ID: 1085223227

View in Genome Browser
Species Human (GRCh38)
Location 11:74894249-74894271
Sequence AGGATCTACTTGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1901
Summary {0: 2, 1: 10, 2: 88, 3: 543, 4: 1258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085223227 Original CRISPR AGGATCTACTTGAGGGTAGA GGG Intronic
900011208 1:110774-110796 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900027312 1:287338-287360 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900041270 1:466782-466804 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900062701 1:701758-701780 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900858412 1:5205009-5205031 GAGATCTACTTGAGGATACAGGG + Intergenic
902083686 1:13839482-13839504 GGGGCCTAGTTGAGGGTAGAAGG - Intergenic
902175067 1:14643323-14643345 GGGGTCTACTTGAAGGTGGAGGG - Intronic
902258900 1:15209157-15209179 AGGATCTGCTTGAGCCTAGGAGG - Intronic
902376667 1:16033130-16033152 AGGAAACACTGGAGGGTAGATGG - Intronic
902381829 1:16056383-16056405 AGGAAACACTGGAGGGTAGAAGG - Intronic
903372175 1:22843498-22843520 GGGGCCTACTTGAGGGTGGAGGG - Intronic
903898977 1:26629069-26629091 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
903988500 1:27247480-27247502 GGAACCTACTTGAGGGTGGAGGG - Intronic
904233001 1:29092704-29092726 AGGGCCTACTTGAGGGTGGAGGG - Intronic
904414358 1:30347704-30347726 GGGTTCTATTTGAGGGTAAAAGG - Intergenic
904916422 1:33973634-33973656 AAAATGCACTTGAGGGTAGAAGG + Intronic
905015374 1:34774600-34774622 AGGAACTTCTGGAGGGTAGGAGG + Intronic
905154526 1:35964278-35964300 GGGGTCTACCAGAGGGTAGAGGG - Intronic
905255397 1:36678555-36678577 AGGATCCCCTTTAGGGGAGAAGG + Intergenic
905848105 1:41251035-41251057 AGGGTCTACTTGAGCGGGGAGGG - Intergenic
906288887 1:44606445-44606467 TGGATGAACTGGAGGGTAGATGG + Intronic
906737754 1:48148700-48148722 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
906836786 1:49092019-49092041 GGGGCCTACTTGAGGGTGGAGGG + Intronic
906882707 1:49609744-49609766 AGGGCCTACTTGAGGGTATGTGG - Intronic
906887917 1:49672329-49672351 GGGGTCTACTTGAGGGGGGAGGG + Intronic
907379717 1:54076253-54076275 GAGGTCTACTTGAGGGTGGAGGG - Intronic
907638756 1:56163658-56163680 GGGACCTACTGGAAGGTAGAGGG - Intergenic
907770214 1:57454493-57454515 GGGGTCTACTTGAGGATGGAGGG + Intronic
908083065 1:60601020-60601042 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
908163253 1:61432481-61432503 AGGAGCTGCCTGAGTGTAGAAGG + Intronic
908204547 1:61832163-61832185 GGGGCCTACTTGGGGGTAGAGGG + Intronic
908306883 1:62827811-62827833 CGGGTCTACTTGAGGATGGAGGG - Intronic
908664142 1:66471057-66471079 GGGTTCTACTTAAGGGTGGAGGG - Intergenic
908819753 1:68073053-68073075 GGGCTCTACTTGATGGTGGATGG - Intergenic
908887317 1:68804449-68804471 AGGGCCTACATGAGGGTGGAGGG + Intergenic
908905468 1:69003876-69003898 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
909102009 1:71359450-71359472 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
909181053 1:72424608-72424630 GGAGCCTACTTGAGGGTAGAAGG + Intergenic
909399599 1:75212345-75212367 GGGACCTACTTGAGGGTGGAGGG - Intronic
909442883 1:75717450-75717472 TGGGGCTACTTGAGGGTGGAGGG + Intergenic
909568619 1:77083378-77083400 GGGAACTACTTGGGGGTGGAGGG - Intergenic
909695137 1:78459647-78459669 AGGGCCTACTTGAGGGTGAAAGG - Intronic
909760146 1:79276278-79276300 AGGTTCTACTTGATGGGGGAGGG + Intergenic
909904712 1:81179889-81179911 AGGACTTACTTGAAGGTGGAAGG + Intergenic
910139751 1:84014060-84014082 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
910148253 1:84108312-84108334 AGGATATACTTGAGGGTGGAAGG + Intronic
910166353 1:84331889-84331911 GGGGCCTACTTGAGGGTGGAGGG - Intronic
910313299 1:85853124-85853146 AGGACCTACTTGAGAGTGAAGGG - Intronic
910317144 1:85899101-85899123 AAGATCATCTTGAGGGTTGAGGG - Intronic
910606013 1:89085602-89085624 AGGGCCTTCTTGAGGGTTGAGGG + Intergenic
910645230 1:89507228-89507250 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
910731629 1:90403970-90403992 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
910736301 1:90461603-90461625 AAGGCCTACTTGAGGGCAGAGGG - Intergenic
911245104 1:95508338-95508360 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
911314338 1:96338019-96338041 AGGGTCTACTTGAGGATGGAGGG + Intergenic
911478936 1:98411894-98411916 GGGGCCTACTTGAGGGTACAGGG - Intergenic
911491864 1:98579239-98579261 AGCACCTACTTGAGGGTGGAGGG - Intergenic
911543929 1:99192703-99192725 AGGGTCTACTTGAGGGTAGAGGG + Intergenic
911892087 1:103384202-103384224 GGGATCTACTTGAGGATGGAGGG - Intergenic
912283604 1:108344446-108344468 AGAGTCTATTTGAGGGTGGAGGG + Intergenic
912326083 1:108764038-108764060 TAGGCCTACTTGAGGGTAGAGGG - Intronic
912732622 1:112122608-112122630 GGGGTCTGCTTGAGGGTGGAAGG + Intergenic
912890972 1:113530435-113530457 AGGGCCTATTTGAGGGTAGAGGG + Intronic
913194199 1:116441617-116441639 GGGGTCTATTTGAGGGTAGAAGG - Intergenic
913356148 1:117924285-117924307 AGGACCTACTTGAGGGTGAAAGG - Intronic
913649379 1:120897186-120897208 GGGGACTACTCGAGGGTAGAAGG - Intergenic
913931793 1:124977106-124977128 AGAATCTACTTGAGGATATTTGG - Intergenic
913933060 1:125003909-125003931 AGGATCTGCTTGAGGATATTTGG + Intergenic
914077312 1:144366325-144366347 GGGGACTACTCGAGGGTAGAAGG + Intergenic
914101866 1:144600180-144600202 GGGGACTACTCGAGGGTAGAAGG - Intergenic
914171762 1:145231909-145231931 GGGGACTACTCGAGGGTAGAAGG + Intergenic
914295011 1:146312867-146312889 AAGACCTACTTAACGGTAGAGGG - Intergenic
914297094 1:146337332-146337354 GGGGACTACTCGAGGGTAGAAGG + Intergenic
914414157 1:147462908-147462930 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
914526869 1:148475870-148475892 GGGGACTACTCGAGGGTAGAAGG + Intergenic
914556052 1:148763650-148763672 AAGACCTACTTAACGGTAGAGGG - Intergenic
914639532 1:149591265-149591287 GGGGACTACTCGAGGGTAGAAGG - Intergenic
915696212 1:157745163-157745185 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
915697605 1:157760278-157760300 GGGACCTATTTGAGGGTGGAGGG + Intronic
915784162 1:158589333-158589355 AGGGCCTACTTGAGGGTGAAAGG + Intergenic
915946648 1:160157340-160157362 AAGGCCTACTTGAGGGTGGAGGG - Intronic
916017858 1:160766075-160766097 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
916124172 1:161554525-161554547 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
916285780 1:163103417-163103439 AGGACCTACTTGAGGGTAGAGGG - Intergenic
916299527 1:163258313-163258335 AGAATTTACTTGTGGGTGGATGG + Intronic
916373866 1:164130107-164130129 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
916457423 1:164985283-164985305 AGGGCCTACTTGAGGGTGGAAGG - Intergenic
916546018 1:165805209-165805231 AGGGCCTACTTGAGGGTGAAAGG + Intronic
916593717 1:166221020-166221042 AGGGCCTACTTGAAGGCAGAAGG - Intergenic
