ID: 1085223226

View in Genome Browser
Species Human (GRCh38)
Location 11:74894248-74894270
Sequence CAGGATCTACTTGAGGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1253
Summary {0: 2, 1: 4, 2: 58, 3: 303, 4: 886}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085223226 Original CRISPR CAGGATCTACTTGAGGGTAG AGG Intronic
900011207 1:110773-110795 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900027311 1:287337-287359 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900041269 1:466781-466803 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900062700 1:701757-701779 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900734325 1:4286188-4286210 CAGGGTCTACTTGAGAGTGGGGG - Intergenic
901089105 1:6629640-6629662 CAGAATCTCCATGAGGGCAGGGG + Intronic
904233002 1:29092705-29092727 CAGGGCCTACTTGAGGGTGGAGG - Intronic
905100591 1:35518541-35518563 TGGAATCTACTTGAGGGTAGAGG + Intronic
906737753 1:48148699-48148721 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
907770213 1:57454492-57454514 CGGGGTCTACTTGAGGATGGAGG + Intronic
908083064 1:60601019-60601041 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
908165657 1:61455197-61455219 CAGGATCTACGTTAGGGATGCGG - Intronic
908184393 1:61638560-61638582 CAGGATGTACTTGATGCAAGGGG + Intergenic
908819041 1:68064206-68064228 CAGGGCCTATTGGAGGGTAGAGG + Intergenic
908905469 1:69003877-69003899 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
909240875 1:73211568-73211590 AAAGATCAACTTGAGGTTAGCGG + Intergenic
909399600 1:75212346-75212368 TGGGACCTACTTGAGGGTGGAGG - Intronic
909442882 1:75717449-75717471 CTGGGGCTACTTGAGGGTGGAGG + Intergenic
909875020 1:80790987-80791009 TAGGGACTACTTGAGGGTGGAGG + Intergenic
909972836 1:82010647-82010669 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
910139750 1:84014059-84014081 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
910221645 1:84894111-84894133 CAGAATCTCTTTGATGGTAGGGG - Intergenic
910313300 1:85853125-85853147 CAGGACCTACTTGAGAGTGAAGG - Intronic
910317145 1:85899102-85899124 CAAGATCATCTTGAGGGTTGAGG - Intronic
910606012 1:89085601-89085623 CAGGGCCTTCTTGAGGGTTGAGG + Intergenic
910610895 1:89141032-89141054 CAGGACCTACTTGAGGGTGGAGG + Intronic
910736302 1:90461604-90461626 CAAGGCCTACTTGAGGGCAGAGG - Intergenic
910889897 1:92007391-92007413 TGGGGTCTACTTGAGGGTGGAGG - Intronic
911069329 1:93819921-93819943 TGGGACCTACTTGAGGGTGGAGG - Intronic
911314337 1:96338018-96338040 CAGGGTCTACTTGAGGATGGAGG + Intergenic
911374730 1:97038060-97038082 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
911491865 1:98579240-98579262 CAGCACCTACTTGAGGGTGGAGG - Intergenic
911543928 1:99192702-99192724 TAGGGTCTACTTGAGGGTAGAGG + Intergenic
911598351 1:99822234-99822256 CAGGATCTGTGTGGGGGTAGTGG - Intergenic
911892088 1:103384203-103384225 TGGGATCTACTTGAGGATGGAGG - Intergenic
912147848 1:106816423-106816445 CAGAGTTTACTTGAAGGTAGAGG - Intergenic
912283603 1:108344445-108344467 CAGAGTCTATTTGAGGGTGGAGG + Intergenic
912326084 1:108764039-108764061 CTAGGCCTACTTGAGGGTAGAGG - Intronic
912799228 1:112710922-112710944 GAGGTTCTACCTGAGGGTAGGGG - Intronic
912890971 1:113530434-113530456 CAGGGCCTATTTGAGGGTAGAGG + Intronic
912987426 1:114448443-114448465 AACGGTCTACTTGAGGGAAGTGG + Intronic
914295012 1:146312868-146312890 CAAGACCTACTTAACGGTAGAGG - Intergenic
914556053 1:148763651-148763673 CAAGACCTACTTAACGGTAGAGG - Intergenic
915516103 1:156413580-156413602 CAGGTTCTTCCTGGGGGTAGGGG + Intronic
915602611 1:156931746-156931768 AAGGAGCTTCTTGAGGGTATGGG + Intronic
915696211 1:157745162-157745184 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
915804083 1:158826104-158826126 CAGAACCTACTTGAGGGTGAAGG + Intergenic
915946649 1:160157341-160157363 CAAGGCCTACTTGAGGGTGGAGG - Intronic
916047694 1:161013090-161013112 CAGGGCCTACTTGAGTTTAGAGG - Intronic
916285781 1:163103418-163103440 GAGGACCTACTTGAGGGTAGAGG - Intergenic
916568240 1:166001588-166001610 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
916708378 1:167377823-167377845 CAGGGCCTACTTGAGGGTAGAGG - Intronic
916967308 1:169963105-169963127 CAGGACCTACTTAAGGGTAGAGG - Intronic
917003553 1:170386786-170386808 TAGGGCCTACTTGAGGGTTGAGG - Intergenic
917007705 1:170433549-170433571 CAGAATCTACTTGAGGATGGAGG + Intergenic
917172797 1:172196061-172196083 CTGGGTCTACTTGAGGGTGGAGG - Intronic
917212292 1:172643462-172643484 CAGGAGATACTTGGGGGGAGAGG + Intergenic
917585221 1:176419278-176419300 GGGGGCCTACTTGAGGGTAGAGG - Intergenic
917703500 1:177605297-177605319 TGGCATCTACTTGAGGGTGGAGG + Intergenic
917820821 1:178762013-178762035 CAGGGCCTACTTGAGGGTGGAGG - Intronic
918481209 1:184978668-184978690 CAGGGCCTATTTGAGGGTGGAGG + Intergenic
918852821 1:189714311-189714333 CAGGACCTACTTGACAGTGGAGG + Intergenic
918858709 1:189793729-189793751 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
919617514 1:199825955-199825977 TGGGAACTACTTGAGGGTGGAGG + Intergenic
920056574 1:203197204-203197226 TAGGATCTCCCTGAAGGTAGGGG + Intergenic
920632535 1:207666689-207666711 TGGGATCTATTGGAGGGTAGAGG + Intronic
921095142 1:211879923-211879945 CAGGGCCTACTTGAAGGTGGGGG - Intergenic
921336197 1:214089002-214089024 TGGGATCTGCTTGAGGGTGGAGG - Intergenic
921337014 1:214098377-214098399 CAGGGTCTATTTGAGGGTGAAGG + Intergenic
921372255 1:214436231-214436253 CAGGGCCTACTTGAGGATGGAGG + Intronic
921751360 1:218798036-218798058 CAGTGTCTTCTTGAGGGTGGAGG - Intergenic
922114436 1:222597917-222597939 CACGGGCTACTTGAGGGTGGAGG - Intergenic
922251040 1:223848596-223848618 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
922259649 1:223926775-223926797 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
922852490 1:228745468-228745490 CAGGTTATACTTTAGGTTAGGGG + Exonic
923822031 1:237455405-237455427 CAGGGCCTACTTGAGGGTGGAGG + Intronic
923915541 1:238499678-238499700 TGGGATCTACTTGAGGGTGGAGG + Intergenic
924128962 1:240885734-240885756 TGGGATCTACTTGAGAGTGGAGG + Intronic
924173893 1:241369660-241369682 CAGGATATACTTAAGGGAAGAGG + Intergenic
924185107 1:241480481-241480503 TAGGGTCTATTTGAGGGTGGAGG - Intergenic
924340812 1:243029331-243029353 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
924388849 1:243528477-243528499 CAAGGCCTACTTGAGGGTGGAGG - Intronic
924559559 1:245146480-245146502 CTGGGCCTAATTGAGGGTAGAGG - Intergenic
924844550 1:247752439-247752461 AAGGGCCTACCTGAGGGTAGGGG - Intergenic
1063169241 10:3491815-3491837 CAGAATCCACTTGAGAGTGGAGG + Intergenic
1063833401 10:9983381-9983403 CAGGGCCTACTTAAGGGTAGAGG - Intergenic
1064102367 10:12474751-12474773 CTGGGTCTGCTTGAGGGTAGAGG - Intronic
1064366568 10:14714016-14714038 CAGGGCCTACTTGAGAGTGGAGG + Intronic
1064818943 10:19301700-19301722 CGGGACCTTCTTGAGGGTGGAGG + Intronic
1064824650 10:19383206-19383228 CAGGGCTTACTTGAGGGTGGAGG - Intronic
1064874022 10:19972431-19972453 CAGAGTCTACTTGAGGGTGAAGG + Intronic
1064896216 10:20240083-20240105 CAGAGCCTACTTGAGGATAGAGG - Intronic
1064912826 10:20421599-20421621 CAGGCCCTACTTAACGGTAGAGG - Intergenic
1065194184 10:23246187-23246209 CAGGGCCTATTTGAGGGTGGAGG + Intergenic
1065278172 10:24107038-24107060 TGGGATTTACTTGAGGGTGGAGG - Intronic
1065368369 10:24956293-24956315 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1065370416 10:24979457-24979479 AAGGATCTACTTTAGGGAAAAGG + Intergenic
1065602062 10:27379067-27379089 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1065828240 10:29591314-29591336 CAGGTTCTTCTTGAGGGCATGGG - Intronic
1065860421 10:29867884-29867906 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1065949471 10:30638886-30638908 CAGGTTCTTCTTGAGGGCACGGG + Intergenic
1066156343 10:32682176-32682198 CAGGGCTTACTTGAGGGTGGAGG - Intronic
1066161350 10:32734426-32734448 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1066218091 10:33308198-33308220 CAGGGTCTACTTGAGGATGGAGG + Intronic
1066462700 10:35625449-35625471 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1066679624 10:37924690-37924712 CAGGGCTTACTTGAGGGTAGAGG + Intergenic
1066735659 10:38476076-38476098 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1067162651 10:43840380-43840402 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1067915358 10:50392019-50392041 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1068114066 10:52717102-52717124 CTGGCCCTACTTGAGGGTGGAGG + Intergenic
1068271378 10:54730385-54730407 CAGGGCCTACCTGAGGGTAGAGG + Intronic
1068389795 10:56380330-56380352 CAAGTTTTACTTTAGGGTAGGGG - Intergenic
1069133673 10:64737062-64737084 CAGGGCCTATTTGAGGGTAGAGG - Intergenic
1069195772 10:65549358-65549380 TGGGGTATACTTGAGGGTAGGGG + Intergenic
1070871124 10:79754445-79754467 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1070872003 10:79763707-79763729 CATGGCCTACTTGAGGGTGGAGG - Intergenic
1071063647 10:81604501-81604523 AAGGTTATACTTGAGGGCAGTGG - Intergenic
1071144873 10:82556795-82556817 TGGGATCTACTTCAGGGTGGAGG - Intronic
1071343546 10:84669928-84669950 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071375386 10:84996983-84997005 CAGGAGCTCCTGGAGGGCAGGGG + Intergenic
1071638058 10:87276653-87276675 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071638921 10:87285879-87285901 CATGGCCTACTTGAGGGTGGAGG - Intergenic
1071656317 10:87452073-87452095 CATGGCCTACTTGAGGGTGGAGG + Intergenic
1071657186 10:87461299-87461321 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1072903812 10:99432066-99432088 TGGGACCTACTTGAGGCTAGAGG - Intergenic
1073863727 10:107776536-107776558 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
1073992122 10:109273787-109273809 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1074239847 10:111627254-111627276 TGGGATCTACTTGAGGGTGGAGG + Intergenic
1074385888 10:113016431-113016453 CTGGATGTACTTGAGGTGAGAGG + Intronic
1074418554 10:113288215-113288237 CATGAGCTACTTGAGGGCAAGGG + Intergenic
1075188095 10:120281575-120281597 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1075543434 10:123335306-123335328 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1075614845 10:123883375-123883397 CAGGACATACCTGAGGGTACAGG - Intronic
1075707288 10:124509031-124509053 CAGGGCCTACCTGAGGGTGGAGG - Intronic
1075840556 10:125498729-125498751 CAGGGCCTACTTCAGGGTGGAGG - Intergenic
1076690301 10:132220290-132220312 CAGCCTCTACCGGAGGGTAGAGG + Intronic
1076967540 11:103011-103033 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1077671589 11:4162628-4162650 CAGGTCCTACTTGAGGGTGGAGG - Intergenic
1077763269 11:5127411-5127433 CAGCATTTACTTGAGGTCAGAGG + Intergenic
1077852721 11:6089753-6089775 TGAGATCTACTTGAGGGTGGAGG - Intergenic
1077955158 11:7010407-7010429 TAGGGCCTACTTGAAGGTAGAGG + Intronic
1078395566 11:10978786-10978808 CTGGGTATACTTGAGGGTAGAGG + Intergenic
1079277216 11:19052533-19052555 TAGGATCTACTCGAGGGCATTGG + Intergenic
1079434437 11:20433209-20433231 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1079663768 11:23076836-23076858 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1079728446 11:23907601-23907623 CATGGCCTACTTGAGGGCAGAGG + Intergenic
1079777346 11:24548538-24548560 CAGTGACTACTTGAGGGTGGAGG + Intronic
1079809766 11:24982590-24982612 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1079823896 11:25166178-25166200 CAGGGCATACTTGAGGGTGGAGG - Intergenic
1079879998 11:25915099-25915121 CAGGGCCTACTTGGGGGTGGTGG + Intergenic
1080195907 11:29608461-29608483 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1080500784 11:32869118-32869140 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1080777373 11:35398498-35398520 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1081046667 11:38281923-38281945 TGGAATCTACTTGAGGGTGGAGG + Intergenic
