATAGGTGCCCAAAGTCTGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
984325142 4:178241840-178241862 GCTCCTTGGTGCCCAAAGTCTGG - Intergenic
984763721 4:183383918-183383940 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
984778762 4:183505547-183505569 TCTCTGGGGTCCCCAGAGTGGGG + Intronic
985299679 4:188474913-188474935 CCTCTTGCGTGCACAATGTCAGG + Intergenic
986284787 5:6351199-6351221 CTTCTGGGGTGCCCAGTGTCAGG + Intergenic
989733835 5:44679234-44679256 CCTCTGGGCTCCACAAAGGCTGG - Intergenic
990431383 5:55738245-55738267 TCCCACGGGTGCCCAAAGTCTGG + Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
994753272 5:103764536-103764558 GCTCATGGGTCCCCAAAGTCCGG + Intergenic
996544718 5:124665885-124665907 CCTCTTTGGGGCCCAGAGTCTGG - Intronic
998961357 5:147490172-147490194 ACTCTGGGGTGTGCAAAATCAGG - Intronic
999063436 5:148659534-148659556 CCTCTGGGGTGCTCAGGTTCTGG + Intronic
1005471516 6:26166143-26166165 CCTCTGTTGAGCCCAAAGGCTGG + Intronic
1005594675 6:27368059-27368081 GCTCTTCAGTGCCCAAAGTCTGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006489916 6:34378589-34378611 CCTCTGGAGTGCTCATAGTGTGG - Intronic
1006637977 6:35474123-35474145 CCTCTGGTCTGCCCAGAGGCTGG + Exonic
1007238862 6:40410931-40410953 CCTCTGTCCTGCCCCAAGTCTGG + Intronic
1007649903 6:43412884-43412906 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
1012142065 6:95636640-95636662 GCTCGTTGGTGCCCAAAGTCTGG + Intergenic
1016076802 6:139805338-139805360 GCTCATCGGTGCCCAAAGTCTGG + Intergenic
1016797823 6:148136647-148136669 CCTGTGGGGTCCCCAAACTGTGG + Intergenic
1017063099 6:150504930-150504952 CCTCTGGGATGGCCAGAGGCTGG + Intergenic
1019743078 7:2684764-2684786 CCTCCTGGGTGCCCCAAGTTGGG - Intronic
1021024173 7:15643634-15643656 CCTCTGGGAGTCCCACAGTCTGG - Intronic
1021677614 7:23097223-23097245 GCTCTTTGGCGCCCAAAGTCTGG - Intergenic
1022503282 7:30895778-30895800 CCTCTGGGGTGACCACAGTGTGG + Intergenic
1026392078 7:69912060-69912082 GCTCATGGGTGCCCAAAATCTGG + Intronic
1027113393 7:75458558-75458580 CCTCTGGGTTGCACAAAGGTGGG + Intronic
1027285643 7:76643153-76643175 CCTCTGGGTTGCACAAAGGTGGG + Intergenic
1027353922 7:77338543-77338565 CGACTGGAGTGCCCAAAATCAGG + Intronic
1027687442 7:81295075-81295097 GCTCGTCGGTGCCCAAAGTCGGG + Intergenic
1029589576 7:101498395-101498417 ACTCTGAGGTCCCCAAAGGCAGG - Intronic
1029668826 7:102014441-102014463 CCTCTGGGGTCTCCAAGGGCTGG + Intronic
1031359823 7:120836075-120836097 CCTCTGGGATGCCCAAGTTCAGG - Intronic
1031490396 7:122380817-122380839 CCTCTGGGGAGCACAAACTTGGG - Intronic
1031786520 7:126040687-126040709 GCTCATCGGTGCCCAAAGTCCGG - Intergenic
1033355141 7:140593271-140593293 CCTTTGGGGAGCCCACAGCCTGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1041634898 8:60131998-60132020 CATCTGGGATGCCCAACATCTGG + Intergenic
1042194351 8:66219837-66219859 TCTCTGGGGTTCCCAACGTTTGG - Intergenic
1043180692 8:77083371-77083393 CCTCTTCAGTGCTCAAAGTCTGG + Intergenic
1049530910 8:143154534-143154556 CCTCTGAGGGGCCCACAGCCAGG + Intergenic
1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG + Exonic
1051391151 9:16565339-16565361 CCTCTGATCTGCCCAAAGTAAGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1061267303 9:129514296-129514318 GCTCGTTGGTGCCCAAAGTCTGG - Intergenic
1061954591 9:133955231-133955253 CCTGTGGGGTCCCCAGAATCTGG - Intronic
1062365443 9:136206000-136206022 CCTCTGAGGTGCCCTCAGGCTGG + Intergenic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1203746522 Un_GL000218v1:43255-43277 TCTCTGGGGAGCCCAGGGTCAGG + Intergenic
1203563589 Un_KI270744v1:76225-76247 TCTCTGGGGAGCCCAGGGTCAGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1191253530 X:58270286-58270308 ACTTTGGGGTGCCCCAAGTGGGG + Intergenic
1192482423 X:71497235-71497257 CCTCTCGGGTGGCATAAGTCTGG + Intronic
1195178583 X:102334315-102334337 GCTCGTCGGTGCCCAAAGTCTGG - Intergenic
1195180281 X:102352768-102352790 GCTCGTCGGTGCCCAAAGTCTGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1200096829 X:153668534-153668556 CCCCTGTGGGGCCCAAAGCCTGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201648695 Y:16262870-16262892 CCTCTTGGGTGGCATAAGTCTGG + Intergenic
1201654114 Y:16322430-16322452 CCTCTTGGGTGGCATAAGTCTGG - Intergenic