916616502 1:166446604-166446626 GGGACCTATTTGAGGGTGGAGGG - Intergenic
916708377 1:167377822-167377844 AGGGCCTACTTGAGGGTAGAGGG - Intronic
916940638 1:169673644-169673666 GGGACCTACTTGAGAATAGAGGG + Intronic
916967307 1:169963104-169963126 AGGACCTACTTAAGGGTAGAGGG - Intronic
917003552 1:170386785-170386807 AGGGCCTACTTGAGGGTTGAGGG - Intergenic
917007706 1:170433550-170433572 AGAATCTACTTGAGGATGGAGGG + Intergenic
917172796 1:172196060-172196082 TGGGTCTACTTGAGGGTGGAGGG - Intronic
917253562 1:173089339-173089361 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
917585220 1:176419277-176419299 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
917645637 1:177026160-177026182 AGGAGAGACTTGAGGGCAGAAGG + Intronic
917681356 1:177371400-177371422 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
917820820 1:178762012-178762034 AGGGCCTACTTGAGGGTGGAGGG - Intronic
917990162 1:180367543-180367565 GGGGTCTGCTTGAGGGTGGAGGG - Intronic
918024419 1:180728996-180729018 GGGGCCTACTTGAGGGTGGAGGG - Intronic
918135690 1:181672223-181672245 GGGGTCTACTTGAGTGTGGAGGG + Intronic
918198919 1:182248706-182248728 GGGGTCTACTAGAGGGTGGAGGG - Intergenic
918222811 1:182451353-182451375 AGGATATACGTGATGGTATAGGG + Intronic
918272563 1:182916878-182916900 GGTGTCTACTTGAAGGTAGAGGG + Intronic
918386664 1:184014964-184014986 AGGGCCCACTTGAGGGTGGAGGG + Intronic
918481210 1:184978669-184978691 AGGGCCTATTTGAGGGTGGAGGG + Intergenic
918561797 1:185877891-185877913 AGGGCCTACTTGAGGGAGGAGGG - Intronic
918858708 1:189793728-189793750 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
918966628 1:191358401-191358423 AGGATCTACTTCAGCAGAGATGG - Intergenic
918981739 1:191570365-191570387 AGGACCTACTTGAGGGTGGGAGG + Intergenic
919093860 1:193006153-193006175 GGGGTCTGCTTGAGGGTAAAGGG + Intergenic
919559979 1:199105381-199105403 GGGGACTACTTGAGGGTGGAGGG - Intergenic
919617515 1:199825956-199825978 GGGAACTACTTGAGGGTGGAGGG + Intergenic
919965087 1:202515131-202515153 GGGGTCTACTTGAGGGAGGAGGG + Intronic
920596893 1:207280893-207280915 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
920687957 1:208124206-208124228 GGGGCCTACTTGAGGGTGGAGGG + Intronic
921336196 1:214089001-214089023 GGGATCTGCTTGAGGGTGGAGGG - Intergenic
921337015 1:214098378-214098400 AGGGTCTATTTGAGGGTGAAGGG + Intergenic
921372256 1:214436232-214436254 AGGGCCTACTTGAGGATGGAGGG + Intronic
921541799 1:216425107-216425129 AGGACCTACTTGAGGCTGAAGGG - Intergenic
922114435 1:222597916-222597938 ACGGGCTACTTGAGGGTGGAGGG - Intergenic
922163540 1:223096331-223096353 GGGGCCTACTTGAGGGTAGAAGG - Intergenic
922251039 1:223848595-223848617 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
922259650 1:223926776-223926798 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
922391466 1:225147789-225147811 AGGGCCTACTGGAGGGTGGAAGG - Intronic
923189550 1:231607246-231607268 GGTGTCTACTTGAGGGTGGAGGG - Intronic
923822032 1:237455406-237455428 AGGGCCTACTTGAGGGTGGAGGG + Intronic
923855921 1:237845470-237845492 GGGGTTTACTTGAGGGTGGAAGG + Intergenic
923915542 1:238499679-238499701 GGGATCTACTTGAGGGTGGAGGG + Intergenic
923968407 1:239170752-239170774 GGGTTCTACTTGAGGATGGAGGG + Intergenic
924128963 1:240885735-240885757 GGGATCTACTTGAGAGTGGAGGG + Intronic
924185106 1:241480480-241480502 AGGGTCTATTTGAGGGTGGAGGG - Intergenic
924212963 1:241789721-241789743 GGGGCCTACTTGAGGGTGGAGGG + Intronic
924340813 1:243029332-243029354 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
924388848 1:243528476-243528498 AAGGCCTACTTGAGGGTGGAGGG - Intronic
924874796 1:248090441-248090463 GGGGCCTACTTGAGGGTGGAAGG - Intronic
924891081 1:248280757-248280779 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1062929547 10:1343860-1343882 GGGAACTACTTGAGGGTGAAGGG + Intronic
1063269967 10:4497303-4497325 GGAGCCTACTTGAGGGTAGAGGG - Intergenic
1063455500 10:6179650-6179672 ATGATCCAGTTGAGGGGAGACGG - Intronic
1063586384 10:7356750-7356772 AGGATGTACTTCCGGGTACAGGG - Intronic
1063762332 10:9094079-9094101 GGGGTCTACTTGCGGGTGGAGGG + Intergenic
1064102366 10:12474750-12474772 TGGGTCTGCTTGAGGGTAGAGGG - Intronic
1064366569 10:14714017-14714039 AGGGCCTACTTGAGAGTGGAGGG + Intronic
1064498919 10:15947309-15947331 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1064621314 10:17220398-17220420 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1064772406 10:18737148-18737170 GGGGCCTACTTGAAGGTAGAGGG + Intergenic
1064874023 10:19972432-19972454 AGAGTCTACTTGAGGGTGAAGGG + Intronic
1064896215 10:20240082-20240104 AGAGCCTACTTGAGGATAGAGGG - Intronic
1064912825 10:20421598-20421620 AGGCCCTACTTAACGGTAGAGGG - Intergenic
1065059825 10:21888764-21888786 GGGGTCTACTTGAGGTTGGAGGG + Intronic
1065096055 10:22281970-22281992 GGGGTCTACTTGAGGATGGACGG + Intergenic
1065201763 10:23319158-23319180 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1065368368 10:24956292-24956314 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1065445837 10:25797623-25797645 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1065980331 10:30888531-30888553 GGAGCCTACTTGAGGGTAGAGGG - Intronic
1066156342 10:32682175-32682197 AGGGCTTACTTGAGGGTGGAGGG - Intronic
1066161351 10:32734427-32734449 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1066174161 10:32886631-32886653 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1066218092 10:33308199-33308221 AGGGTCTACTTGAGGATGGAGGG + Intronic
1066462699 10:35625448-35625470 AGGGCCTACTTGAGGATGGAGGG - Intergenic
1066476699 10:35753849-35753871 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
1066645480 10:37603396-37603418 GGGGCCTACTTGAGGGTAAAGGG + Intergenic
1066715549 10:38282000-38282022 GGGGTCTACTTGAGAGTGGAGGG + Intergenic
1066735658 10:38476075-38476097 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1067162650 10:43840379-43840401 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1067319340 10:45202978-45203000 GGGGTCTACTGGAGGGTGGAAGG - Intergenic
1067915359 10:50392020-50392042 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1068086581 10:52381097-52381119 AGGGTCTACTTGAGGGTAGAAGG - Intergenic
1068176397 10:53465178-53465200 AGGATCTACTAGAAAGTAGATGG - Intergenic
1068271379 10:54730386-54730408 AGGGCCTACCTGAGGGTAGAGGG + Intronic
1068384779 10:56311551-56311573 AGGACCTACTTGAAGTTAGGAGG + Intergenic
1068702767 10:60037447-60037469 GGGATCTACTTGAGGGTGAGAGG - Intronic
1068753525 10:60624040-60624062 GAGGCCTACTTGAGGGTAGAGGG + Intronic
1069059182 10:63875943-63875965 GGGTTCTACTTGAGGGGGGAAGG - Intergenic
1069067947 10:63964252-63964274 AGGAGCTAATTGAGAGAAGAGGG - Intergenic
1069133672 10:64737061-64737083 AGGGCCTATTTGAGGGTAGAGGG - Intergenic
1069195773 10:65549359-65549381 GGGGTATACTTGAGGGTAGGGGG + Intergenic