1081222620 11:40480467-40480489 CAGGGCATACTTGAAGGTAGAGG + Intronic
1081443547 11:43107062-43107084 CAGGACCTACTTGAGCGTGGAGG - Intergenic
1082057384 11:47830694-47830716 TAGGGTCTACTTGAGGGTGGAGG + Intronic
1082193105 11:49270734-49270756 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1082641806 11:55670010-55670032 AGGGGTCTACTTGAGGGTGGAGG - Intergenic
1082921310 11:58497693-58497715 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1084450395 11:69233384-69233406 CAGGGTCTGCCTGAGGGAAGGGG + Intergenic
1085223226 11:74894248-74894270 CAGGATCTACTTGAGGGTAGAGG + Intronic
1085881140 11:80467249-80467271 TGGGGTCTACCTGAGGGTAGTGG + Intergenic
1086664188 11:89459284-89459306 AGGGGTCTACTTGAGGGTAGAGG + Intronic
1086673024 11:89570333-89570355 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1086823956 11:91472008-91472030 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1087167111 11:95016003-95016025 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1087360387 11:97151280-97151302 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1087440360 11:98176222-98176244 CAGGGCGTACTTGAGGGTGGAGG + Intergenic
1087466688 11:98516835-98516857 CAGGGTCTACTTGAAGGCGGAGG - Intergenic
1087873117 11:103324327-103324349 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1087978086 11:104575396-104575418 TGGGGTCTACTTGAGGGTAGAGG + Intergenic
1088149774 11:106730275-106730297 CAGGGCCTACTTTAGGGCAGGGG - Intronic
1088409273 11:109515317-109515339 AGGGACCTACTTGAGGGTGGAGG - Intergenic
1088418522 11:109617181-109617203 CAAGGCCTACTTGAGGGTGGAGG + Intergenic
1088418536 11:109617303-109617325 CAAGGCCTACTTGAGGGTGGAGG + Intergenic
1088420362 11:109638366-109638388 TGGGATCTACTTGAGGGGGGAGG - Intergenic
1088453184 11:110004131-110004153 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1088508285 11:110548348-110548370 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1088620390 11:111675907-111675929 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1089033185 11:115355452-115355474 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1089884902 11:121810777-121810799 CAGTGCCTACTTGAGGGTGGAGG - Intergenic
1090217067 11:124978008-124978030 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1090659889 11:128874323-128874345 CAGCATCCACTTTTGGGTAGGGG + Intergenic
1090864192 11:130682145-130682167 CAGGTCCTACTTTAGAGTAGAGG - Intronic
1091901780 12:4149886-4149908 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1092574124 12:9760543-9760565 CAGGTTCTTCTTCAGGGAAGAGG - Intronic
1092889842 12:12958993-12959015 TGGGACCTACTTGAGGGGAGAGG - Intergenic
1093030324 12:14282631-14282653 CAGGACCTACCTGAGGGCGGAGG + Intergenic
1093385050 12:18542562-18542584 TGGGATCTACTTGAGGGGCGAGG - Intronic
1093403228 12:18772970-18772992 CAGGGCCTGCTTGAGGGTAGAGG + Intergenic
1093497002 12:19769547-19769569 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1093686033 12:22054881-22054903 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1093787836 12:23213314-23213336 GGGGGCCTACTTGAGGGTAGAGG - Intergenic
1094079598 12:26518356-26518378 CAGGTCCTACTTGAGGGTGGAGG + Intronic
1094171121 12:27493166-27493188 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1094255537 12:28421363-28421385 CAGGGCCTACCTGAGGGTGGAGG - Intronic
1094407462 12:30132726-30132748 CAGGGTCTACTCGAGGGTGGAGG + Intergenic
1094464678 12:30739390-30739412 CTGGAGCCACTTGAGGGTGGAGG + Intronic
1094722591 12:33079591-33079613 GAGGGTCTACTTGAGGGTAGAGG - Intergenic
1094759329 12:33512322-33512344 TGGGATCTACTTGGGGGTGGAGG - Intergenic
1094801158 12:34037455-34037477 CAGGATCTACAGGAGAGTGGAGG - Intergenic
1095114292 12:38333448-38333470 CAGGATCTACAGGAGAGTGGAGG - Intergenic
1095118945 12:38390872-38390894 CAGTAGCTACTTTAGGGAAGGGG + Intergenic
1095186315 12:39204393-39204415 TAGAACCTGCTTGAGGGTAGAGG + Intergenic
1095241549 12:39865864-39865886 CAGGGATTACTTGGGGGTAGAGG + Intronic
1095389902 12:41693135-41693157 CTTTATCTTCTTGAGGGTAGGGG + Intergenic
1095571715 12:43690519-43690541 CGGGACCTACTTGAGGGTGGAGG + Intergenic
1095575094 12:43727670-43727692 CATGGCCTACTTGAGGGTGGAGG + Intergenic
1095601743 12:44021264-44021286 TAGGTTCTATTTGAGGGTGGAGG - Intronic
1095620068 12:44242294-44242316 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1095634569 12:44417741-44417763 CTGGACCTATTTGAGGGTGGAGG - Intergenic
1095836380 12:46643870-46643892 TGGGGTCTTCTTGAGGGTAGAGG + Intergenic
1096042978 12:48536225-48536247 CAGGGCCTACTTGAGAGCAGAGG + Intergenic
1096176015 12:49519709-49519731 CAGCCTCTGCTTGAGGGCAGAGG - Intronic
1096393399 12:51247451-51247473 CAGGATCTATTTTAGGGTAGAGG - Intronic
1096929524 12:55191167-55191189 TAGGATCTATCTGAGGGTAGAGG - Intergenic
1097358632 12:58631800-58631822 CAGGATCTACTATAGGACAGAGG - Intronic
1098283193 12:68882243-68882265 CAGCATCTACTTGAGGATGGAGG - Intronic
1098399750 12:70061911-70061933 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1098603055 12:72356370-72356392 CGGGGTCTACTTGAGGGTGGAGG + Intronic
1098765937 12:74488840-74488862 CAGGGCCTACTTGAGGATAGAGG + Intergenic
1098989910 12:77054061-77054083 CAGGGCCTACTTGAGGGTAGAGG + Intronic
1099348204 12:81529807-81529829 CAGGGGCTACTGGAGGGTAGAGG + Intronic
1099395339 12:82131701-82131723 CAGTACCTACTTGAGGGTGAGGG + Intergenic
1099404177 12:82239675-82239697 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1099634145 12:85192161-85192183 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1099647163 12:85372651-85372673 CAGGACTTACTTGAGGGTGGAGG - Intergenic
1099662849 12:85587534-85587556 TGGGGTCTACTTGAGAGTAGAGG + Intergenic
1099663197 12:85593162-85593184 CTGGGGCTACTTGAGGGTGGAGG - Intergenic
1100001771 12:89845186-89845208 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1100129091 12:91468235-91468257 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1100179874 12:92073659-92073681 TGGGACCTACTTGAGGGTGGGGG - Intronic
1100212726 12:92414252-92414274 TAGGATCTAGTTGAGGGAACTGG + Intergenic
1100344007 12:93709415-93709437 TCGGGTCTACTTGAGGGGAGAGG - Intronic
1100454507 12:94739384-94739406 CCGGGTCTACTTGAGGGTGGCGG - Intergenic
1100611165 12:96193422-96193444 CAGGACCTCCTTGAGGGATGTGG + Intergenic
1100928620 12:99580182-99580204 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1101039786 12:100743868-100743890 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1101257206 12:102990172-102990194 CAAGACCTACTTGAGGGTGGAGG + Intergenic
1101336767 12:103803632-103803654 TGGGATCTACTGGAGGGTGGAGG - Intronic
1101737908 12:107476744-107476766 CATGATCTGCTTGGGGGTGGGGG - Intronic
1101745945 12:107541749-107541771 TAGGGCCTACCTGAGGGTAGGGG + Intronic
1101759111 12:107644732-107644754 CAGGGCCTGCTTGAGGGTAAAGG - Intronic
1102649557 12:114429523-114429545 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1103032970 12:117632692-117632714 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1103511557 12:121478341-121478363 AAGGATCTACTTGAGGGTGGAGG - Intronic
1104155787 12:126130401-126130423 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1104225499 12:126828686-126828708 TGGTATCTACTTGAGGGTGGAGG + Intergenic
1104240773 12:126986908-126986930 CAGGGTCGACTTGAGGGTGGAGG + Intergenic
1104298031 12:127536380-127536402 TAGGACCTACCTGAGGGTGGAGG + Intergenic
1104330488 12:127839882-127839904 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1105224375 13:18415830-18415852 CAAGAGCTTCTTGAGGGCAGGGG - Intronic
1105313443 13:19234960-19234982 CAGGGCCTACTTGAGGCTGGAGG + Intergenic
1105576033 13:21652962-21652984 CAGGAGCTACTTGAGGACAAAGG - Intergenic
1105716617 13:23071903-23071925 CAGGACCTGCTTGAGGATAGAGG - Intergenic
1106742030 13:32654689-32654711 CAGCATCTTCTTGACGGTGGAGG - Intronic
1107082809 13:36392860-36392882 TGGGACCTATTTGAGGGTAGAGG - Intergenic
1107330311 13:39292639-39292661 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1108141778 13:47431035-47431057 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1108720870 13:53130288-53130310 GAGGATCTACCTGAGGCAAGAGG + Intergenic
1108816553 13:54298887-54298909 TGGGACCTACTTAAGGGTAGAGG + Intergenic
1108885145 13:55171114-55171136 CAGAGCCTACTTGAGAGTAGAGG + Intergenic
1108982574 13:56537339-56537361 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1109114196 13:58360466-58360488 TAGGGCCTACTTGAGGATAGAGG + Intergenic
1109374824 13:61478615-61478637 AAGGGCCTACTTGAGGGTAAAGG - Intergenic
1109400390 13:61820103-61820125 CCAGAGCTACTTGAGGGTGGAGG + Intergenic
1109760010 13:66815748-66815770 CAGGGCCTACTTGAGGCTGGAGG + Intronic
1109833470 13:67825018-67825040 TGGGATCTACTTGAGGGTTGAGG - Intergenic
1110020704 13:70466745-70466767 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1110061018 13:71038210-71038232 AAGGACCTACTTGAAGGTACAGG + Intergenic
1110149595 13:72234771-72234793 CAGGTCCTACTTGAGGATGGAGG - Intergenic
1110230294 13:73161023-73161045 CTGGGCCTACTTGAGGGCAGAGG + Intergenic
1110251647 13:73387224-73387246 AAGGACCTACTTGAGGATGGAGG + Intergenic
1110482084 13:75990536-75990558 CTGGGCCTACTTGAGGGCAGAGG + Intergenic
1110802710 13:79718293-79718315 CAGAAACTACTTAAGTGTAGAGG - Intergenic
1110829989 13:80019603-80019625 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1110866469 13:80401647-80401669 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1110875242 13:80501558-80501580 CAGGACCTACTTGAGGGCGGAGG + Intergenic
1110992054 13:82054572-82054594 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1111064262 13:83070418-83070440 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1111101414 13:83593180-83593202 TAGTACCTACTTGAGGGTGGAGG - Intergenic
1111179405 13:84642208-84642230 CAGGTCCTACTTGAGGGTGGCGG + Intergenic
1111288672 13:86131499-86131521 CTGGGACTACTTGAGGGTGGAGG - Intergenic
1111350154 13:87017829-87017851 GGGGGTCTACTTGAGGGTGGAGG - Intergenic
1111892374 13:94099948-94099970 CTGCAGATACTTGAGGGTAGAGG + Intronic
1111972399 13:94930418-94930440 CAGGGCCTACTTGAGGGTGGCGG - Intergenic
1112227402 13:97553290-97553312 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1112364604 13:98746031-98746053 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1112782701 13:102918587-102918609 CAGGGCTTACTTGAGGGTAAAGG - Intergenic
1112783229 13:102924987-102925009 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1113189803 13:107731556-107731578 TGGGACCTACTTGAGGGTCGGGG - Intronic
1113247800 13:108417971-108417993 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1113363255 13:109651538-109651560 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1113390261 13:109889764-109889786 CAGGGCCTACTTCAGGGTAGAGG + Intergenic
1114008469 14:18340337-18340359 CAGGAGCTTCTTGAGGGCAGGGG - Intergenic
1114594845 14:23902841-23902863 CAGAGTCTACTTGAGGGCGGAGG - Intergenic
1114760268 14:25306544-25306566 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1114860310 14:26510245-26510267 CATGAGCTACTTGAAGGCAGGGG - Intronic
1115341897 14:32301422-32301444 CAGGACCTACCTGAGGGTGGAGG - Intergenic
1115391757 14:32861978-32862000 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1116157176 14:41220292-41220314 CGGGACCTACTTGAGGGTGGAGG + Intergenic
1116182574 14:41553868-41553890 CAGGACCTACTTGAGTGTGGAGG + Intergenic
1116358735 14:43965696-43965718 CAGGGACTACTGGAGGGTGGAGG - Intergenic
1116553710 14:46275671-46275693 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1116568597 14:46485522-46485544 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1116578616 14:46608790-46608812 CAGGGCCTACTTGAAGGTAGAGG - Intergenic
1116648355 14:47559243-47559265 TGGGACCTACTTGATGGTAGAGG - Intronic
1116737874 14:48717179-48717201 CAGGGCCTACCTGAGGGTGGAGG - Intergenic
1116805236 14:49488084-49488106 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1116816606 14:49590023-49590045 CAGGGCCTACTTGAGGGTAGAGG + Intronic
1117838638 14:59833688-59833710 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1118081204 14:62362755-62362777 CAGGCCCTACTTGAAGGTAGAGG - Intergenic
1118115168 14:62767660-62767682 CAGAACCTACTGGAGGGTGGAGG + Intronic
1118536030 14:66765598-66765620 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1118598819 14:67457115-67457137 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1118680428 14:68236045-68236067 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1119115984 14:72021932-72021954 TGGGGTCTACTTGAGGGTGGGGG - Intronic
1119489862 14:75022151-75022173 CTGGGCCTACTTGAGGGTGGAGG + Intronic
1119906590 14:78309458-78309480 CAGGGACTACTTGAGGGTGGAGG - Intronic
1120030881 14:79639370-79639392 TGAGGTCTACTTGAGGGTAGAGG - Intronic
1120820273 14:88905814-88905836 TGGGAACTACTTGAGGGTGGAGG - Intergenic
1121068262 14:90990863-90990885 TAGGGCCTACTTGAGGGGAGAGG + Intronic
1121163790 14:91771921-91771943 CAGAGCCTACTTGAGGGTGGAGG + Intronic
1121449298 14:93997192-93997214 CAGGATCCACCTGTGGGTGGAGG - Intergenic
1121740770 14:96250899-96250921 CAGGGCCTGCTGGAGGGTAGGGG + Intronic
1121798022 14:96751870-96751892 CAGGGCCTACTTGGGGGTGGAGG + Intergenic
1122036424 14:98952444-98952466 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1122380151 14:101297416-101297438 TGGGGTCTACTTGAGGATAGAGG + Intergenic
1123391674 15:19880924-19880946 CAAGAGCTTCTTGAGGGCAGGGG - Intergenic
1123769664 15:23516097-23516119 GAGGATCTACTTGAGGGTGGAGG - Intergenic
1124674459 15:31671922-31671944 CGGGACCTACTTGAGGATGGAGG - Intronic
1125091767 15:35801394-35801416 AAGGATATACGTGAAGGTAGGGG - Intergenic
1125780755 15:42264858-42264880 CTGGGCCTACTTGAGGGTGGAGG - Intronic
1125873782 15:43126141-43126163 ACGGACCTACTTGAGGGTGGAGG + Intronic
1126213590 15:46128818-46128840 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1126227131 15:46284054-46284076 TAGGGCCTACTTGAGGGTAGAGG - Intergenic
1126502485 15:49361401-49361423 CAGGACCTACTTGAGGGAGGAGG - Intronic
1127163640 15:56219518-56219540 TAGGTCCTACTTGAGGGTAGAGG - Intronic
1127188618 15:56506466-56506488 CTGGATCAACTTGAGCCTAGAGG - Intergenic
1127320647 15:57841867-57841889 CAGGGCCTTCTTGAGGGTGGAGG - Intergenic
1128369327 15:67028758-67028780 CAGGGCCTACTTGAGAGTAAAGG + Intergenic
1129081807 15:73047903-73047925 ACGGGTCTACTTTAGGGTAGAGG - Intergenic
1129585425 15:76858621-76858643 CAGGGCCTACTTGAGGGTAGAGG - Intronic
1129956597 15:79642773-79642795 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1129965684 15:79733419-79733441 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1131639697 15:94278727-94278749 CACGGCCTACTTGAGGGTAGAGG - Intronic
1131893592 15:97001601-97001623 AATGATCTACTTGAGGATATGGG - Intergenic
1131893706 15:97003011-97003033 AATGATCTACTTGAGGATATGGG - Intergenic
1131956177 15:97738678-97738700 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1131982920 15:98013000-98013022 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1133102631 16:3488404-3488426 AAGGATCTCCTATAGGGTAGGGG + Intergenic
1133657310 16:7878315-7878337 CAGGATCTACTTGAGGGAGGAGG + Intergenic
1134284808 16:12851544-12851566 TGGGCTCTACTTGAGGGTGGAGG + Intergenic
1134373684 16:13649730-13649752 CAGGACCTAGTTGAGGGAAGAGG - Intergenic
1134433236 16:14231540-14231562 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1134657597 16:15958929-15958951 CAGCATCTACTAGGGGGTAGAGG - Intronic
1135128792 16:19834638-19834660 CAGGATCTACATGAGTGTTTTGG + Intronic
1135246931 16:20864970-20864992 TGGGGTCTACTTGAGGGTAGAGG + Intronic
1135247540 16:20869926-20869948 CAGGACCTCCTTAGGGGTAGGGG - Intronic
1135469305 16:22715194-22715216 CAGGGCCTACTTGTGGGTGGAGG + Intergenic
1136075176 16:27812238-27812260 CAGGAGATCCTTGAGGGCAGGGG - Intronic
1136075334 16:27813246-27813268 CAGGACCTACTTGAAGGTGGAGG - Intronic
1136601380 16:31292417-31292439 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1136678016 16:31931959-31931981 CAGGACCTACTTGAGGGTGGAGG + Intergenic
1137230408 16:46560333-46560355 CAAGAGCTTCTTGAGGGCAGGGG + Intergenic
1138093174 16:54193222-54193244 CATGAGCTCCTTGGGGGTAGGGG + Intergenic
1138720975 16:59078645-59078667 TGGGATCTACTTGAGGGCAGAGG - Intergenic
1138760688 16:59540305-59540327 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1138848792 16:60600705-60600727 TGGGATCTACTTGAGGGTGGAGG - Intergenic
1139113734 16:63923868-63923890 TAGGACCTACTTGATGGTGGAGG + Intergenic
1139154189 16:64421303-64421325 CAGGGTCTACTTGAGGGTGTAGG - Intergenic
1139275396 16:65723194-65723216 CAGGACCCACTTGAGGGTGGAGG - Intergenic
1139487690 16:67267606-67267628 GGGGATCTACTTGAGGGCATGGG - Intronic
1140552330 16:75880148-75880170 TTGGTTCTACTTGAGGGTGGAGG - Intergenic
1140572791 16:76128307-76128329 CAGGACCTACTTGAGAGCAGAGG - Intergenic
1140591808 16:76362737-76362759 CAGAACCTAATTGAGGGTGGAGG + Intronic
1140942129 16:79731983-79732005 CAGGGCCCACTTGAGGGTGGAGG + Intergenic
1141128474 16:81418022-81418044 CAGTTCCTACTTGAGGGTGGAGG - Intergenic
1141348719 16:83273338-83273360 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1141816792 16:86416061-86416083 CAGCATCTAATTGAGGATAGAGG - Intergenic
1142317839 16:89360059-89360081 GGGGGTCTACTTGAGGGGAGAGG - Intronic
1142453142 16:90196132-90196154 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1143124666 17:4634018-4634040 CAGCATCTACTTGTGGACAGAGG + Intronic
1144134417 17:12279616-12279638 TGGGGCCTACTTGAGGGTAGCGG - Intergenic
1144383222 17:14723726-14723748 GGGGGCCTACTTGAGGGTAGAGG + Intergenic
1144428057 17:15163650-15163672 CAGGGTCTACTTGAGGATTGAGG + Intergenic
1144817943 17:18049605-18049627 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1146532171 17:33617486-33617508 CAGGGACTACTGGAGGGTGGAGG + Intronic
1147501031 17:40963717-40963739 CAGGATCTGCTTGAGGCCATTGG + Exonic
1147761015 17:42797395-42797417 CAGTATGTTCTTGTGGGTAGAGG + Intronic
1148317699 17:46717972-46717994 CCAGATCTACTTGGGGCTAGTGG + Intronic
1149128189 17:53260890-53260912 CAGGGCCTACTTGAGGGTAAAGG + Intergenic
1149133943 17:53342165-53342187 CAGGGCCTACTTGAGGTTGGAGG + Intergenic
1149395224 17:56234505-56234527 CGGGACCTACTTGAGGGTGGAGG - Intronic
1150048469 17:61936152-61936174 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1150057147 17:62028380-62028402 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1150171462 17:63000067-63000089 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1151021241 17:70619758-70619780 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151060714 17:71090576-71090598 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151069811 17:71196040-71196062 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151530118 17:74698693-74698715 CAGGGCCTACTTGAGGATGGAGG + Intronic
1151899233 17:77000864-77000886 CAGGGTCTATTTGAGGGTGGCGG + Intergenic
1153672361 18:7424045-7424067 CTGGGTCTACTTGACGGGAGAGG - Intergenic
1153723794 18:7935823-7935845 CAGGGTCTACTTTAGGGTGGAGG - Intronic
1153760386 18:8325318-8325340 TGGGACCTACCTGAGGGTAGAGG - Intronic
1154114729 18:11602867-11602889 TAGGACCCACTTGAGGGTGGAGG + Intergenic
1154528984 18:15323617-15323639 CAAGAGCTTCTTGAGGGCAGGGG + Intergenic
1155257174 18:24009037-24009059 CAGGGTCTGCTTGAGGGTAGAGG + Intronic
1155262509 18:24058148-24058170 CAGGGTCTACTTGAGGGTGGAGG + Intronic
1155576917 18:27258618-27258640 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1155931282 18:31711411-31711433 CTGGGTCTACTTGAGGATGGAGG - Intergenic
1156067872 18:33166933-33166955 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1156618736 18:38822346-38822368 CAGGGCCTACTTGAAGGTGGAGG + Intergenic
1156928491 18:42612258-42612280 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1157144343 18:45146243-45146265 CACAACCTACTTGAGGGTGGAGG - Intergenic
1157170193 18:45396824-45396846 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1157778238 18:50414109-50414131 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1157987790 18:52459353-52459375 CGGTACCTACTTGAGGGTGGAGG - Intronic
1158057024 18:53293626-53293648 CAGGGCCTACTTGAAGGTATAGG - Intronic
1159485113 18:69045760-69045782 TGGGACCTACTTGAGGGTGGAGG - Intronic
1159524513 18:69570028-69570050 TGGGATCTACTTGAGGGAGGAGG + Intronic
1159732337 18:72044478-72044500 CAAGACCTACTTGAGGGTGGAGG + Intergenic
1159791261 18:72782002-72782024 CAGAACCTACTTGAGGGTGGAGG - Intronic
1159905538 18:74087390-74087412 CAGGTCCTACTTGAGGGTGGAGG - Intronic
1160138880 18:76300996-76301018 TAGGACCTGCTTGAGGGTAGAGG + Intergenic
1160225518 18:77008376-77008398 CAGAAACTACCTGCGGGTAGTGG + Intronic
1160275800 18:77433946-77433968 CAGGATTTTCATGAGGGTAGGGG - Intergenic
1160280905 18:77489764-77489786 CAGGGCCTACTGGAGGGTGGAGG + Intergenic
1160319657 18:77878414-77878436 CAGGGCCTACTGGAGGGTGGAGG - Intergenic
1160644344 19:172634-172656 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1162099267 19:8330013-8330035 GAGGAGCTACTTGAGGTCAGAGG + Intronic
1163181040 19:15602176-15602198 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1163887728 19:19982857-19982879 CAGGGTCTGCTTGAGAATAGAGG + Intergenic
1163965836 19:20746450-20746472 CAGGGTCTACTTGAGAGTAGAGG - Intronic
1165777041 19:38410849-38410871 CTGTATCCACTTGGGGGTAGGGG + Intronic
1166025518 19:40080662-40080684 CAGGGCCTACTTGAGAGTAGAGG + Intronic
1166200176 19:41232297-41232319 TAGGAGCAACTTGAGGGCAGAGG - Intronic
1167989166 19:53343159-53343181 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1168374518 19:55865141-55865163 CAGGGCCTACTTGAGAGCAGAGG - Intronic
925810920 2:7699660-7699682 CAGGGCCTACTGGAGGGTGGAGG - Intergenic
926072056 2:9904261-9904283 AAGGGCCTACTTGAGGGTGGAGG - Intronic
926277715 2:11417340-11417362 CAGGTGATCCTTGAGGGTAGGGG - Intergenic
926557231 2:14373279-14373301 CAGGGAGTACTTGAGGGTGGAGG + Intergenic
926981864 2:18580925-18580947 TAGGGCCTACTTGAGGGTGGAGG + Intronic
927046622 2:19285622-19285644 TGGGACCTACTTGAGGGTACAGG + Intergenic
927128090 2:20031868-20031890 CAGGGCCTACCTGAGAGTAGAGG + Intergenic
927381964 2:22489596-22489618 CAGGATCTACTTGAGGGTAGAGG + Intergenic
927420028 2:22921025-22921047 CGGGACCTAGTTGAGGGTGGAGG + Intergenic
927761552 2:25760351-25760373 TAGCATCTACTTAAGGTTAGTGG - Intronic
927863710 2:26575955-26575977 CTGGAAGTACTTGAGGGTGGTGG - Exonic
928452124 2:31386469-31386491 CAGCAGCTCCTTGAGGGTTGAGG + Exonic
928470649 2:31572290-31572312 TGGGGTCTACTTGAGGGTGGAGG + Intronic
928669140 2:33582527-33582549 AGGGGTCTACTTGAGGGTGGAGG + Intergenic
928886139 2:36150663-36150685 TGGGATCTACTTGAGGGTAGAGG + Intergenic
929234611 2:39592906-39592928 CAGTAGCTACTTGTGGCTAGTGG + Intergenic
930086779 2:47503387-47503409 CAGGAGCTACCTGGGGGTTGAGG + Intronic
930211299 2:48640515-48640537 CTGGGTCTACTTAAGGGTGGAGG + Intronic
930302531 2:49634978-49635000 CAAGTTCTACTTGAAGGTGGAGG - Intergenic
930558218 2:52927224-52927246 CAGGGCCTATTTGAGGGTGGAGG + Intergenic
930918901 2:56726857-56726879 TAGGACCTACTTGAGAGTGGTGG - Intergenic
930954645 2:57192473-57192495 AAGAATCTTCTTGAGGGTGGAGG - Intergenic
930954759 2:57193236-57193258 AAGAATCTTCTTGAGGGTGGAGG - Intergenic
931425749 2:62169476-62169498 CTGGGTCTACTTGAGGGTGGAGG - Intergenic