1069234208 10:66049781-66049803 AGCATCTACTTGAGGGGGAAGGG + Intronic
1069701442 10:70429515-70429537 AGGATCTCTTTAAGGGAAGATGG + Intergenic
1070123432 10:73600572-73600594 GGGGCCTACTTGAGGATAGAAGG + Intronic
1070455992 10:76616204-76616226 CGGGTCTACTTGAGGGTGGAAGG + Intergenic
1070857111 10:79614654-79614676 AGGCTCTCCATGAGGTTAGAAGG + Exonic
1070871125 10:79754446-79754468 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1071005032 10:80874338-80874360 GGGGTCTACTTGAGGGTCAAGGG - Intergenic
1071022631 10:81076581-81076603 AGGCGCTACCTGAGGGTGGAGGG - Intergenic
1071109032 10:82133413-82133435 GGGGTCTACTTGAGGGTGCAGGG - Intronic
1071343547 10:84669929-84669951 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1071367982 10:84920354-84920376 GTGGTCTACTTGAGGGCAGAGGG + Intergenic
1071410540 10:85388174-85388196 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1071418976 10:85470054-85470076 AGGGTGCACTTCAGGGTAGAGGG + Intergenic
1071638059 10:87276654-87276676 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1071657185 10:87461298-87461320 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1071770164 10:88720357-88720379 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1072259986 10:93660537-93660559 ATGACCTACTTCAGGGGAGAAGG + Intronic
1072903811 10:99432065-99432087 GGGACCTACTTGAGGCTAGAGGG - Intergenic
1073485655 10:103817309-103817331 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1073832301 10:107399153-107399175 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1073992121 10:109273786-109273808 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1074214504 10:111370954-111370976 AGGGCCTACTTGAGGGTGGGTGG - Intergenic
1074239848 10:111627255-111627277 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1074271715 10:111960288-111960310 AGGGTCTATCAGAGGGTAGAGGG + Intergenic
1074385889 10:113016432-113016454 TGGATGTACTTGAGGTGAGAGGG + Intronic
1074557578 10:114506019-114506041 AGGGACTACTGGAGGGGAGATGG - Intronic
1074959650 10:118430553-118430575 AGGGTCGACTTGAGAGTGGAGGG + Intergenic
1075162525 10:120037085-120037107 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
1075333048 10:121588229-121588251 GAGGTCTACTTGAGGGTGGAGGG + Intronic
1075543433 10:123335305-123335327 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1075614844 10:123883374-123883396 AGGACATACCTGAGGGTACAGGG - Intronic
1075707287 10:124509030-124509052 AGGGCCTACCTGAGGGTGGAGGG - Intronic
1075840555 10:125498728-125498750 AGGGCCTACTTCAGGGTGGAGGG - Intergenic
1076597389 10:131632560-131632582 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1076690302 10:132220291-132220313 AGCCTCTACCGGAGGGTAGAGGG + Intronic
1076967541 11:103012-103034 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1077671588 11:4162627-4162649 AGGTCCTACTTGAGGGTGGAGGG - Intergenic
1077763270 11:5127412-5127434 AGCATTTACTTGAGGTCAGAGGG + Intergenic
1077955159 11:7010408-7010430 AGGGCCTACTTGAAGGTAGAGGG + Intronic
1078138256 11:8670347-8670369 GGGACCTGCTTGAGGGTGGAGGG - Intronic
1079277217 11:19052534-19052556 AGGATCTACTCGAGGGCATTGGG + Intergenic
1079285422 11:19126279-19126301 GGGGTATACTTGAGGGTGGAGGG - Intronic
1079343800 11:19634326-19634348 GGGGTCTACTTGAAGGTGGAGGG + Intronic
1079680273 11:23287754-23287776 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1079728447 11:23907602-23907624 ATGGCCTACTTGAGGGCAGAGGG + Intergenic
1079777347 11:24548539-24548561 AGTGACTACTTGAGGGTGGAGGG + Intronic
1079823895 11:25166177-25166199 AGGGCATACTTGAGGGTGGAGGG - Intergenic
1080094106 11:28383962-28383984 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1080260624 11:30346031-30346053 AGAACCTACTTGAGGTTGGAAGG + Intergenic
1080500785 11:32869119-32869141 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1080706164 11:34696180-34696202 AGAGCCTACTTGAGGGTGGAAGG - Intergenic
1080725051 11:34889637-34889659 GGGACCTACTGGAGGGTGGAGGG - Intronic
1080777374 11:35398499-35398521 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1081425512 11:42922047-42922069 GGGGTCTACTTCAGGGTGGAGGG - Intergenic
1081452978 11:43191119-43191141 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1082107828 11:48239923-48239945 AGGGACTACTTGAGGGGGGAGGG - Intergenic
1082193104 11:49270733-49270755 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1082218002 11:49598038-49598060 GGGGACTACTTGAGGGTGGAGGG - Intergenic
1082641805 11:55670009-55670031 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1082701544 11:56438009-56438031 GGGGTCCACTTGAGGGCAGAGGG - Intergenic
1082921311 11:58497694-58497716 AGGGCCTACTTGAGGGTGAAGGG + Intergenic
1082981451 11:59127222-59127244 GGGGCCTACTTGAGGGTGGAGGG + Exonic
1083097766 11:60269060-60269082 GGGTCCTACTGGAGGGTAGAGGG - Intergenic
1083677770 11:64336556-64336578 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1084390829 11:68875654-68875676 GTGGTCTACTTGAGGGTGGAGGG + Intergenic
1084439311 11:69162642-69162664 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1084990238 11:72916043-72916065 AGGGCCTACCAGAGGGTAGAGGG + Intronic
1085223227 11:74894249-74894271 AGGATCTACTTGAGGGTAGAGGG + Intronic
1085787592 11:79468751-79468773 GGGTCCTACTTGAGGGTGGAGGG + Intergenic
1085790058 11:79489459-79489481 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1085881141 11:80467250-80467272 GGGGTCTACCTGAGGGTAGTGGG + Intergenic
1085914221 11:80865498-80865520 GGGGCCTACTTGAGGGTAGAAGG + Intergenic
1086209885 11:84307334-84307356 AGGACTTACTTGAGGGTGGATGG + Intronic
1086381333 11:86258099-86258121 GGGGCCTACTGGAGGGTAGAGGG - Intronic
1086526405 11:87732241-87732263 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1086611915 11:88767663-88767685 GGGACCTACTTGAGGGTGGATGG + Intronic
1086631570 11:89026150-89026172 GGGGACTACTTGAGGGTGGAGGG + Intronic
1086664189 11:89459285-89459307 GGGGTCTACTTGAGGGTAGAGGG + Intronic
1086673025 11:89570334-89570356 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1087167110 11:95016002-95016024 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1087360386 11:97151279-97151301 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1087440361 11:98176223-98176245 AGGGCGTACTTGAGGGTGGAGGG + Intergenic
1087466687 11:98516834-98516856 AGGGTCTACTTGAAGGCGGAGGG - Intergenic
1087853974 11:103068672-103068694 GGGGTCTACTTGAAGGTGGAGGG + Intronic
1087873116 11:103324326-103324348 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1087978087 11:104575397-104575419 GGGGTCTACTTGAGGGTAGAGGG + Intergenic
1088099414 11:106138634-106138656 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1088161622 11:106878615-106878637 GGGGCCTACTGGAGGGTAGAAGG + Intronic
1088409272 11:109515316-109515338 GGGACCTACTTGAGGGTGGAGGG - Intergenic
1088418537 11:109617304-109617326 AAGGCCTACTTGAGGGTGGAGGG + Intergenic
1088420361 11:109638365-109638387 GGGATCTACTTGAGGGGGGAGGG - Intergenic
1088508286 11:110548349-110548371 AGGGCCTACTTGAGGGTGAAGGG + Intergenic
1088570661 11:111220379-111220401 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1088620389 11:111675906-111675928 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1088929162 11:114332059-114332081 AAGAGCTCCTTCAGGGTAGATGG - Intergenic
1088934211 11:114382526-114382548 GGGGCCTAGTTGAGGGTAGAGGG - Intergenic
1089763160 11:120743411-120743433 GGGGTCTACTTGAGGGTGGAAGG + Intronic
1089884901 11:121810776-121810798 AGTGCCTACTTGAGGGTGGAGGG - Intergenic
1090096626 11:123748375-123748397 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1090143857 11:124296519-124296541 GGGGTCTACTTGAGGGTTGAAGG - Intergenic
1090217066 11:124978007-124978029 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1090538027 11:127667391-127667413 GGGGTCTGCTTGAGGGTGGAGGG + Intergenic
1090864191 11:130682144-130682166 AGGTCCTACTTTAGAGTAGAGGG - Intronic
1091815870 12:3437521-3437543 GAGGCCTACTTGAGGGTAGAGGG - Intronic
1091901779 12:4149885-4149907 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1092440804 12:8500488-8500510 AGGGCCTACTTGAGGGTGGAAGG + Intergenic
1092581003 12:9841300-9841322 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1092724386 12:11470787-11470809 GGCGTCTACTTGAGGGTGGACGG + Intronic
1092889841 12:12958992-12959014 GGGACCTACTTGAGGGGAGAGGG - Intergenic
1092926443 12:13276502-13276524 AGAATCTTCCTTAGGGTAGAAGG + Intergenic
1093030325 12:14282632-14282654 AGGACCTACCTGAGGGCGGAGGG + Intergenic
1093056150 12:14557672-14557694 GGGACCTACTTCAGGGTGGAGGG + Intronic
1093097788 12:14991745-14991767 GGGGTCTACTTGAAGGTGGAGGG + Intergenic
1093218493 12:16390450-16390472 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1093385049 12:18542561-18542583 GGGATCTACTTGAGGGGCGAGGG - Intronic
1093403229 12:18772971-18772993 AGGGCCTGCTTGAGGGTAGAGGG + Intergenic
1093686032 12:22054880-22054902 GGGGCCTACTTGAGGGTAGAGGG - Intronic
1093787835 12:23213313-23213335 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
1093968598 12:25353306-25353328 CAGGTCTACTCGAGGGTAGAGGG + Intergenic
1094079599 12:26518357-26518379 AGGTCCTACTTGAGGGTGGAGGG + Intronic
1094171122 12:27493167-27493189 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1094226008 12:28046963-28046985 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1094232925 12:28128496-28128518 ATGACCTGCTTCAGGGTAGAAGG - Intergenic
1094255536 12:28421362-28421384 AGGGCCTACCTGAGGGTGGAGGG - Intronic
1094257108 12:28444667-28444689 GGGGTCTACTTGAGAGTGGAGGG + Intronic
1094262283 12:28514855-28514877 GTGACCTACTAGAGGGTAGAGGG + Intronic
1094277705 12:28697079-28697101 AGGGTTTACTTGAGGGTGAAAGG - Intergenic
1094407463 12:30132727-30132749 AGGGTCTACTCGAGGGTGGAGGG + Intergenic
1094722590 12:33079590-33079612 AGGGTCTACTTGAGGGTAGAGGG - Intergenic
1094759328 12:33512321-33512343 GGGATCTACTTGGGGGTGGAGGG - Intergenic
1094801157 12:34037454-34037476 AGGATCTACAGGAGAGTGGAGGG - Intergenic
1095032738 12:37314972-37314994 AGGATCTACTTGCGGATATTCGG + Intergenic
1095056623 12:37613260-37613282 AGGATCTGCTTGTGGGTATTTGG + Intergenic
1095114291 12:38333447-38333469 AGGATCTACAGGAGAGTGGAGGG - Intergenic
1095241550 12:39865865-39865887 AGGGATTACTTGGGGGTAGAGGG + Intronic
1095519540 12:43046280-43046302 GGGGCCTACTTGAGAGTAGAGGG + Intergenic
1095555863 12:43503721-43503743 TGGGCCTACTTGAGGGTGGATGG - Intronic
1095556198 12:43507975-43507997 AGGGCCTACTTGAGAGTGGAGGG + Intronic
1095571716 12:43690520-43690542 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1095575095 12:43727671-43727693 ATGGCCTACTTGAGGGTGGAGGG + Intergenic
1095620067 12:44242293-44242315 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1095680086 12:44964061-44964083 AGGGCCTACTTGAGGGTAGAAGG + Intergenic
1095836381 12:46643871-46643893 GGGGTCTTCTTGAGGGTAGAGGG + Intergenic
1095842910 12:46714024-46714046 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1096042979 12:48536226-48536248 AGGGCCTACTTGAGAGCAGAGGG + Intergenic
1096894256 12:54804464-54804486 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1096899963 12:54866621-54866643 GGGACCTACTCGAGGGTTGAGGG - Intergenic
1096929523 12:55191166-55191188 AGGATCTATCTGAGGGTAGAGGG - Intergenic
1097292886 12:57934068-57934090 GGGGTCTGCTTGAGGGTGGAGGG - Intergenic
1097318069 12:58194497-58194519 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
1097319962 12:58214445-58214467 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1097538311 12:60901820-60901842 GGGGCCTACTTGAGGGCAGAAGG + Intergenic
1097610698 12:61816177-61816199 GGGGTCTACTTGATGGTGGAGGG - Intronic
1098120690 12:67234655-67234677 GGGGTCTACTTAAGGGTAAAGGG - Intergenic
1098283192 12:68882242-68882264 AGCATCTACTTGAGGATGGAGGG - Intronic
1098308762 12:69127168-69127190 GGGATCTTCTTGGGGGTGGAGGG - Intergenic
1098399751 12:70061912-70061934 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1098508528 12:71283553-71283575 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1098603056 12:72356371-72356393 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1098663614 12:73131655-73131677 AGGGCCTACTTGAAGGTGGAGGG + Intergenic
1098765938 12:74488841-74488863 AGGGCCTACTTGAGGATAGAGGG + Intergenic
1098872187 12:75828901-75828923 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1098889205 12:75991580-75991602 TGGATTTACTTGTGGGTTGAGGG - Intergenic
1098945719 12:76587431-76587453 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1098989911 12:77054062-77054084 AGGGCCTACTTGAGGGTAGAGGG + Intronic
1099348205 12:81529808-81529830 AGGGGCTACTGGAGGGTAGAGGG + Intronic
1099404176 12:82239674-82239696 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1099647162 12:85372650-85372672 AGGACTTACTTGAGGGTGGAGGG - Intergenic
1099648673 12:85395531-85395553 AAGGTCTACTTGAGGGAGGATGG - Intergenic
1099662850 12:85587535-85587557 GGGGTCTACTTGAGAGTAGAGGG + Intergenic
1099663196 12:85593161-85593183 TGGGGCTACTTGAGGGTGGAGGG - Intergenic
1099827675 12:87799136-87799158 GGGGCCTACTTGAGGGTACAGGG - Intergenic
1099844210 12:88008218-88008240 GGGGTCTACCAGAGGGTAGAGGG - Intronic
1099866599 12:88290373-88290395 AGAATCGACTTGAGCATAGAGGG + Intergenic
1099874497 12:88388601-88388623 AGAATGTAGTTGAGGGTTGATGG - Intergenic
1100001770 12:89845185-89845207 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1100179873 12:92073658-92073680 GGGACCTACTTGAGGGTGGGGGG - Intronic
1100226815 12:92565860-92565882 TGGGGCTACTTGAGGGTGGAAGG + Intergenic
1100252897 12:92848396-92848418 AGGATCTGCTTGAGGCCAGGAGG + Intronic
1100344006 12:93709414-93709436 CGGGTCTACTTGAGGGGAGAGGG - Intronic