931470856 2:62536602-62536624 TAGGCTCTACTTGAGGGTAGGGG - Intergenic
931543778 2:63358071-63358093 TGGGGTCTACTTGAGGGTGGAGG + Intronic
931921672 2:67023785-67023807 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
932506318 2:72235392-72235414 CAGGGCCTACTTGAAGGTGGAGG + Intronic
932532987 2:72557635-72557657 TAAGGTCTACTTGAGGGTGGAGG + Intronic
932614296 2:73222343-73222365 CAGGAGCTGCCTGAGGGTGGAGG + Intronic
932913304 2:75828318-75828340 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
933355489 2:81205264-81205286 CAGGGCCTACTTGAGGGGAAAGG - Intergenic
933439321 2:82291405-82291427 TAGGGTCTACTTGAAGGTGGAGG - Intergenic
933451783 2:82463141-82463163 CAGGGTCTATTTGAGGGTGAAGG - Intergenic
933512683 2:83261232-83261254 CAGGGTCTACTTGAAGGTGGAGG + Intergenic
934689340 2:96346351-96346373 TAGGGTCTACTTGAGGGTGGTGG + Intronic
935192682 2:100791584-100791606 AGAGATCTACTTGAGGGCAGTGG + Intergenic
935521826 2:104116136-104116158 CAGGACCTACTCGAGTGTGGAGG + Intergenic
935665965 2:105512980-105513002 GAGGAACTACTTGAGGGTGGAGG - Intergenic
936752767 2:115666050-115666072 CAAGGTCTACTTGAGGGTGGAGG - Intronic
936791241 2:116155815-116155837 TGGGATCTACTTGAGGTTGGAGG - Intergenic
936857124 2:116972054-116972076 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
937441953 2:121923277-121923299 GAGGGCCTACTTGAGGGTGGAGG - Intergenic
937521551 2:122718943-122718965 TAGGGTCTTCTTGAGGGTGGCGG + Intergenic
937608320 2:123827860-123827882 TGGAGTCTACTTGAGGGTAGAGG + Intergenic
937752881 2:125499231-125499253 CAGGGTCTACTTGAGAGGAGAGG - Intergenic
938095839 2:128462711-128462733 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
938215975 2:129515634-129515656 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
938252508 2:129826917-129826939 CGGGACCTACATGAGGGTCGGGG + Intergenic
938485277 2:131700590-131700612 CAGGGCCTATGTGAGGGTAGAGG - Intergenic
938528080 2:132155023-132155045 CAAGAGCTTCTTGAGGGCAGGGG + Intronic
938623412 2:133082039-133082061 CAGGGCCTACTTGAGGGTGGAGG - Intronic
939197095 2:138986799-138986821 CAGGACATACTTGAGGGTGAAGG - Intergenic
939274505 2:139983700-139983722 CTGGACCTACTTGAGGGCAGAGG - Intergenic
939526148 2:143296820-143296842 TGGGATCTACTTGAGGGGAGAGG - Intronic
939945956 2:148411013-148411035 CAGGACCCACTTGAGCGTGGAGG - Intronic
940038798 2:149337790-149337812 TGGGGTCTACTTGAGGGTAAAGG - Intronic
940063614 2:149600574-149600596 CAGGGTCTATTTGAGGGTGGAGG + Intergenic
940527047 2:154829283-154829305 CAGGGCCTACTTGAGGGTAGCGG - Intronic
940535054 2:154930710-154930732 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
940547519 2:155107521-155107543 CAGGACCTACTTTAGGGTGGAGG + Intergenic
940628665 2:156209594-156209616 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
940808162 2:158211023-158211045 CAGGGCCTACTTGGGGGTTGGGG + Intronic
940831681 2:158473640-158473662 TTGGGTCTACTTGAGGGTAGAGG + Intronic
941078711 2:161035525-161035547 TAGCGTCTACTTGAGGATAGAGG - Intergenic
941112777 2:161434733-161434755 AGGGTCCTACTTGAGGGTAGGGG - Intronic
941239856 2:163023871-163023893 AGGGACCTACTTGAGGGTGGAGG - Intergenic
941566006 2:167109024-167109046 TGGGGCCTACTTGAGGGTAGAGG - Intronic
941653830 2:168122188-168122210 GAGGGCCTACTTGAGGGTGGAGG - Intronic
942159100 2:173163280-173163302 AGGGATCTACTTGAAGGTGGAGG - Intronic
942886464 2:180930825-180930847 CAGGGCCTACTTGAGAGTTGGGG - Intergenic
942917579 2:181330194-181330216 TGGGATCTACTTGAGGGTGAAGG + Intergenic
943030048 2:182675110-182675132 TGGGTCCTACTTGAGGGTAGAGG - Intergenic
943053542 2:182946426-182946448 CAGGGCCTACTTGAAGGTAGAGG + Intronic
943155564 2:184170508-184170530 CAGGGACTACTAGAGGGGAGAGG + Intergenic
943177240 2:184492374-184492396 CAGGTCCTACTTAAGGGTGGAGG + Intergenic
943205483 2:184887959-184887981 CAGGGCCTACTTGAGAGTGGAGG + Intronic
943322370 2:186461469-186461491 TGGGATCTACTTGATGGGAGAGG + Intergenic
943323838 2:186474919-186474941 CTGGGCCTACTTGACGGTAGAGG + Intergenic
943351346 2:186799890-186799912 CAGGGCTTACTTGAGGGTAGAGG - Intergenic
943498372 2:188653366-188653388 CAGGGCCTACTTAAGGGTTGGGG - Intergenic
943611476 2:190039675-190039697 CGGGGTCTACTTGAGGGGAGAGG - Intronic
944021298 2:195107696-195107718 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
944269538 2:197765848-197765870 TGGGGTCTACTTGAGGGTGGAGG - Intronic
944537143 2:200722340-200722362 TGGGGTCTACTTGAGGGTTGTGG + Intergenic
944576363 2:201094868-201094890 TGGGATCTACTTGAAGGTGGAGG + Intergenic
945342723 2:208676388-208676410 CAGGGCCTACTTGAGGGTGGAGG - Intronic
945798588 2:214395683-214395705 CAGGGCCTACTTGAGGGTGGAGG - Intronic
945829593 2:214766978-214767000 CAGAGTCTACTTGAGTGTGGAGG - Intronic
946073498 2:217054229-217054251 TAGGAGCAGCTTGAGGGTAGGGG + Intergenic
946135067 2:217639226-217639248 CAGGGCCTACTTGAGGGTGCAGG + Intronic
946591307 2:221251096-221251118 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
947060388 2:226157890-226157912 CAGGGTCTACTTGAGGGTAGAGG - Intergenic
947438440 2:230094248-230094270 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
947485567 2:230545413-230545435 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
948004381 2:234595297-234595319 CAGGAGTTACTTGAGGGGTGGGG + Intergenic
948043467 2:234923867-234923889 CAATGTCTACTTGAGGGTGGAGG - Intergenic
948534445 2:238635554-238635576 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
948552282 2:238781615-238781637 CAGGGCCTGCTTGAGGGTGGAGG + Intergenic
948850288 2:240702331-240702353 GAGGCTCTACGAGAGGGTAGGGG - Intergenic
949084580 2:242140797-242140819 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1169024641 20:2358861-2358883 CAGGGCCTACTTGGGGGTGGAGG - Intergenic
1169514679 20:6303051-6303073 CGGGACCTACCTGAGGGTGGAGG - Intergenic
1170053002 20:12167328-12167350 TAGAGTCTACTTGAGGGTGGAGG - Intergenic
1170103903 20:12733002-12733024 CAGGACCTACTTAAGGGTGGAGG + Intergenic
1170168677 20:13387021-13387043 CAAGACCTACTTGAGAGTGGAGG - Intergenic
1170515407 20:17124433-17124455 TAGGGTCTACTTGAGGTTGGAGG + Intergenic
1170521195 20:17187313-17187335 CTGGATCTACTTGAGGGTGGAGG + Intergenic
1170798096 20:19567493-19567515 TGGGACCTACTTGAGGGTAGGGG + Intronic
1170843021 20:19939346-19939368 CTGGATCTATTTAAAGGTAGAGG - Intronic
1172402469 20:34661366-34661388 CTGGGCCTACTTGAGGGTGGAGG - Intronic
1172863860 20:38079415-38079437 CCGGGACTACTTGAGGGTGGAGG - Intronic
1173517653 20:43676274-43676296 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1173961491 20:47075857-47075879 AAGGACCTACTTGAGGGTAGAGG - Intronic
1174936126 20:54871021-54871043 CAGGGTCTACTTGAGTGGGGAGG + Intergenic
1175747375 20:61467530-61467552 AAGGATCTCCTTGAGGCCAGGGG + Intronic
1176281160 20:64313291-64313313 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1176768417 21:13044886-13044908 CAAGAGCTTCTTGAGGGCAGGGG - Intergenic
1176865637 21:14052968-14052990 TAGGATCTACATGAGGGTGGAGG - Intergenic
1177370950 21:20202469-20202491 CGGGGCCTACTTGATGGTAGAGG + Intergenic
1178060261 21:28845951-28845973 CTGGGCCTACTTGAGGGCAGAGG - Intergenic
1178203447 21:30435719-30435741 TGGGATCTACTTGAGGGAGGAGG - Intergenic
1178462859 21:32818651-32818673 CAGCATCCACTTTAGGGTACAGG + Intergenic
1178489521 21:33040235-33040257 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1178508651 21:33183828-33183850 TTAGACCTACTTGAGGGTAGAGG - Intergenic
1179092174 21:38276543-38276565 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1179121854 21:38554659-38554681 CAGGGGCTGCTTGAGGGTGGAGG + Intronic
1179164147 21:38922498-38922520 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1179174510 21:38997959-38997981 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1179463288 21:41552273-41552295 TAGAGTCTACTTGAGGGTGGAGG - Intergenic
1180198388 21:46210680-46210702 CAGGCTCTGCTTGAGGTTCGTGG - Exonic
1180432973 22:15271154-15271176 CAGGAGCTTCTTGAGGGCAGGGG - Intergenic
1181786147 22:25228604-25228626 CAGGACCTACTGGAAGGTTGGGG + Intronic
1182044377 22:27262814-27262836 CAGTTTCTACTTGATGGAAGAGG + Intergenic
1182263122 22:29090368-29090390 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1182653750 22:31873290-31873312 CAGGATCTCTGTCAGGGTAGAGG - Exonic
1183237752 22:36632373-36632395 CAGGACCAACTTGATGGCAGGGG - Intronic
1184156534 22:42671206-42671228 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1184647621 22:45904678-45904700 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
949225462 3:1688422-1688444 TGGGACCTACTTGAGGGTGGAGG - Intergenic
949376384 3:3394596-3394618 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
950598001 3:14002668-14002690 CAAGCTCTACTTGATGGTGGAGG - Intronic
950685165 3:14611883-14611905 CAGGCTGTACTGGAGTGTAGTGG - Intergenic
951287384 3:20830934-20830956 CAGGGCCTACTTGAGGGCAGAGG - Intergenic
951517912 3:23582058-23582080 CATGGCCTACTTGAGGGTGGAGG - Intronic
951571674 3:24070500-24070522 CAGGGCTTACTTAAGGGTAGAGG - Intergenic
951732810 3:25829365-25829387 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
952228094 3:31399929-31399951 TGGGATCTGCTTGAGGGTGGAGG - Intergenic
952515520 3:34100557-34100579 CATGATCATCTTGATGGTAGAGG + Intergenic
952667631 3:35926022-35926044 TGGGGACTACTTGAGGGTAGAGG - Intergenic
954038791 3:47868650-47868672 CAGCATCAACTGGAGGGCAGAGG - Intronic
954462221 3:50633878-50633900 CAGGGTTTACTTGTGGGTGGAGG - Intronic
955149138 3:56349565-56349587 CAGGGCCTACTTGAGGGTTGAGG + Intronic
955442140 3:58967864-58967886 TGGGGTCTACTTGAGGGTGGAGG - Intronic
955846078 3:63164316-63164338 TGGGGTCTATTTGAGGGTAGAGG + Intergenic
955886246 3:63601500-63601522 CAGGGTCTACTTGAGAGTGGAGG - Intronic
956350758 3:68333463-68333485 AGGGACCTACTTGAGTGTAGAGG + Intronic
956447360 3:69338670-69338692 CGAGGCCTACTTGAGGGTAGAGG + Intronic
956577457 3:70768970-70768992 CGGGGCCTACTTGAGGGTAGAGG - Intergenic
956724674 3:72147011-72147033 CAGCGCCTACTTGAGGGTGGAGG - Intergenic
956797179 3:72727777-72727799 CAGGCTCACCTTGTGGGTAGTGG + Intergenic
956943266 3:74189552-74189574 AGGGGTCTACTTGAGGGTGGAGG - Intergenic
957446500 3:80318788-80318810 CCGGACCTACTTGAGGGTGGAGG + Intergenic
957633460 3:82748924-82748946 CAGGGCCCACTTGAGGATAGTGG + Intergenic
957746488 3:84349518-84349540 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
957901355 3:86497568-86497590 AGGGGTCTACTTGAGGGTAGAGG + Intergenic
958460780 3:94392021-94392043 CAGGACTTACTTGAGGATGGTGG + Intergenic
958589782 3:96141017-96141039 CTGGGCCTACTTGAGGGTGGAGG + Intergenic
958822627 3:98993053-98993075 TAGGTTCTACTTGAGGATGGAGG - Intergenic
958843278 3:99234635-99234657 TGAGGTCTACTTGAGGGTAGAGG - Intergenic
958874735 3:99603289-99603311 CGGGACCTACTTGAGGGTGGAGG - Intergenic
959098335 3:101981838-101981860 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
959166236 3:102782060-102782082 CTGGGTCTACTTGAGGGTGGAGG + Intergenic
959213128 3:103414613-103414635 AGGGGCCTACTTGAGGGTAGAGG + Intergenic
959310803 3:104734402-104734424 TAGGACCTACTTGAGGGTGGAGG - Intergenic
959392820 3:105797430-105797452 CAGGGGCTACTTGAGGGTGAAGG + Intronic
959451392 3:106507401-106507423 CAGGGCCTACTTGAGGGCAGAGG - Intergenic
959881916 3:111453666-111453688 TAGGGCCTACTTTAGGGTAGAGG + Intronic
960043279 3:113171693-113171715 TCAGGTCTACTTGAGGGTAGAGG - Intergenic
960098161 3:113708194-113708216 CAGAGCCTACTTGAGGGTAGAGG + Intergenic
960145947 3:114202704-114202726 CAGGACCTACTTAAGGGTGGAGG + Intergenic
960347393 3:116550920-116550942 CAGGGCATACCTGAGGGTAGAGG - Intronic
960782680 3:121337083-121337105 TGGGGTCTACTTGAGGGTGGTGG + Intronic
961578313 3:127856710-127856732 CGGGACCTACTTGAAGGTGGAGG - Intergenic