1100454506 12:94739383-94739405 CGGGTCTACTTGAGGGTGGCGGG - Intergenic
1100637993 12:96454165-96454187 GGGGTCTCCTTGAGGGTGGAAGG + Intergenic
1100675068 12:96857293-96857315 AGGGTCTACTTGAGGGTAGAAGG - Intronic
1100703797 12:97178483-97178505 ATGATCTGCTTCAGGGGAGAAGG + Intergenic
1100714376 12:97290234-97290256 AGCATCTGCTTGATGTTAGAAGG + Intergenic
1100928621 12:99580183-99580205 GGGGCCTACTTGAGGGTAGAGGG + Intronic
1101067320 12:101035840-101035862 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1101336766 12:103803631-103803653 GGGATCTACTGGAGGGTGGAGGG - Intronic
1101423735 12:104570374-104570396 AGGATCTGCTGGAGTGTGGAAGG - Intronic
1101477746 12:105066503-105066525 GGGAACTACTGAAGGGTAGAGGG + Intronic
1101759110 12:107644731-107644753 AGGGCCTGCTTGAGGGTAAAGGG - Intronic
1101806749 12:108070674-108070696 GGGATCTACTTGAGGGTGGATGG - Intergenic
1102649558 12:114429524-114429546 AGGGCTTACTTGAGGGTGGAGGG + Intergenic
1103032969 12:117632691-117632713 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1103051777 12:117786485-117786507 AGGGTCTGCTTAAGGGTGGAGGG - Intronic
1104155786 12:126130400-126130422 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1104225500 12:126828687-126828709 GGTATCTACTTGAGGGTGGAGGG + Intergenic
1104298032 12:127536381-127536403 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1104491126 12:129194446-129194468 GGGGTCTACGTGAGGGTGGAGGG + Intronic
1104619202 12:130298130-130298152 GGGGCTTACTTGAGGGTAGAGGG - Intergenic
1104626682 12:130362228-130362250 AGGGCCTACTTGGGGGTGGAAGG - Intronic
1105313444 13:19234961-19234983 AGGGCCTACTTGAGGCTGGAGGG + Intergenic
1105716616 13:23071902-23071924 AGGACCTGCTTGAGGATAGAGGG - Intergenic
1105732148 13:23228621-23228643 GGGACCTAATTGAGGGTGGAGGG - Intronic
1105930555 13:25047973-25047995 GGGACCTACTGGAGGGTGGAGGG - Intergenic
1106363584 13:29055522-29055544 AGGGCCTACTTGAGGGTAGAAGG - Intronic
1106426902 13:29639932-29639954 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1106653517 13:31717647-31717669 ATGACCTCCTTCAGGGTAGAAGG - Intergenic
1106742029 13:32654688-32654710 AGCATCTTCTTGACGGTGGAGGG - Intronic
1106985063 13:35336855-35336877 GGGGCCTACATGAGGGTAGAAGG + Intronic
1107082808 13:36392859-36392881 GGGACCTATTTGAGGGTAGAGGG - Intergenic
1107176139 13:37400990-37401012 AGGGCCTACTTGAGAGTGGAGGG + Intergenic
1107236584 13:38177755-38177777 AGGACCTCCTTGAGGGTTCAGGG + Intergenic
1107330087 13:39290180-39290202 GGGGCCTACTTGAAGGTAGAGGG + Intergenic
1108141777 13:47431034-47431056 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1108263688 13:48682881-48682903 GGCATCTACTTGAGGGTGGATGG - Intronic
1108467878 13:50736340-50736362 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1108787794 13:53926957-53926979 GGGGTCTACTTGAGGCTGGAGGG - Intergenic
1108839783 13:54598213-54598235 GGGTTCTACTTGAGGGTGAAAGG + Intergenic
1108885146 13:55171115-55171137 AGAGCCTACTTGAGAGTAGAGGG + Intergenic
1108982573 13:56537338-56537360 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1109114197 13:58360467-58360489 AGGGCCTACTTGAGGATAGAGGG + Intergenic
1109158289 13:58939342-58939364 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1109198628 13:59407009-59407031 GGGGCCTACTTGAGGGCAGAGGG - Intergenic
1109374823 13:61478614-61478636 AGGGCCTACTTGAGGGTAAAGGG - Intergenic
1109400391 13:61820104-61820126 CAGAGCTACTTGAGGGTGGAGGG + Intergenic
1109714175 13:66199547-66199569 AAGGCCTACTTGAGAGTAGAAGG + Intergenic
1109760011 13:66815749-66815771 AGGGCCTACTTGAGGCTGGAGGG + Intronic
1110004599 13:70250630-70250652 AGAATCTAGGTGAGAGTAGATGG - Intergenic
1110020703 13:70466744-70466766 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1110061019 13:71038211-71038233 AGGACCTACTTGAAGGTACAGGG + Intergenic
1110069330 13:71153657-71153679 GGGGCCTACTTGAGGATAGAGGG - Intergenic
1110149594 13:72234770-72234792 AGGTCCTACTTGAGGATGGAGGG - Intergenic
1110230295 13:73161024-73161046 TGGGCCTACTTGAGGGCAGAGGG + Intergenic
1110251648 13:73387225-73387247 AGGACCTACTTGAGGATGGAGGG + Intergenic
1110313393 13:74076798-74076820 GGGGTCGACTTGAGGGTGGAGGG - Intronic
1110387270 13:74928030-74928052 AAGGCCTACTTGAGGGTGGAAGG - Intergenic
1110431927 13:75434480-75434502 GGAAACTACTTGAGGGTGGAGGG + Intronic
1110482085 13:75990537-75990559 TGGGCCTACTTGAGGGCAGAGGG + Intergenic
1110802709 13:79718292-79718314 AGAAACTACTTAAGTGTAGAGGG - Intergenic
1110829990 13:80019604-80019626 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1110866468 13:80401646-80401668 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1110875243 13:80501559-80501581 AGGACCTACTTGAGGGCGGAGGG + Intergenic
1111101413 13:83593179-83593201 AGTACCTACTTGAGGGTGGAGGG - Intergenic
1111179406 13:84642209-84642231 AGGTCCTACTTGAGGGTGGCGGG + Intergenic
1111318731 13:86595667-86595689 AGGGCCTAATTGAGGGTGGAGGG + Intergenic
1111350153 13:87017828-87017850 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1111449912 13:88401517-88401539 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1111892375 13:94099949-94099971 TGCAGATACTTGAGGGTAGAGGG + Intronic
1111972398 13:94930417-94930439 AGGGCCTACTTGAGGGTGGCGGG - Intergenic
1112227401 13:97553289-97553311 GGGACCTACTTGAGGGTGGAGGG - Intergenic
1112364603 13:98746030-98746052 GGGGCCTACTTGAGGGTAGAGGG - Intronic
1112446201 13:99466438-99466460 CGGGCCTACTTGAGGGTGGAGGG - Intergenic
1112460260 13:99597822-99597844 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1112782700 13:102918586-102918608 AGGGCTTACTTGAGGGTAAAGGG - Intergenic
1112783230 13:102924988-102925010 AGGGCTTACTTGAGGGTGGAGGG + Intergenic
1112787409 13:102966403-102966425 AGTGCCTACTTGAGGGTGGAAGG - Intergenic
1112865099 13:103885450-103885472 AGGACCTACTTGAGGGTGAAAGG + Intergenic
1112912573 13:104506287-104506309 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1112916603 13:104558749-104558771 GGGGTCTACTTGATGGTGGAGGG - Intergenic
1113189802 13:107731555-107731577 GGGACCTACTTGAGGGTCGGGGG - Intronic
1113247799 13:108417970-108417992 GGGACCTACTTGAGGGTGGAGGG - Intergenic
1113358588 13:109607186-109607208 GGGGCCTACCTGAGGGTAGAGGG - Intergenic
1113363256 13:109651539-109651561 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1113390262 13:109889765-109889787 AGGGCCTACTTCAGGGTAGAGGG + Intergenic
1113526415 13:110981464-110981486 ATGACCTGCTTTAGGGTAGAAGG - Intergenic
1113988251 13:114336819-114336841 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1114159669 14:20150394-20150416 GGGGTCTACTTGAGGATGGAGGG + Intergenic
1114345360 14:21789258-21789280 AGGAATTACTTGAGGCTGGATGG + Intergenic
1114374352 14:22127873-22127895 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1114760269 14:25306545-25306567 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1114763687 14:25346502-25346524 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1114902537 14:27082431-27082453 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1115172429 14:30524564-30524586 ATGATCTGCTTCAGGGGAGAAGG + Intergenic
1115283262 14:31688817-31688839 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1115341896 14:32301421-32301443 AGGACCTACCTGAGGGTGGAGGG - Intergenic
1115391756 14:32861977-32861999 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1115891019 14:38029131-38029153 AGGGCTTACTTGAGGGTGGAGGG + Intronic
1116148278 14:41103029-41103051 GGGACCTACTTGAAGGTCGAGGG - Intergenic
1116182575 14:41553869-41553891 AGGACCTACTTGAGTGTGGAGGG + Intergenic
1116252932 14:42509976-42509998 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
1116504257 14:45659438-45659460 GGGGTCTACTTGAGGATGGAAGG - Intergenic
1116535676 14:46026334-46026356 GCGGTCTACTTGAGGGTGGATGG - Intergenic
1116553711 14:46275672-46275694 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1116578615 14:46608789-46608811 AGGGCCTACTTGAAGGTAGAGGG - Intergenic
1116592402 14:46795059-46795081 GGGTTCTACATGAGGGCAGAGGG - Intergenic
1116648354 14:47559242-47559264 GGGACCTACTTGATGGTAGAGGG - Intronic
1116737873 14:48717178-48717200 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
1116805235 14:49488083-49488105 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
1116810594 14:49536391-49536413 AGGGCCTACTAGAGGGTGGAGGG + Intergenic
1116816607 14:49590024-49590046 AGGGCCTACTTGAGGGTAGAGGG + Intronic
1117244380 14:53869597-53869619 GGGGTCTACTTGAGGGGGGAAGG + Intergenic
1117451828 14:55858616-55858638 GGGGCCTACTTGAAGGTAGACGG - Intergenic
1117671837 14:58115896-58115918 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1117686021 14:58254057-58254079 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1117712333 14:58544021-58544043 GGGATCTACTTGAGACTGGAGGG - Intronic
1117752047 14:58934627-58934649 TGAATCTACTTGAGGATGGAGGG - Intergenic
1117838637 14:59833687-59833709 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1117989926 14:61423360-61423382 TTGGTCTACTTGAGGGTAAAAGG + Intronic
1118081203 14:62362754-62362776 AGGCCCTACTTGAAGGTAGAGGG - Intergenic
1118528073 14:66668620-66668642 AGGGCCTACTTGAGGGTAGAAGG + Intronic
1118536031 14:66765599-66765621 GGGGCCTACTTGAGGGTAGAGGG + Intronic
1118598820 14:67457116-67457138 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1118680429 14:68236046-68236068 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1118757450 14:68855249-68855271 ACGACCTACTTCAGGGTAGACGG + Intergenic
1119094835 14:71819899-71819921 GGGGACTACTTAAGGGTAGAGGG - Intergenic
1119185711 14:72640920-72640942 AGGACCTAGTTAGGGGTAGAGGG + Intronic
1119489863 14:75022152-75022174 TGGGCCTACTTGAGGGTGGAGGG + Intronic
1119543928 14:75458323-75458345 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1120030880 14:79639369-79639391 GAGGTCTACTTGAGGGTAGAGGG - Intronic
1120231614 14:81846675-81846697 GAGATCTCCTTGAGGGAAGATGG + Intergenic
1120397483 14:83986141-83986163 ATGACCTACTTCAGGGAAGAAGG - Intergenic
1120448550 14:84634997-84635019 GGGATCTACTTGAGAGATGAAGG - Intergenic
1120820272 14:88905813-88905835 GGGAACTACTTGAGGGTGGAGGG - Intergenic
1121068263 14:90990864-90990886 AGGGCCTACTTGAGGGGAGAGGG + Intronic
1121163791 14:91771922-91771944 AGAGCCTACTTGAGGGTGGAGGG + Intronic
1121449297 14:93997191-93997213 AGGATCCACCTGTGGGTGGAGGG - Intergenic
1121798023 14:96751871-96751893 AGGGCCTACTTGGGGGTGGAGGG + Intergenic
1122036425 14:98952445-98952467 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1122380152 14:101297417-101297439 GGGGTCTACTTGAGGATAGAGGG + Intergenic
1122589382 14:102835742-102835764 AGGGCCTACTTGAGGGTGGAAGG + Intronic
1123009369 14:105340242-105340264 AGGATATACTTCTGGGTAAATGG + Intronic
1123217853 14:106828784-106828806 AGGTCCTACTTGAGTGTGGAGGG + Intergenic
1123769663 15:23516096-23516118 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1123889431 15:24761436-24761458 GGAGTCTACCTGAGGGTAGAGGG + Intergenic
1124228253 15:27916182-27916204 GGAGTCTACTTGAGGGTGGAAGG + Intronic
1124447851 15:29754357-29754379 GGGGTCTACTTGAGGGGGGAGGG + Intronic
1124556815 15:30733815-30733837 GGGACCTACTTGAGGATGGAGGG + Intronic
1124674458 15:31671921-31671943 GGGACCTACTTGAGGATGGAGGG - Intronic
1125087079 15:35742704-35742726 GGGACCTACTGGAGGGCAGAGGG - Intergenic
1125091766 15:35801393-35801415 AGGATATACGTGAAGGTAGGGGG - Intergenic
1125302988 15:38277272-38277294 AGGGCCTACTTGAGGGTGGGAGG - Intronic
1125382830 15:39105234-39105256 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1125443605 15:39729875-39729897 GGGGCCTACTTGAGGGCAGAGGG + Intronic
1125529176 15:40400579-40400601 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1125780754 15:42264857-42264879 TGGGCCTACTTGAGGGTGGAGGG - Intronic
1125873783 15:43126142-43126164 CGGACCTACTTGAGGGTGGAGGG + Intronic
1125891707 15:43271461-43271483 GGGGTCTACTTGAGGGATGAGGG - Intergenic
1126213589 15:46128817-46128839 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1126227130 15:46284053-46284075 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
1126502484 15:49361400-49361422 AGGACCTACTTGAGGGAGGAGGG - Intronic
1126507166 15:49418632-49418654 GGGGTCCACTTGAGGGTGGAGGG + Intronic
1126993343 15:54409532-54409554 GGGACCTCCTTGAGGGTGGAGGG - Intronic
1127055140 15:55123667-55123689 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1127163639 15:56219517-56219539 AGGTCCTACTTGAGGGTAGAGGG - Intronic
1127188617 15:56506465-56506487 TGGATCAACTTGAGCCTAGAGGG - Intergenic
1128369328 15:67028759-67028781 AGGGCCTACTTGAGAGTAAAGGG + Intergenic
1128408035 15:67363712-67363734 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1128814613 15:70598647-70598669 AGGATTGACTTCAGGGTACATGG - Intergenic
1128926881 15:71664649-71664671 AGGGCCTACTTGAGGGTGGGAGG - Intronic
1129081806 15:73047902-73047924 CGGGTCTACTTTAGGGTAGAGGG - Intergenic
1129585424 15:76858620-76858642 AGGGCCTACTTGAGGGTAGAGGG - Intronic
1129832478 15:78679777-78679799 AGGGTCCACTTGAGGAAAGATGG + Intronic
1129965685 15:79733420-79733442 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1130085537 15:80775888-80775910 AGGAGCTACTACAGGGTAGATGG + Intergenic
1130439449 15:83937497-83937519 AGGGTCTACTTGAGGGTGGAAGG + Intronic
1130677308 15:85964672-85964694 AGGAAATCCTTGAGGCTAGAAGG - Intergenic
1130909164 15:88259130-88259152 AGGGTCTACCAGAGGGTAGAAGG + Intergenic
1131618419 15:94041199-94041221 GGGGTCTACTTGAGGGTGCAGGG + Intergenic
1131639696 15:94278726-94278748 ACGGCCTACTTGAGGGTAGAGGG - Intronic