961614385 3:128167281-128167303 CTTGATCTCTTTGAGGGTAGGGG + Intronic
961987231 3:131149147-131149169 TGGGGCCTACTTGAGGGTAGAGG - Intronic
962067764 3:132000442-132000464 CATGATCTACTTGTGGGGAGAGG + Intronic
962420505 3:135225018-135225040 TGGGATTTACTTGAGGGGAGGGG + Intronic
962451726 3:135524357-135524379 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
962472623 3:135725858-135725880 CAGGGCCTGCTTGAGGGTGGAGG - Intergenic
962478324 3:135777346-135777368 CAAGGCTTACTTGAGGGTAGAGG + Intergenic
962513042 3:136121420-136121442 CAGGGCCTGCTTGAGGGTAGAGG + Intronic
962691675 3:137905406-137905428 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
962865564 3:139445653-139445675 CAGGAGCTTCTTGAGGACAGGGG + Intergenic
962881883 3:139586211-139586233 TGGGGTCTACTTGAGGGTGGAGG + Intronic
963075077 3:141338631-141338653 CAGGGTCTACTTGACAGTGGAGG + Intronic
963208552 3:142662405-142662427 CAGGGTCTATTGGGGGGTAGGGG + Intronic
963411167 3:144930053-144930075 CAGGACTTACTTGAGGATGGAGG + Intergenic
963578086 3:147088463-147088485 GGGGGCCTACTTGAGGGTAGAGG - Intergenic
964177464 3:153841457-153841479 TGGGATCTACTTGAGGGTGGAGG - Intergenic
964366336 3:155954420-155954442 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
964529865 3:157655853-157655875 TGGGGTCTACTTGAGGGTGGAGG - Intronic
964687694 3:159415452-159415474 CAGGGTGTACTTGAGGGTAGAGG - Intronic
964868441 3:161287536-161287558 TGGGACCTACTTGAGGGTGGAGG + Intergenic
964987350 3:162760460-162760482 CAGGACCTATTTGAAGGTGGAGG - Intergenic
965043869 3:163550005-163550027 CAGGGTCTCCTGGAGGGTTGAGG - Intergenic
965058814 3:163755872-163755894 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
965065823 3:163847354-163847376 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
965193265 3:165559430-165559452 CAGAGTCTACTTGAGGGTGGAGG - Intergenic
965241213 3:166200898-166200920 TGGAATCTACTTAAGGGTAGAGG + Intergenic
965295371 3:166938568-166938590 CAGGGTCTATTTGAAGGTGGAGG - Intergenic
965464586 3:169012119-169012141 CAGGACCTACTTGAGGGTGTAGG - Intergenic
965725925 3:171715923-171715945 TAGGGCCTACTTGAGGGTGGGGG - Intronic
965877527 3:173345321-173345343 CAGGGCCTACTTGAAGGTAAAGG + Intergenic
965903202 3:173669425-173669447 AAGGATCTACCAGAAGGTAGCGG - Intronic
965948011 3:174266211-174266233 CAGGGCCTACTTCAGGGTGGAGG - Intronic
966453539 3:180089843-180089865 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
966651846 3:182310223-182310245 TAGGGCCTACTTGAGGGTAGAGG - Intergenic
966654621 3:182341689-182341711 CAGGACCTACTTGAGGATGGAGG + Intergenic
966671779 3:182535330-182535352 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
966771172 3:183504860-183504882 CAGGGCCTACTTGAGGGTAGAGG - Intronic
966818346 3:183906786-183906808 AAGGGTCTACCTGAGGGTAGAGG + Intergenic
967374313 3:188783542-188783564 TGGGATCTACTTGAGGGTGGAGG + Intronic
967401146 3:189062274-189062296 TGGGGACTACTTGAGGGTAGAGG + Intronic
967693454 3:192504176-192504198 CAGGGCCTACTTGAGAGTGGAGG + Intronic
968154793 3:196371202-196371224 CAGTAGCCACTTGTGGGTAGTGG - Intronic
970010431 4:11452911-11452933 TGGGTTCTACTTGAGGGTGGAGG - Intergenic
970327177 4:14938195-14938217 CTGGGTCTACTTGAGAGTGGGGG - Intergenic
970624706 4:17863984-17864006 CAGGGCCTACTTGAGGGCAGAGG + Intronic
970745464 4:19289475-19289497 TGGGATCTACTTGAGGGTGGAGG - Intergenic
971106486 4:23530355-23530377 CAGGGTCTACTTGAAGGTGGAGG + Intergenic
971243765 4:24911344-24911366 CAGGAGTTCTTTGAGGGTAGGGG + Intronic
971434940 4:26610605-26610627 CAGGGCCTACTTGATGGTAGAGG - Intronic
971461727 4:26906262-26906284 CTGGGTCAACTTGAGGGTGGAGG + Intronic
971521152 4:27552070-27552092 TGGGATCTACTTGAGGGTGGAGG - Intergenic
971542696 4:27840866-27840888 TGGGGTCTACTTGAGGGGAGAGG - Intergenic
971668929 4:29530267-29530289 TGGGGTCTACTTGAGGGCAGAGG + Intergenic
971882288 4:32392570-32392592 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
971989666 4:33875909-33875931 CGGGACCTGCTTGAGGGTGGAGG - Intergenic
972038609 4:34559540-34559562 TGGGATCTACTTGAGTGGAGAGG + Intergenic
972125913 4:35765423-35765445 CAAGACCTACTTGAGGGTGGAGG - Intergenic
972143379 4:35989669-35989691 CAGGGTCTACTTGAGGGTGAAGG + Intronic
972147131 4:36042010-36042032 TGGGGTCTACTTGAGGGGAGAGG + Intronic
972175577 4:36401822-36401844 CAGGGACTACTTGAGTGTGGAGG - Intergenic
972432954 4:39001562-39001584 TAGGATTGACTTGAGAGTAGGGG - Intronic
972724645 4:41736100-41736122 CAGGGCCTACCTGAGGGTGGAGG - Intergenic
973034180 4:45384943-45384965 CAAAATTTACTTGAGGGTGGAGG - Intergenic
973694167 4:53473640-53473662 CAGGGCCTACTTGAGGGTGGAGG + Intronic
973740368 4:53913854-53913876 CGGGGCCTACTTGAGGGTGGAGG + Intronic
973743602 4:53942051-53942073 CGGGGTCTACTGGAGGGTGGAGG + Intronic
973761046 4:54116086-54116108 CAGGACCTACCTGAGGGTAGAGG - Intronic
974063875 4:57059582-57059604 CTGGGTCTACTTGAGGGTGGAGG + Intronic
974159847 4:58124515-58124537 CAACGTCTACTTGAGGGTGGAGG + Intergenic
974515304 4:62900358-62900380 TGGGACCTACTTGAGGGTGGAGG + Intergenic
974598586 4:64045967-64045989 TAGGGCCTACTTGAGTGTAGAGG + Intergenic
974683175 4:65191345-65191367 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
974944192 4:68506183-68506205 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
974954740 4:68623496-68623518 TGGGGTCTACTTGAGGGTGGAGG + Intronic
975131239 4:70834947-70834969 CAGGGCCAACTTGAGGGTTGGGG - Intronic
976001812 4:80383168-80383190 TAGGGCCTACTTGAGGGTGGAGG + Intronic
976015840 4:80553155-80553177 TGGGGTCTACTTGAGGGTGGAGG - Intronic
976043041 4:80910660-80910682 TAGGGGCTACCTGAGGGTAGAGG + Intronic
976059968 4:81116188-81116210 CAGGACCTACTTGAGGGTGGAGG - Intronic
976318353 4:83683595-83683617 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
976452909 4:85212355-85212377 TGGGATCTACTTGAGGGTGCAGG - Intergenic
976481327 4:85549763-85549785 CAGGGCCTACTTGAGGGTAGAGG - Intronic
976721280 4:88171104-88171126 ACGGGTCTACTTGAGGGTGGAGG + Intronic
977001918 4:91515361-91515383 TGGGATCTACTTGAGGATGGAGG - Intronic
977329467 4:95619334-95619356 CAGGGCTTACTTGAGGATAGAGG + Intergenic
977403486 4:96564649-96564671 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
977476917 4:97523008-97523030 CAGGAACTACTTCAGGATAGTGG - Intronic
977508183 4:97929037-97929059 CTGGGTCTACTTGAGGGTGGAGG - Intronic
977552379 4:98456192-98456214 TGGGGTCTACTTGAGAGTAGAGG + Intergenic
977734744 4:100399917-100399939 CTGGGACTTCTTGAGGGTAGAGG - Intronic
977800736 4:101227720-101227742 CAGGGCCTACTTGAAGGTGGTGG - Intronic
977973248 4:103234570-103234592 CAGGTTCTACTTAAGGGTGGAGG + Intergenic
977987034 4:103395042-103395064 CAGGTTCTACTTAAGGGTGGAGG - Intergenic
978053195 4:104229131-104229153 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
978063499 4:104367215-104367237 CAGGGCCTACTTAAGGGTGGAGG + Intergenic
978099890 4:104825671-104825693 CAGAGTCTACTTGAGGGTGAGGG - Intergenic
978252986 4:106655605-106655627 CAGGGCCTACTTGAGAGTAGAGG + Intergenic
978390136 4:108216555-108216577 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
978391504 4:108230961-108230983 AGGGGCCTACTTGAGGGTAGAGG - Intergenic
979208482 4:118071415-118071437 CAGCACCTACTTGAGGGTGGAGG - Intronic
979262010 4:118659029-118659051 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
979281907 4:118878193-118878215 CAGGGCCTACTTGAGGGTGGAGG + Intronic
979709943 4:123767670-123767692 CTGGGCCTACTTGAGGGTAGAGG + Intergenic
979741929 4:124161793-124161815 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
980089597 4:128428583-128428605 CTGGGCCTACTTGAGGGTGGAGG - Intergenic
980144658 4:128967014-128967036 CTGGCCCTACTGGAGGGTAGGGG - Intronic
980215754 4:129851002-129851024 TAGGGTCTACTTGAGGGTGAAGG + Intergenic
980232442 4:130061998-130062020 CAGGAGCTGGTTGAGGTTAGTGG - Intergenic
980398204 4:132243663-132243685 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
980456577 4:133051889-133051911 CAGGACCTACTTGAAGATGGAGG + Intergenic
981217846 4:142192150-142192172 CAGGACCTACTTAAGGGTGGAGG + Intronic
981253719 4:142635694-142635716 TTGGGTCTACTTGAGGGTGGAGG + Intronic
981275197 4:142891357-142891379 CAGGGCCTACTTGAGAGTGGAGG - Intergenic
981295229 4:143123922-143123944 CAGGTTCTAATTGAGGGTGAAGG + Intergenic
981394209 4:144227979-144228001 CGAGGTCTACTTGAGGGTGGAGG + Intergenic
981495864 4:145391554-145391576 TGGGTTCTACTTGAGGGTGGAGG + Intergenic
981834182 4:149036184-149036206 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
983155637 4:164344211-164344233 CAGGACCTACTTGAGGGTGGAGG + Intronic
983293158 4:165831991-165832013 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
983404952 4:167316027-167316049 CAGGGCCTACTTGAGGGTTGAGG - Intergenic
983447287 4:167869497-167869519 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
983486713 4:168340801-168340823 CAGGGCCTACTTGAGTGTAGAGG - Intergenic
983853081 4:172607297-172607319 CAGGGTCTACTTGAGGGTGGAGG - Intronic
984070981 4:175111867-175111889 CAGGGCCTACTTGAGGGTAGAGG + Intergenic
984516634 4:180749495-180749517 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
984861963 4:184248711-184248733 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
985085749 4:186310654-186310676 CAGGGTCTACTTGAGACTGGGGG - Intergenic
985100995 4:186458498-186458520 CAGGATCTACTTGTGGGGGGAGG - Intronic
985839218 5:2293515-2293537 CCGGGCCTACTTGAGGGTGGAGG + Intergenic
985844364 5:2333362-2333384 CAGGGTCTCCTTTAGGGGAGGGG + Intergenic
986381019 5:7185826-7185848 CAACGCCTACTTGAGGGTAGAGG + Intergenic
986467380 5:8039242-8039264 CAGGGGCCACTTGAGGGTATAGG - Intergenic
986576426 5:9218034-9218056 TGGGGTCTACTTGAGGGTAGAGG + Intronic
986896659 5:12379169-12379191 CAGGGCCTACTTGAGGGTGAAGG - Intergenic
986998211 5:13631736-13631758 CAGGGTCTACTTGAAGGTAGGGG + Intergenic
987018557 5:13846288-13846310 TGGGGTCTACTTGAGGGTGGAGG - Intronic
987072275 5:14349880-14349902 TAGGACCTACTTGAAGGTGGAGG - Intronic
987159519 5:15126716-15126738 CAGGGCCTACTTGATGGTGGGGG - Intergenic
987388967 5:17357507-17357529 CAGAGTCTACTTGATGGTGGAGG - Intergenic
987394525 5:17409699-17409721 CAGGGCCTGCTTGAGGGTGGAGG - Intergenic
987621088 5:20339170-20339192 CAGGAGGCACTTGAGGGGAGTGG - Intronic
987747971 5:22001643-22001665 CAGGGCCTACTCGAGGGCAGAGG - Intronic
987756721 5:22106116-22106138 TGGGTTCTACTTGAGGGTGGAGG + Intronic
987787900 5:22525722-22525744 CGGGCTCTACTTGTGGGTACTGG + Intronic
987796347 5:22632049-22632071 CAGGATGTAGCAGAGGGTAGAGG + Intronic
987850339 5:23344539-23344561 CGGGACCTACTTGAGGGTGAAGG + Intergenic
988004069 5:25385078-25385100 TGGGATCTACTTGAGGGTAGAGG - Intergenic
988043788 5:25921505-25921527 TAGGGTCTCCTTGAGGGTGGAGG + Intergenic
988163266 5:27548957-27548979 CAGGATCTACTTGAGTGTGAAGG + Intergenic
988321372 5:29701478-29701500 CAGGTCCTACTTGAGGGTGGAGG - Intergenic
988329660 5:29818900-29818922 CAGGACCTACTTGAAGGTGGAGG - Intergenic
988675104 5:33425058-33425080 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
988979753 5:36555054-36555076 TGGGATCTACTTGAGGGTGTTGG - Intergenic
989461345 5:41702640-41702662 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
989491540 5:42060921-42060943 TGGGATCTACTTGAGCGTAGAGG + Intergenic
989715867 5:44462299-44462321 CAGGGACTACTTGAGGGTGAAGG - Intergenic
990024501 5:51168906-51168928 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
990091544 5:52057201-52057223 CAGGGCCTAGTTGAGGGTGGAGG - Intronic
990134099 5:52624299-52624321 CAGAGTCTACTTGAGGGTGGAGG - Intergenic
990215005 5:53521160-53521182 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
990354077 5:54948497-54948519 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
990497308 5:56361448-56361470 TGGGACCTACTTGAGGGTGGAGG - Intergenic
990831890 5:59968415-59968437 CATGGACTACTAGAGGGTAGAGG + Intronic
991169385 5:63603551-63603573 CGGGACCTACTTGAGAGTGGAGG - Intergenic
991565700 5:68002350-68002372 CAGAATCTTCTTGTGGGTAAGGG - Intergenic
991768149 5:70011447-70011469 CAGGGCCTACTCGAGGGCAGAGG - Intergenic
991847387 5:70886529-70886551 CAGGGCCTACTCGAGGGCAGAGG - Intergenic
991911428 5:71566153-71566175 CAGGATTTTCATGAGGATAGGGG + Exonic
992249002 5:74858570-74858592 CAGGGCTTACTTGAAGGTAGAGG + Intronic
992309349 5:75479451-75479473 TGGGGTCTACTTGAGGGTAGAGG - Intronic
992434432 5:76741703-76741725 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
992558629 5:77928442-77928464 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
992976208 5:82123353-82123375 TGGGTTCTACTTGAGGGTGGAGG + Intronic
993138998 5:84006559-84006581 CAGGGCCTACTTGAGAGCAGAGG + Intronic
993275894 5:85858211-85858233 TGGGGTCTACCTGAGGGTAGAGG + Intergenic
993413387 5:87598110-87598132 TGGGACCTACTTGAGGGTGGAGG - Intergenic
993697093 5:91074330-91074352 TGGGGCCTACTTGAGGGTAGAGG - Intronic
993801424 5:92347627-92347649 TGGGATCTACTTGAGGGTGGAGG - Intergenic
994228413 5:97282774-97282796 TAGAGTCTACTTGAGGGTGGAGG - Intergenic
994242989 5:97446103-97446125 TAGGTTCTACTTGAGGGTGGAGG + Intergenic
994330254 5:98496610-98496632 CAGGGCCTACTTGAGGGCAGAGG + Intergenic
994471298 5:100211539-100211561 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
994595888 5:101834409-101834431 CAGGGTCTACTTGCGGTTGGGGG - Intergenic
994610231 5:102027360-102027382 TGGGATCTACTCGAGGGTGGAGG + Intergenic
994638241 5:102370039-102370061 CAGGGCCTACTTGAAGGTGGAGG + Intergenic
994679844 5:102872905-102872927 CGGGGCCTACTTGAGGGTGGAGG + Intronic
994765099 5:103905505-103905527 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
995170626 5:109107486-109107508 TGGGGTCTACTTGAGGGTAGAGG - Intronic
995429449 5:112058051-112058073 TGGGATCTACTTGACGGTGGAGG + Intergenic
995653374 5:114396878-114396900 CAGGGCCTACCTGAGGGTAGAGG - Intronic
995717979 5:115099176-115099198 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
995943249 5:117610595-117610617 CAGGGCCTACCTGAGGGTGGAGG - Intergenic
995992898 5:118264118-118264140 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
996006173 5:118423070-118423092 CAGGGCCTACTGGGGGGTAGGGG + Intergenic
996180579 5:120414354-120414376 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
996469403 5:123842727-123842749 CAGGGCCTACTTGAGGATGGAGG + Intergenic
996588752 5:125121500-125121522 TGGAGTCTACTTGAGGGTAGAGG - Intergenic
996768312 5:127058194-127058216 CAGGGCCTAATTGAGGGTGGAGG - Intronic
997046252 5:130321647-130321669 CAAGGCCTACTTGAGGGTGGAGG + Intergenic
997609466 5:135204812-135204834 TGGGGTCTACTTGAGGGTGGAGG - Intronic
997641859 5:135454510-135454532 TGGGGTCTACTTGAGGGTGGGGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998692905 5:144606866-144606888 CAGAGCATACTTGAGGGTAGAGG - Intergenic
998776065 5:145604248-145604270 TAGGGCCTACTTGAGGGTGGAGG - Intronic
999056039 5:148577805-148577827 TGGGGTCTACTTGAGGGTGGAGG + Intronic
999057298 5:148592220-148592242 TGGAATCTACTTGAGGGTGGAGG + Intronic
999071055 5:148744586-148744608 TGGGACCTACTTGAGGGTAGAGG + Intergenic
999104285 5:149056266-149056288 TGGGATCTACTTGAGGGTGGAGG - Intronic
999429479 5:151513581-151513603 CAGGGCCTACTTGAGGGCAGAGG + Intronic
999598246 5:153229892-153229914 TAGGATCTACTTGAGGATGAAGG - Intergenic
999761717 5:154706545-154706567 GAGGATTTACTTGAGAGTGGAGG + Intergenic
999834948 5:155359699-155359721 AAGGGCCTACTTGAGGGTAGAGG + Intergenic
1000162718 5:158615500-158615522 TAGGGTCTACTTGTGGGTGGAGG - Intergenic
1000276492 5:159740815-159740837 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1000371345 5:160539617-160539639 AAGGAGCTACTTGAGGGTCACGG + Intergenic
1000678440 5:164152918-164152940 TAGGATCTACTTGAGGGTGGAGG + Intergenic
1001178875 5:169499633-169499655 TGGAATCTACTTGAGGGTGGAGG - Intergenic
1001357875 5:171048634-171048656 CACAGTCTACTGGAGGGTAGGGG - Intronic
1001891188 5:175340493-175340515 CAGGGCCTACTTGAGGGTTGAGG + Intergenic
1002096323 5:176833307-176833329 CAGGGCTTACTTGAGGGTGGAGG - Intronic
1002392933 5:178929925-178929947 CAGCATCTGCTTGACGGTGGGGG + Intronic
1002732577 5:181352147-181352169 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1002751960 6:121960-121982 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1002821204 6:726661-726683 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
1002822956 6:745424-745446 CAGGGCCTACTTGAGGGTAAAGG + Intergenic
1002907284 6:1459887-1459909 CAGGGCCTGCTTGAGGGTGGAGG - Intergenic
1003709104 6:8569078-8569100 CTGGGCCTACTTGAGGGTAGAGG - Intergenic
1004034080 6:11904934-11904956 TGGGATCTACTTGAGGGTGGAGG - Intergenic
1004059367 6:12177151-12177173 TGGGATCTACTTGAGGGTGGAGG + Intergenic
1004464074 6:15867131-15867153 GAGTATCTTGTTGAGGGTAGAGG + Intergenic
1004549034 6:16628619-16628641 TGGGTCCTACTTGAGGGTAGAGG - Intronic
1004564700 6:16785344-16785366 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1004766398 6:18732633-18732655 TGGCACCTACTTGAGGGTAGAGG + Intergenic
1004813316 6:19284743-19284765 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1004962477 6:20806139-20806161 TGGGGGCTACTTGAGGGTAGAGG - Intronic
1005102076 6:22182102-22182124 TGGGGTCTACTTGAGGGTAGAGG - Intergenic
1005123658 6:22420455-22420477 AGGGGCCTACTTGAGGGTAGAGG + Intergenic
1005244908 6:23872636-23872658 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
1005283236 6:24297297-24297319 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1005802565 6:29441739-29441761 CAGGACATAATTGAGGGTGGAGG - Intronic
1005909682 6:30297543-30297565 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1006610725 6:35292772-35292794 CAGCAGCAACTTGAGGGTAAGGG + Exonic
1006627761 6:35409712-35409734 CGGGGCCTACTTGAGGGTGGAGG - Intronic
1007179826 6:39921934-39921956 TGGGACCTACTTGAGGGTGGAGG - Intronic
1007216244 6:40241518-40241540 CTGGATCTACTTGAGGGTGGAGG + Intergenic
1008251756 6:49248461-49248483 CAGGACTTACTTGAGGGTGGAGG + Intergenic
1008285457 6:49643866-49643888 CAAGATCTGTTTGAGGGTGGAGG - Intergenic
1008642473 6:53478676-53478698 CAGCACCTACTTGAGGGTGAAGG - Intergenic
1008736665 6:54552944-54552966 TGGGATCTACTTGAGGGTGGAGG + Intergenic
1009302055 6:62036378-62036400 CAGGGCCTATTTGAGGGTGGAGG + Intronic
1009333424 6:62455097-62455119 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1009467237 6:63986765-63986787 TGGGGTCTACTTGAGGGTAAAGG + Intronic
1009497388 6:64368098-64368120 CAGGACCTACTTGAAGGCGGAGG - Intronic
1009505169 6:64468658-64468680 CAGGACCTACTTGAAGGTGGAGG - Intronic
1009646573 6:66410980-66411002 TAGGACCTACTTGAGGGTGCAGG + Intergenic
1009997313 6:70910328-70910350 CTGGACCTACTTGAGGGTGGAGG - Intronic
1010023276 6:71186488-71186510 AAAGGCCTACTTGAGGGTAGGGG + Intergenic
1010096809 6:72056249-72056271 CAGGGCCTACTTGAGGATGGAGG + Intronic
1010193502 6:73217188-73217210 TAAGTTCTACTTGAGGGTGGAGG + Intronic
1010500836 6:76597726-76597748 CAGGGCCTTCTTGAGGGTGGAGG - Intergenic
1010523519 6:76872233-76872255 TGGGTTCTACTTGAGGGTGGAGG - Intergenic
1010695071 6:78962678-78962700 GAGGATCTTCTTAAGGGGAGAGG - Intronic
1010802101 6:80188342-80188364 GGGGATCTACCTGAGGGTGGAGG + Intronic
1010954653 6:82076226-82076248 CAGGGCATACTTGAGGGTGGAGG + Intergenic
1011117323 6:83907638-83907660 CAGACACTACTTGAGGGTGGAGG - Intronic
1011405618 6:87012384-87012406 CAGAGCCTACATGAGGGTAGAGG + Intronic
1011500153 6:87979333-87979355 CAGGAAATACTTGAGGGTCCTGG + Intergenic
1011911585 6:92447488-92447510 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1012001139 6:93656564-93656586 CGGGGCCTACTTGAAGGTAGGGG - Intergenic
1012170043 6:96005456-96005478 CGGTACCTACTTGAGGGTGGAGG + Intergenic
1012337473 6:98078972-98078994 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1012440704 6:99259818-99259840 CAGGGCCTACTTGGGGGTGGAGG + Intergenic
1012586521 6:100929883-100929905 CAGGACCTACTTGAGGGTACGGG - Intergenic
1012604616 6:101142778-101142800 CAAGACCTTCTTGAGGGTGGAGG - Intergenic
1012722754 6:102767676-102767698 TGGGATCTAGTTGAGGGTAGGGG - Intergenic
1012834553 6:104248827-104248849 CAGAGTCTACTTGAGTGTGGAGG + Intergenic
1012991810 6:105933830-105933852 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1013314794 6:108931077-108931099 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1013316750 6:108950611-108950633 TGGGACCTACTTGAGGGTGGAGG + Intronic
1013376893 6:109526120-109526142 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1013390044 6:109677077-109677099 TAAGGCCTACTTGAGGGTAGAGG + Intronic
1013456838 6:110337259-110337281 TGGGTTCTACTTGAGGGTCGAGG + Intronic
1013457666 6:110345767-110345789 TGGGACCTACTTGAGGGTGGAGG + Intronic
1013766432 6:113579349-113579371 TGGGGTCTACTTGAGGGTTGAGG + Intergenic
1014124890 6:117765531-117765553 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1014207346 6:118670384-118670406 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1014717281 6:124880554-124880576 TAGGATGTACTTGAAGGTAGAGG + Intergenic
1014961208 6:127687479-127687501 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1015221944 6:130814024-130814046 CAGGATATACTTTTGGGTAAGGG - Intergenic
1015493836 6:133859219-133859241 GGGGGTCTACTTGGGGGTAGAGG - Intergenic
1015567679 6:134590436-134590458 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1015738942 6:136432563-136432585 CAGGAGCTATATGAGGTTAGTGG - Intronic
1016124233 6:140380072-140380094 CAGGAGCTCCTTGAGGTCAGTGG + Intergenic
1016238085 6:141892171-141892193 CAGAGCCTACTTGAGGGTGGAGG + Intergenic
1016545784 6:145221849-145221871 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1016935269 6:149445188-149445210 CAGGAGCTTCTTGAGCTTAGAGG + Intergenic
1016980418 6:149848715-149848737 TGGGACCTACTTGAGGGTGGAGG + Intronic
1017276852 6:152579674-152579696 CAGGGTCTACTTGAGGGTAGAGG - Intronic
1017305089 6:152908842-152908864 CAGGTCCTACTTGACGGTAGAGG - Intergenic
1018001444 6:159582006-159582028 CGGGGTCTACCTGAGGGTAGAGG + Intergenic
1018935142 6:168269281-168269303 CAGGAAGCACTTGAGGGGAGAGG + Intergenic
1019183058 6:170204372-170204394 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1019236832 6:170624465-170624487 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1020491359 7:8788286-8788308 CAGGTCCTACTTGAGGGTGGAGG - Intergenic
1020514127 7:9094750-9094772 CTGGGCCTACTTGAAGGTAGAGG + Intergenic
1020651005 7:10876127-10876149 CAGGGACTACTTGAGGGTAGAGG - Intergenic
1020861367 7:13495990-13496012 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1020862406 7:13511270-13511292 TGGGATCTACTTGAGGGAGGAGG - Intergenic
1020985944 7:15134456-15134478 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1021419438 7:20428892-20428914 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1021426187 7:20502312-20502334 TGGGATCTACTTGAGGGTGGAGG + Intergenic
1021572489 7:22080605-22080627 TGGGGTCTACTTGAGGGAAGAGG + Intergenic
1021618480 7:22527091-22527113 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1021750235 7:23791452-23791474 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1022687194 7:32608227-32608249 CCGGGCCTACTTGAGGGTGGAGG + Intergenic
1022694895 7:32695026-32695048 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1022928075 7:35076544-35076566 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1023457148 7:40352465-40352487 CAGGGCCTACTTGAGAGTAGAGG - Intronic
1023567516 7:41538351-41538373 CAGGACCAACATGAGGCTAGAGG + Intergenic