1131956176 15:97738677-97738699 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1131982921 15:98013001-98013023 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1132260835 15:100423588-100423610 AGGTCCTACTTGAGGGCGGAGGG + Intronic
1133093696 16:3426343-3426365 AGCTTCTCCTTGAGGATAGAAGG - Intronic
1134284809 16:12851545-12851567 GGGCTCTACTTGAGGGTGGAGGG + Intergenic
1134407213 16:13971014-13971036 ATGTTCAACTTCAGGGTAGAGGG + Intergenic
1134464828 16:14465987-14466009 AGGGCCTACTTAAGGGTGGAGGG + Intronic
1135246932 16:20864971-20864993 GGGGTCTACTTGAGGGTAGAGGG + Intronic
1135461201 16:22644761-22644783 GGGGCCTACTTGAGGATAGAGGG - Intergenic
1135469306 16:22715195-22715217 AGGGCCTACTTGTGGGTGGAGGG + Intergenic
1135658480 16:24272998-24273020 GGGGCCTACTGGAGGGTAGAGGG - Intronic
1136075333 16:27813245-27813267 AGGACCTACTTGAAGGTGGAGGG - Intronic
1136678017 16:31931960-31931982 AGGACCTACTTGAGGGTGGAGGG + Intergenic
1137375779 16:47950542-47950564 GGGACCGACTTGAGGGTGGAGGG - Intergenic
1137837142 16:51603463-51603485 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1138058080 16:53857238-53857260 AGGGCCCACTTGAGGGTGGAAGG - Intronic
1138276823 16:55741029-55741051 AGGGTCTACTTGAGGGATGACGG + Intergenic
1138720974 16:59078644-59078666 GGGATCTACTTGAGGGCAGAGGG - Intergenic
1138760689 16:59540306-59540328 AGGGCCTACTTGAGGATGGAGGG + Intergenic
1138983906 16:62303606-62303628 GGGACCTACTTGAGGGTGAAGGG + Intergenic
1139154188 16:64421302-64421324 AGGGTCTACTTGAGGGTGTAGGG - Intergenic
1139235276 16:65331687-65331709 GGGATCTATTGGAGGGTGGAGGG - Intergenic
1139275395 16:65723193-65723215 AGGACCCACTTGAGGGTGGAGGG - Intergenic
1140152030 16:72377331-72377353 GGGACCTATTGGAGGGTAGAGGG + Intergenic
1140542008 16:75764823-75764845 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
1140552329 16:75880147-75880169 TGGTTCTACTTGAGGGTGGAGGG - Intergenic
1140572790 16:76128306-76128328 AGGACCTACTTGAGAGCAGAGGG - Intergenic
1140591809 16:76362738-76362760 AGAACCTAATTGAGGGTGGAGGG + Intronic
1140775252 16:78243516-78243538 GGGGCCTACTGGAGGGTAGAGGG - Intronic
1140942130 16:79731984-79732006 AGGGCCCACTTGAGGGTGGAGGG + Intergenic
1141128473 16:81418021-81418043 AGTTCCTACTTGAGGGTGGAGGG - Intergenic
1141150632 16:81562430-81562452 TGGATTTGCTTGAGGGCAGAAGG - Intronic
1141311670 16:82919363-82919385 GGGACCTATTTGAGGGTGGAGGG - Intronic
1141348718 16:83273337-83273359 AGGGCCTACTTGAGGGTGAAGGG - Intronic
1141377731 16:83547454-83547476 AGGGCCTACTTGAGGGTAGATGG - Intronic
1142317838 16:89360058-89360080 GGGGTCTACTTGAGGGGAGAGGG - Intronic
1142453141 16:90196131-90196153 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1143094329 17:4469172-4469194 AGGATCCACTTGAGCCCAGAAGG - Intronic
1143124667 17:4634019-4634041 AGCATCTACTTGTGGACAGAGGG + Intronic
1143348464 17:6268128-6268150 GGAGCCTACTTGAGGGTAGAGGG - Intergenic
1144383223 17:14723727-14723749 GGGGCCTACTTGAGGGTAGAGGG + Intergenic
1144428058 17:15163651-15163673 AGGGTCTACTTGAGGATTGAGGG + Intergenic
1144725155 17:17498154-17498176 AGGAGCCAGTTGAGGGTACATGG + Intergenic
1144817942 17:18049604-18049626 GGGGCCTACTTGAGGGTAGAGGG - Intronic
1145764595 17:27449627-27449649 GGGATCTACTCGGGGTTAGAAGG + Intergenic
1146532172 17:33617487-33617509 AGGGACTACTGGAGGGTGGAGGG + Intronic
1146963061 17:37001228-37001250 AGGATCTGCTTGAGGTTGGGAGG + Intronic
1147484075 17:40795853-40795875 GGGATCTAGTTCAGGGAAGAAGG + Intronic
1147692247 17:42323445-42323467 AGGACCTGCCTGAAGGTAGACGG - Intronic
1148564958 17:48627198-48627220 AGAAACTACTTGAGGTTAAAGGG + Intronic
1149014827 17:51896244-51896266 GGGGCCTCCTTGAGGGTAGAGGG - Intronic
1149091047 17:52780062-52780084 GCGATGTACTTGAGGGTGGAGGG + Intergenic
1149128190 17:53260891-53260913 AGGGCCTACTTGAGGGTAAAGGG + Intergenic
1149133944 17:53342166-53342188 AGGGCCTACTTGAGGTTGGAGGG + Intergenic
1149198080 17:54147689-54147711 AGTGCCTACTTGAGGGTGGAGGG - Intergenic
1149247979 17:54733976-54733998 GAGGTCTACTTGAGGGTGGAAGG + Intergenic
1149395223 17:56234504-56234526 GGGACCTACTTGAGGGTGGAGGG - Intronic
1149742040 17:59055762-59055784 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1150048470 17:61936153-61936175 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1150171463 17:63000068-63000090 AGGGCCTACTTGAGGATGGAGGG + Intergenic
1150175324 17:63048787-63048809 AGGGCCTACTTGAGGGTGAAGGG + Intronic
1150421833 17:65043773-65043795 TGGATCTACTGCAGAGTAGATGG + Intronic
1150423749 17:65060057-65060079 GGGACCTACTTGAGGGTGGAAGG + Intergenic
1150444751 17:65220313-65220335 AGGATATATTTGAGGGGAGGAGG + Intronic
1150831667 17:68526755-68526777 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1150846776 17:68666470-68666492 GGGGTCTACTTGAGGGGGGAGGG - Intergenic
1151021240 17:70619757-70619779 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1151023644 17:70650876-70650898 GGGATCTACTTGACGGTGAAGGG - Intergenic
1151060713 17:71090575-71090597 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1151069810 17:71196039-71196061 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1151143928 17:72021165-72021187 GGGATCTACTAGAGGGTGGAAGG - Intergenic
1151530119 17:74698694-74698716 AGGGCCTACTTGAGGATGGAGGG + Intronic
1151899234 17:77000865-77000887 AGGGTCTATTTGAGGGTGGCGGG + Intergenic
1152054410 17:78012329-78012351 GGGTTCTCCTTGAGGGTGGAGGG + Intronic
1152482559 17:80564749-80564771 GGGGCCTACTTGAGGGTAGACGG - Intronic
1153019358 18:612635-612657 AGGAGCTACTTGAGGATAAGTGG - Intronic
1153329147 18:3855269-3855291 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1153353454 18:4108133-4108155 ATGACCTACTTCAGGGAAGAAGG - Intronic
1153359516 18:4177619-4177641 AGGGCCTACATGAGGGTGGATGG - Intronic
1153411226 18:4795587-4795609 GGGACCTACCTGAGGGTGGAGGG + Intergenic
1153672360 18:7424044-7424066 TGGGTCTACTTGACGGGAGAGGG - Intergenic
1153723793 18:7935822-7935844 AGGGTCTACTTTAGGGTGGAGGG - Intronic
1153760385 18:8325317-8325339 GGGACCTACCTGAGGGTAGAGGG - Intronic
1154114730 18:11602868-11602890 AGGACCCACTTGAGGGTGGAGGG + Intergenic
1154402027 18:14048454-14048476 GGGGTCTACTTGAGAGGAGAGGG - Intergenic
1155090777 18:22507995-22508017 GGAACCTACTTGAGGGTGGAAGG + Intergenic
1155110109 18:22706408-22706430 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1155131283 18:22937212-22937234 GGGACCTACATGAGGGTGGAGGG - Intronic
1155262510 18:24058149-24058171 AGGGTCTACTTGAGGGTGGAGGG + Intronic
1155576916 18:27258617-27258639 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1155613245 18:27692933-27692955 GGGACCTACTTCAGGGTGGAGGG - Intergenic
1155770805 18:29695780-29695802 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1155844730 18:30691648-30691670 GGGGTGTACTTGAGGGTGGAAGG - Intergenic
1155931281 18:31711410-31711432 TGGGTCTACTTGAGGATGGAGGG - Intergenic
1156051470 18:32940677-32940699 GGGGTCTACTTGAGGGTGAAGGG - Intronic