1023571334 7:41575602-41575624 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1023657678 7:42441451-42441473 TAGGACCTACTTGAGGGAGGAGG - Intergenic
1023782864 7:43673981-43674003 CAGGACCTACTTAAAGGTGGAGG + Intronic
1024254590 7:47531093-47531115 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1024313375 7:47990936-47990958 TGAGATCTACTTGAGGGTGGGGG + Intronic
1024687697 7:51765149-51765171 GAGGATCTACTTGAGTCCAGAGG + Intergenic
1024726281 7:52200025-52200047 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1024969838 7:55058674-55058696 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1027481607 7:78704990-78705012 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1027754132 7:82189005-82189027 TGGGACCTACTTGAGTGTAGAGG + Intronic
1027875362 7:83761627-83761649 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1028374202 7:90129044-90129066 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1029334949 7:99890707-99890729 CAGGGACTACTTGAGGGTAGAGG + Exonic
1029808720 7:103023962-103023984 CAGGATCTACTTGAGGGTGGAGG + Intronic
1030454411 7:109754968-109754990 CAGGCTTTACTTGAGGTTGGAGG - Intergenic
1030689237 7:112515875-112515897 CAGGGTCTATTTGAGGGTGGAGG + Intergenic
1030711150 7:112750930-112750952 TGGGACCTACTTGAGGGTAGAGG + Intergenic
1030718946 7:112846351-112846373 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1030732436 7:113006010-113006032 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1030733783 7:113019666-113019688 TAAGGCCTACTTGAGGGTAGAGG - Intergenic
1030959623 7:115900582-115900604 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1030982765 7:116206261-116206283 TGGTACCTACTTGAGGGTAGAGG + Intergenic
1030989073 7:116278467-116278489 CAGGGCTTATTTGAGGGTAGAGG + Intergenic
1031258221 7:119483391-119483413 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
1031465459 7:122104763-122104785 CAGGGTATACTTGAGGGTGGAGG + Intronic
1031546993 7:123063135-123063157 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
1031647746 7:124247472-124247494 CGGGGCCTACTTGAGGGTAGAGG - Intergenic
1032012736 7:128357521-128357543 CAGGATGTGATTGGGGGTAGGGG - Intronic
1032625009 7:133582130-133582152 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1032625385 7:133586240-133586262 CAGGGCCTGCTTGAGGGTGGAGG - Intronic
1032647544 7:133841817-133841839 CGGGACCTACTTGAGGGTGGTGG - Intronic
1032960936 7:137033331-137033353 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1033256866 7:139808770-139808792 CATGAACTTCTTGAGGGCAGAGG + Intronic
1033493433 7:141868097-141868119 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1033567310 7:142591662-142591684 TAGGAAATACTTGAGGCTAGAGG - Intergenic
1034040344 7:147870937-147870959 CAGGTAATAGTTGAGGGTAGGGG - Intronic
1034156182 7:148957926-148957948 TGGGATCTGCTTGAGGGTGGAGG - Intergenic
1034204943 7:149307243-149307265 CAGGTTCTACTGGAGGGTGGAGG + Intergenic
1034359192 7:150479150-150479172 CAGGGTATACTTGAGGGTGGAGG + Exonic
1035510940 8:182145-182167 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1035563913 8:628730-628752 CAGGGACTACGTGAGGGTATGGG - Intronic
1036139021 8:6189286-6189308 CAGGACCTGTTTGAGGGTATGGG + Intergenic
1036634103 8:10536852-10536874 CAGGACCTACTTAAAGGTAGAGG + Intronic
1036786527 8:11691710-11691732 CTGGATCTAGTTGAGGCTGGAGG - Intronic
1037061504 8:14516302-14516324 CAGGTCCTCCTTGAGGGTGGAGG - Intronic
1037177079 8:15960544-15960566 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1037373023 8:18200522-18200544 CGGGATCTACTTAAGGGTAAAGG + Intronic
1038116771 8:24564752-24564774 CAGGGCATACTTGAGGGTAGAGG + Intergenic
1038270659 8:26072629-26072651 TGGGTTCTACTTGAGGGTGGAGG - Intergenic
1038750428 8:30290011-30290033 CAGGGCCTAGTTGAGGGTGGAGG - Intergenic
1038817561 8:30920791-30920813 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1038990820 8:32865840-32865862 CAGTGCCTACTTGAGGGTGGAGG + Intergenic
1039085963 8:33780110-33780132 CAGCATCTAATTGAGGGTGGAGG - Intergenic
1039198101 8:35054950-35054972 CAGAGCCTACTTGAGGGTGGAGG - Intergenic
1039335000 8:36579099-36579121 CAGGGGCTACTTGAGGGTAAAGG + Intergenic
1039342216 8:36663343-36663365 TGGGCTCTACTTGAGGGTGGAGG - Intergenic
1039928504 8:41961031-41961053 CAGGACCTGCTTGAGGTTTGTGG - Intronic
1040357094 8:46629236-46629258 CGGGAACTACTTGAGGGTGGAGG + Intergenic
1040407612 8:47121795-47121817 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1040792289 8:51246271-51246293 CAGGGTCTTCTTGAGAGCAGAGG + Intergenic
1040943928 8:52861917-52861939 CGGAACCTACTTGAGGATAGAGG - Intergenic
1041013494 8:53567921-53567943 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1041521435 8:58760852-58760874 CAGAGTCTACTTGAGGGTGGAGG - Intergenic
1041611881 8:59860019-59860041 TGGGATCTACTTGAGGGGAGAGG + Intergenic
1041695244 8:60728972-60728994 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1041715761 8:60930636-60930658 CAGGGCCTACTTGAGGGTAAAGG - Intergenic
1041895003 8:62914331-62914353 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1042046299 8:64655997-64656019 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1042419275 8:68566315-68566337 TGGGTTCTACTTGAGGGTGGAGG - Intronic
1042464172 8:69107971-69107993 CAGGGCCTACTTAAGGGTGGAGG - Intergenic
1042795258 8:72655283-72655305 GAGGGCCTACTTGAGGGTGGGGG + Intronic
1042866020 8:73357380-73357402 CAGGATTTCCTTCAGGGTTGAGG - Intergenic
1043067202 8:75589946-75589968 CTGGGCCTACTTGAGGGTGGAGG - Intergenic
1043361662 8:79479638-79479660 TGGGATGTACTTGAGGGTGGAGG + Intergenic
1043407819 8:79956635-79956657 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1043569438 8:81585997-81586019 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1043587152 8:81782590-81782612 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1043732188 8:83696163-83696185 CAGGGTCTACTCGAGGTTGGTGG - Intergenic
1043737959 8:83770530-83770552 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1043989687 8:86737738-86737760 CAGGATCTACTTGAGGGTGGAGG - Intronic
1044126241 8:88461155-88461177 CAGGGCCTACTTGAGGTTGGTGG - Intergenic
1044200100 8:89424663-89424685 CAGGGCCTACATGAGGGTAGAGG + Intergenic
1044307594 8:90656030-90656052 TAGTACCTACTTGATGGTAGAGG + Intronic
1044662886 8:94608818-94608840 TAGGACCTCCTTGAGGGTGGAGG + Intergenic
1044711487 8:95062799-95062821 CAGGATCTACTTTAGGTTCTGGG - Intronic
1044960847 8:97529288-97529310 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1045010750 8:97956657-97956679 CAGGATCAAATTGAGGGCTGGGG - Intronic
1045127463 8:99108001-99108023 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1045412949 8:101937344-101937366 TGGGTTCTACTTGAGGGTGGAGG - Intronic
1045619549 8:103958391-103958413 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1045636885 8:104201134-104201156 CAGGGCCTACTTGAGGGGAGAGG - Intronic
1045691751 8:104766462-104766484 CAGGGTCTACTGGAGGGTAGAGG + Intronic
1045813250 8:106249331-106249353 GAGGGTCTACCTGAGGGGAGAGG + Intergenic
1045945863 8:107795193-107795215 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1046072036 8:109267279-109267301 CAGAGCCTACTTGAGGGTGGAGG - Intronic
1046139545 8:110072352-110072374 TGGAGTCTACTTGAGGGTAGAGG - Intergenic
1046141417 8:110097683-110097705 AATGAACTACTTGAGGGTAGTGG + Intergenic
1046255217 8:111687883-111687905 CAGGGATTACTTGAGGGTGGAGG - Intergenic
1046499229 8:115054284-115054306 TGGGATCTACTTGAGGATGGAGG - Intergenic
1046865358 8:119143437-119143459 CATGGCCTACTTGAGGGTGGAGG + Intergenic
1046975475 8:120271211-120271233 CAGGGCCTACTTGTGGGTGGAGG + Intronic
1046979744 8:120324058-120324080 TGGGACCTACTTGAGGGTGGAGG + Intronic
1047264887 8:123297232-123297254 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1047277976 8:123420069-123420091 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1047438529 8:124856351-124856373 CGGGGTCTACTTGAGGGTGGAGG + Intergenic
1047595020 8:126369664-126369686 TGGGATCTTCTTGAGGGTGGAGG - Intergenic
1047609537 8:126507624-126507646 CAGGGCCTACTGGAGGGTGGGGG + Intergenic
1047641937 8:126829954-126829976 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1048145422 8:131837092-131837114 CAGGGTTTACTTGAGGGTGGAGG - Intergenic
1048668717 8:136693433-136693455 CAGGATGTACTTGAGGATAGAGG - Intergenic
1048723043 8:137348937-137348959 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1048945836 8:139446205-139446227 CAGAATCTAGTTGAGAGTTGGGG - Intergenic
1049117289 8:140700217-140700239 CTGGATCTATTAGAGGGCAGTGG + Intronic
1049137237 8:140914579-140914601 TGGGATTTACTTGAGGGTGGAGG - Intronic
1049652674 8:143780478-143780500 TAGGATCTACTTGAGGGTGGAGG - Intergenic
1049823587 8:144652745-144652767 TAGGGTCTACCTGAGGGTGGAGG + Intergenic
1050041403 9:1497778-1497800 CAGGACCTACTGGAGGGAGGAGG - Intergenic
1050127485 9:2374039-2374061 TGGGACCTACTTGAAGGTAGAGG + Intergenic
1050181714 9:2930137-2930159 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1050498078 9:6265531-6265553 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1050672169 9:8009846-8009868 CGGGGCCTACTTGAGGGCAGAGG + Intergenic
1050728314 9:8677509-8677531 CAGGGCCTAATTGAGGGTGGAGG + Intronic
1051267861 9:15326097-15326119 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1051861775 9:21633416-21633438 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1051930829 9:22383378-22383400 CAGGGCCTACTTGAGGGTTGAGG + Intergenic
1052071454 9:24086775-24086797 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1052446518 9:28568312-28568334 GGGGGTCTACTTGTGGGTAGAGG + Intronic
1052518803 9:29515961-29515983 TGGGGTCTACTTGAGGGCAGAGG + Intergenic
1052586656 9:30437986-30438008 CAAGGCCTACTTGAGGATAGAGG + Intergenic
1052618770 9:30877964-30877986 CAGAGTCTACTTGAGAGTGGAGG - Intergenic
1052626818 9:30986026-30986048 TGGTGTCTACTTGAGGGTAGAGG + Intergenic
1052669208 9:31534100-31534122 AGGGGTCTACTTGAGGGTGGAGG - Intergenic
1053159558 9:35804767-35804789 CAAGATCTACTAGAGGGAGGTGG - Intronic
1053159568 9:35804812-35804834 CAAGATCTACTAGAGGGAGGTGG - Intronic
1053159579 9:35804857-35804879 CAAGATCTACTAGAGGGAGGTGG - Intronic
1053159590 9:35804902-35804924 CAAGATCTACTAGAGGGAGGTGG - Intronic
1053159601 9:35804947-35804969 CAAGATCTACTAGAGGGAGGTGG - Intronic
1053159612 9:35804992-35805014 CAAGATCTACTAGAGGGAGGTGG - Intronic
1054750482 9:68899921-68899943 AAGGGCCTACTTGAGGGTGGAGG - Intronic
1054767615 9:69055272-69055294 CAGGCTCTAGTAGAGGCTAGGGG - Intronic
1054932471 9:70650144-70650166 CAGGACTTACTTGAGGGTGGAGG + Intronic
1054971915 9:71097974-71097996 CAGGATGTACTTGAGAGTCCTGG - Intronic
1055133159 9:72798671-72798693 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1055361959 9:75501144-75501166 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1055387809 9:75782571-75782593 CAGGACTTACTTGAGAGTGGAGG - Intergenic
1055472946 9:76631825-76631847 CAGGGACTACTAGAGGGTGGAGG - Intronic
1055531395 9:77187867-77187889 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1055990989 9:82105352-82105374 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1056669181 9:88609313-88609335 CAGGGCTTACTTGAGGGTGGAGG - Intergenic
1056959499 9:91110346-91110368 CAGGGCCTACTTGAAGGAAGAGG + Intergenic
1057096218 9:92312486-92312508 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1057408037 9:94791327-94791349 CAGGGCCTGCTTGAGGGTGGAGG + Intronic
1058178028 9:101760971-101760993 CAGGGCCTACTTGACGGTGGAGG - Intergenic
1058199028 9:102015428-102015450 TGGGGTCTACTTGAGGGTGGCGG + Intergenic
1058238337 9:102522547-102522569 CAGAGCCTACTTGAGGGTGGAGG - Intergenic
1058313890 9:103539995-103540017 AAGGAGCTACTGGAGGGTGGAGG + Intergenic
1058658922 9:107251033-107251055 TGGGGTTTACTTGAGGGTAGAGG + Intergenic
1058831359 9:108820205-108820227 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1059036582 9:110760548-110760570 TGGGATCTACCTGAGGGTAGAGG + Intronic
1059839764 9:118200769-118200791 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1060050481 9:120375057-120375079 CAGGATCTACGTGAGGCCTGTGG + Intergenic
1060117701 9:120956867-120956889 CAGAGCCTACTTGAGGGTAGAGG + Intronic
1060122015 9:121000834-121000856 CAGGGCCTGCTTGAGGGTGGAGG - Intronic
1060340701 9:122773990-122774012 CAGGGTCTACTTGAGAGTGGAGG + Intergenic
1061616196 9:131780876-131780898 TGAGGTCTACTTGAGGGTAGAGG + Intergenic
1061689835 9:132318186-132318208 CAGGAGCTAGTTGGGGATAGAGG - Intronic
1062531025 9:137000464-137000486 CAGGGTCTAGTTAAGGTTAGTGG - Intergenic
1062756982 9:138304471-138304493 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1185660175 X:1721434-1721456 TAGGGTCCACTTGAAGGTAGAGG - Intergenic
1185775413 X:2799245-2799267 CAGGGCCTACTTGAGGGCAGAGG - Intronic
1185881974 X:3749410-3749432 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1185930558 X:4198398-4198420 AAGGGTCTACTTGAGGGTGAAGG - Intergenic
1186018487 X:5226622-5226644 CAGGACCTACCTGAGGGTGGAGG + Intergenic
1186052091 X:5607581-5607603 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1186373291 X:8968627-8968649 CAGGACCTACCTGAGGGTGGAGG + Intergenic
1186378203 X:9031608-9031630 CTGGGCCTACTTGAGGGTGGAGG + Intronic
1186436053 X:9544013-9544035 CAGGATCTAAGTGGGGGCAGGGG - Intronic
1186632395 X:11364190-11364212 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1186862579 X:13688430-13688452 CAGGGCCCACTTGAGGGTTGAGG - Intergenic
1186921008 X:14280259-14280281 TGGGGTGTACTTGAGGGTAGAGG - Intergenic
1186947397 X:14584037-14584059 TGGGACCTACTTGAGGGTGGAGG + Intronic
1187217826 X:17294245-17294267 CAGGTCCTACTTGAGGGTGGAGG + Intergenic
1187600285 X:20821732-20821754 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
1187746425 X:22414214-22414236 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1188172573 X:26945978-26946000 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1188362311 X:29271016-29271038 CAAGGTCTACTTGAGGGTGGAGG - Intronic
1188471014 X:30539269-30539291 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1188516581 X:30994021-30994043 CAGAGGCTACTTGAGGGTGGAGG - Intergenic
1188531690 X:31148100-31148122 CATTATCTCCTTGAGGGCAGCGG - Intronic
1188573523 X:31618060-31618082 CAGGATCTACTCTAGGGTGGAGG + Intronic
1188711360 X:33404538-33404560 TAGGACCTACTGGAAGGTAGAGG - Intergenic
1188738658 X:33749960-33749982 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1188754641 X:33947414-33947436 CAGGGCCTACTTGAGGATAGAGG - Intergenic
1188806433 X:34596293-34596315 TGGGGCCTACTTGAGGGTAGGGG - Intergenic
1188810562 X:34649536-34649558 TGGGGTCTACTTGAGGGTTGAGG + Intronic
1188816679 X:34723542-34723564 CATGGCCTACTTGAGGGTTGAGG - Intergenic
1188826267 X:34839210-34839232 CATGGACTACTTGAGGGTAGAGG - Intergenic
1188848785 X:35106614-35106636 TAGGACTTACTTGAGGGTGGAGG + Intergenic
1188859264 X:35237751-35237773 TGGGGTCTACTTGAGGGAAGAGG + Intergenic
1189012797 X:37063330-37063352 CAGGATCTACTGGGGTGGAGGGG - Intergenic
1189095665 X:38136395-38136417 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1189132062 X:38509900-38509922 CAGAGCCTACTTGAGGGTGGAGG + Intronic
1189388331 X:40555563-40555585 CAGGGCCTACTCGAGGGTGGAGG + Intergenic
1189497880 X:41525876-41525898 CAGCATCTTCTTGTGGGTTGAGG + Intronic
1189611231 X:42738341-42738363 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1189653600 X:43217066-43217088 CAGGGTGTACTTGAGGGTGGAGG + Intergenic
1189752773 X:44239431-44239453 CAAGAGCTCCTTGAGGGCAGGGG - Intronic
1190051843 X:47156480-47156502 CATGATCTAAATGAGGGTTGGGG - Intronic
1190167925 X:48088550-48088572 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1190324339 X:49197626-49197648 CAGGAGCTACTTGCGGGGGGAGG + Intronic
1190447938 X:50549248-50549270 TGGGGTCTACTTGAGGGTAGAGG - Intergenic
1191176726 X:57511070-57511092 TAAGGTCTACTTGAGGGTGGAGG - Intergenic
1191219287 X:57969684-57969706 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1191738377 X:64411056-64411078 TGGATTCTACTTGAGGGTAGAGG - Intergenic
1191763805 X:64673679-64673701 CAGGGCCTACTTGAGGGTTGAGG + Intergenic
1191820661 X:65303200-65303222 CAGGGCTTACTTGAGGGTAAAGG + Intergenic
1191850700 X:65583820-65583842 CAGGGCCTACTTGAGGGTGAAGG - Intergenic
1191919796 X:66243325-66243347 CAGGGTGTACTTGAGGGTGGAGG + Intronic
1191926419 X:66315742-66315764 CAGGGGCTACTTGAGAGTAGAGG + Intergenic
1191927719 X:66331880-66331902 CAGGGTGTACTTGAGGGTGGAGG - Intergenic
1192042108 X:67633290-67633312 CAGGGCCTACTTGATGGTGGAGG - Intronic
1192072032 X:67951113-67951135 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1192200225 X:69061912-69061934 CACGATCTCCATGAGGGCAGGGG + Intergenic
1192338997 X:70246741-70246763 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1192354825 X:70391773-70391795 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1192616195 X:72625257-72625279 CAGGACCTTCTTGAGGATGGAGG - Intronic
1192767506 X:74157168-74157190 CAGCACCTACTTGAGAGTGGAGG + Intergenic
1192849326 X:74937719-74937741 CAGGGTCTACTTAAGGGTGGAGG - Intergenic
1193085167 X:77442409-77442431 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1193165964 X:78280738-78280760 TGGGACCTACCTGAGGGTAGAGG - Intronic
1193218401 X:78892988-78893010 CAGGAGCTACTTTGGGGTGGGGG - Intergenic
1193289695 X:79757179-79757201 CAGGACCTACTTCAGGATGGAGG - Intergenic
1193340534 X:80343954-80343976 CAGGGCCTACTTGAGGGAGGAGG - Intronic
1193405786 X:81100187-81100209 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1193429361 X:81382084-81382106 CAGGACCTACTGGAGGGTGGAGG - Intergenic
1193467051 X:81862273-81862295 CTGGGTGTACTTGAGGGTGGAGG + Intergenic
1193472960 X:81928807-81928829 CAGGGTCTATTTGAGGGTGGAGG + Intergenic
1193482073 X:82039015-82039037 CAGGGCCTACCTGAGGGTGGAGG + Intergenic
1193515456 X:82456436-82456458 CAGGACCTACCTGAGGGTGAAGG + Intergenic
1193615118 X:83677609-83677631 CACCATCTACTTGAGGGTGGAGG + Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1193825378 X:86219464-86219486 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1193851738 X:86545389-86545411 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1193885209 X:86975652-86975674 TAGGACCTACTTGACGGTTGAGG + Intergenic
1193987717 X:88266573-88266595 TGGGGTCTACTTGAGGGCAGAGG + Intergenic
1194091918 X:89587780-89587802 CAGGGGCTACTTGAGGGTGGAGG + Intergenic
1194167431 X:90536271-90536293 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1194234428 X:91364692-91364714 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1194243205 X:91477191-91477213 CAAGGTCTACTTGAGGTTTGAGG - Intergenic
1194260964 X:91695153-91695175 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1194290021 X:92060487-92060509 CAGGGTCTACTTCAGGGTGGAGG - Intronic
1194310147 X:92296401-92296423 CGGTACCTACTTGAGGGTGGTGG - Intronic
1194338053 X:92673664-92673686 CAGGGACTACTAGAGGGTGGAGG + Intergenic
1194407193 X:93511274-93511296 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1194410208 X:93548071-93548093 CGGGGCCTACTTGAGGGTAGAGG + Intergenic
1194484204 X:94467067-94467089 TGGGGTGTACTTGAGGGTAGAGG + Intergenic
1194545910 X:95233169-95233191 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
1194873199 X:99158676-99158698 TAGGGCTTACTTGAGGGTAGAGG + Intergenic
1194982973 X:100459415-100459437 CAGGGCCTACTTAAGGGTGGAGG + Intergenic
1195275905 X:103280293-103280315 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1195280252 X:103326530-103326552 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1195448494 X:104981287-104981309 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1195602268 X:106762859-106762881 CGGGGCCTACTTGAGGGTGGAGG + Intronic
1195833092 X:109082350-109082372 CAGGGCATACTTGAGGGTGGAGG - Intergenic
1195979720 X:110564351-110564373 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1196010554 X:110882986-110883008 CAGGACCTTCTTGAAGGTGGAGG - Intergenic
1196080694 X:111627620-111627642 CTGGGTCTACTTGAGGGCGGAGG + Intergenic
1196472329 X:116042570-116042592 TGGGATCTACTTGAGGGTGGAGG + Intergenic
1197107797 X:122736421-122736443 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1197353598 X:125406346-125406368 TGAGGTCTACTTGAGGGTAGAGG - Intergenic
1197367236 X:125579158-125579180 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1197372698 X:125644476-125644498 CAAGGCCTACTTGAGGATAGAGG - Intergenic
1197422217 X:126252182-126252204 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1197567997 X:128112326-128112348 CAGGGCTTACTTGAGGGTGGTGG + Intergenic
1197595904 X:128464019-128464041 CAGCATGTACTTGAGGGTGGAGG - Intergenic
1197791069 X:130254746-130254768 GAGGGCCTACTTGAGGGTGGAGG + Intronic
1197913175 X:131507561-131507583 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1198054481 X:132980407-132980429 CAGGGCCTACTTGAGGGAGGAGG + Intergenic
1198063204 X:133068239-133068261 CAGGGCCTACTTGAGGGTAGAGG + Intronic
1198076578 X:133199058-133199080 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1198383842 X:136108917-136108939 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1198528114 X:137522499-137522521 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
1198722299 X:139635878-139635900 ACGGGTCTACTTGAGGGTGGAGG - Intronic
1198837722 X:140821837-140821859 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1198895190 X:141446305-141446327 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1198945463 X:142008166-142008188 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1199197980 X:145054653-145054675 CAGGGCCTACTTGAGGGTTCAGG + Intergenic
1199257746 X:145735977-145735999 CAGGACCTACTTGAGGACAGAGG + Intergenic
1199262701 X:145794209-145794231 CTGGGTCTACTTGAGGGTGGGGG + Intergenic
1199338471 X:146647213-146647235 CGGGGCATACTTGAGGGTAGAGG - Intergenic
1199365590 X:146978326-146978348 TGGGATCTACTTCAGGGGAGAGG - Intergenic
1199469145 X:148174538-148174560 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1199788382 X:151126532-151126554 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1199877003 X:151940782-151940804 CAGGACCTGCTTGAGGGTGGAGG - Intergenic
1200444558 Y:3243842-3243864 CAGGGACTACTTGAGGGTGGAGG + Intergenic
1200513694 Y:4114049-4114071 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1200579615 Y:4933955-4933977 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1200607533 Y:5285061-5285083 CAGGATCTACTTCAGGGTGGAGG - Intronic
1201249050 Y:12037450-12037472 CAACACCTACTTGAGGGTGGAGG + Intergenic
1201294500 Y:12452154-12452176 CAGGGCCTACTTGAAGGCAGAGG + Intergenic
1201384302 Y:13421751-13421773 TGGGATCTACTTGAGAGTGGAGG + Intronic
1201538706 Y:15082447-15082469 AGGGACCTACTTGAGGGTGGAGG - Intergenic
1201713502 Y:17017794-17017816 CAGGGCCTACTTGAGGTTGGAGG + Intergenic
1201790247 Y:17832008-17832030 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1201811307 Y:18073981-18074003 TGGGACCTACTTGAGGGTGGAGG - Intergenic
1201967769 Y:19756794-19756816 CAGGATCTACTTCAGGGTGGAGG - Intergenic
1202351891 Y:24001754-24001776 TGGGACCTACTTGAGGGTGGAGG + Intergenic
1202384094 Y:24307505-24307527 TAGGGTCTACTTGAGGGTGGAGG - Intergenic
1202486689 Y:25362615-25362637 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1202518888 Y:25668365-25668387 TGGGACCTACTTGAGGGTGGAGG - Intergenic