1156067871 18:33166932-33166954 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1156340582 18:36206640-36206662 GGGGCCTACTTGAGGGTAGAAGG - Intronic
1156561872 18:38134491-38134513 GGGGCCTACTTGAGGCTAGAAGG - Intergenic
1156826681 18:41438284-41438306 AGGGCCTACTTGAGGGTGGAAGG - Intergenic
1156928490 18:42612257-42612279 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1157139715 18:45093680-45093702 AAGGCTTACTTGAGGGTAGAGGG + Intergenic
1157144342 18:45146242-45146264 ACAACCTACTTGAGGGTGGAGGG - Intergenic
1157170192 18:45396823-45396845 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1157235897 18:45965286-45965308 AGGGCCTACTTGAGGGCAGAAGG + Intronic
1157237228 18:45976186-45976208 GGGATCTGTTTGAGGGTGGAGGG + Intergenic
1157826101 18:50813825-50813847 AGGGCCTACTTGAGGGTTGGAGG + Intronic
1157838687 18:50933817-50933839 GGGGCCTACTTAAGGGTAGAGGG - Intronic
1157987789 18:52459352-52459374 GGTACCTACTTGAGGGTGGAGGG - Intronic
1158055912 18:53279925-53279947 GGGGTCTACTTAAGGGTGGAAGG + Intronic
1158057023 18:53293625-53293647 AGGGCCTACTTGAAGGTATAGGG - Intronic
1158738086 18:60106930-60106952 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1158743208 18:60167257-60167279 TTCATCTACATGAGGGTAGATGG + Intergenic
1159485112 18:69045759-69045781 GGGACCTACTTGAGGGTGGAGGG - Intronic
1159524514 18:69570029-69570051 GGGATCTACTTGAGGGAGGAGGG + Intronic
1159732338 18:72044479-72044501 AAGACCTACTTGAGGGTGGAGGG + Intergenic
1159905537 18:74087389-74087411 AGGTCCTACTTGAGGGTGGAGGG - Intronic
1160138881 18:76300997-76301019 AGGACCTGCTTGAGGGTAGAGGG + Intergenic
1160280906 18:77489765-77489787 AGGGCCTACTGGAGGGTGGAGGG + Intergenic
1160319656 18:77878413-77878435 AGGGCCTACTGGAGGGTGGAGGG - Intergenic
1160644345 19:172635-172657 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1161880558 19:6948421-6948443 AGGTCCTTCTTGAGGGTGGAAGG - Intergenic
1162634863 19:11959887-11959909 AGATTCTACTTAAGAGTAGATGG - Intronic
1163071089 19:14842220-14842242 GGGACCTATTTGAGGGTGGAAGG - Intergenic
1163181039 19:15602175-15602197 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1163887729 19:19982858-19982880 AGGGTCTGCTTGAGAATAGAGGG + Intergenic
1163965835 19:20746449-20746471 AGGGTCTACTTGAGAGTAGAGGG - Intronic
1165042692 19:33080537-33080559 TGGACCTACTTGAGGGTGGAAGG + Intergenic
1165972974 19:39649024-39649046 GGGGCCTACTTGAGGGTTGAGGG + Intergenic
1166025519 19:40080663-40080685 AGGGCCTACTTGAGAGTAGAGGG + Intronic
1166398643 19:42461548-42461570 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1166409130 19:42544721-42544743 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1166772545 19:45292780-45292802 AGGATCCACTTGAGGCCAGGAGG + Intronic
1167776062 19:51557453-51557475 AGGATCTAGTTGAGGATGGAAGG + Intergenic
1167837641 19:52087368-52087390 GGGATCTACCTGAGAGTGGAAGG - Intronic
1167924059 19:52809465-52809487 GGCGTCTACTTGAGGGTGGAGGG + Intronic
1167995686 19:53400150-53400172 GGCGTCTACTTGAGGGTGGAGGG - Intronic
1168374517 19:55865140-55865162 AGGGCCTACTTGAGAGCAGAGGG - Intronic
1168389141 19:55992024-55992046 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1168473416 19:56659439-56659461 AGGTGCTACTTGAGGGTGGTCGG - Intergenic
925302031 2:2823856-2823878 GGGGTCTACTTGACGGTGGAGGG - Intergenic
925565727 2:5252190-5252212 GGGGTCTACTTGAGGGCGGAGGG - Intergenic
926072055 2:9904260-9904282 AGGGCCTACTTGAGGGTGGAGGG - Intronic
926548914 2:14277193-14277215 AGGACCTACTTGAGGGTGAATGG - Intergenic
926557232 2:14373280-14373302 AGGGAGTACTTGAGGGTGGAGGG + Intergenic
926615997 2:14997140-14997162 GGGATGTACTTGAGGATGGAGGG + Intergenic
926835463 2:17014363-17014385 GGGGTCTACTTGAAGGTGGAGGG - Intergenic
926856382 2:17260670-17260692 AGAGCCTCCTTGAGGGTAGAGGG - Intergenic
926981865 2:18580926-18580948 AGGGCCTACTTGAGGGTGGAGGG + Intronic
927046623 2:19285623-19285645 GGGACCTACTTGAGGGTACAGGG + Intergenic
927078502 2:19603668-19603690 AGGGCCTACTTGAGGGTGGAAGG + Intergenic
927128091 2:20031869-20031891 AGGGCCTACCTGAGAGTAGAGGG + Intergenic
927165623 2:20317708-20317730 GGGGCCTCCTTGAGGGTAGAGGG - Intronic
927329715 2:21848075-21848097 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
927381965 2:22489597-22489619 AGGATCTACTTGAGGGTAGAGGG + Intergenic
928041535 2:27882915-27882937 GGGGTCTACCTGAGGGTGGAGGG + Intronic
928049759 2:27978794-27978816 GGGGCCTACTTGAGGGTGGAGGG - Intronic
928372424 2:30750294-30750316 GGGATCTACTTGAGTGGGGAGGG + Intronic
928432266 2:31230185-31230207 GGGGTCTAGTTGAGGGTGGAGGG - Intronic
928503409 2:31922633-31922655 GAGACCTACTGGAGGGTAGAAGG - Intronic
928669141 2:33582528-33582550 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
929238636 2:39630735-39630757 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
929529861 2:42742876-42742898 TGGATTTGCTTGAAGGTAGATGG + Intronic
929557621 2:42935409-42935431 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
930086780 2:47503388-47503410 AGGAGCTACCTGGGGGTTGAGGG + Intronic
930141700 2:47957169-47957191 GGGGTCTACTTGAGAGTGGAGGG + Intergenic
930147241 2:48019786-48019808 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
930211300 2:48640516-48640538 TGGGTCTACTTAAGGGTGGAGGG + Intronic
930233636 2:48868045-48868067 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
930302530 2:49634977-49634999 AAGTTCTACTTGAAGGTGGAGGG - Intergenic
930325134 2:49906730-49906752 AGGATCTACTTGAGCCTGGAAGG + Intergenic
930347065 2:50196896-50196918 GAGATCTATTTGAGGGTGGAGGG + Intronic
930425162 2:51203878-51203900 AGGTCTTACTTGAGGGTGGAGGG - Intergenic
930450495 2:51530622-51530644 GGGGTCTTCTTGAGGGTGGAGGG - Intergenic
930552941 2:52858593-52858615 AGGGCTTACTTGAGGGTGGAGGG + Intergenic
930928800 2:56855238-56855260 AGGGTCTACTTGAAGATAGACGG - Intergenic
931062356 2:58545508-58545530 ATGATCTGCTTTAGGGGAGAAGG + Intergenic
931286688 2:60838060-60838082 ATGATCTGCTTCAGGGCAGAAGG - Intergenic
931425748 2:62169475-62169497 TGGGTCTACTTGAGGGTGGAGGG - Intergenic
931454404 2:62396752-62396774 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
931841494 2:66154661-66154683 GGGATATACTTGAGGGTGAAGGG - Intergenic
931875451 2:66506999-66507021 AGTATCTACATGAGGGAAAATGG - Intronic
931921673 2:67023786-67023808 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
932003840 2:67908403-67908425 AGGGCCTACTTGAGGGTGGAAGG + Intergenic
932173243 2:69576497-69576519 GGGGTATACTTGAGGGTGGAGGG - Intronic
932222572 2:70011094-70011116 GGGACCTCCTTGAGGGTGGAGGG + Intergenic
932532988 2:72557636-72557658 AAGGTCTACTTGAGGGTGGAGGG + Intronic
932647443 2:73518119-73518141 GGGGCCTACTTGAGGGTGGAGGG - Intronic
932913305 2:75828319-75828341 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
933080885 2:77984042-77984064 GGGATTTACTTGAGTGTGGAGGG + Intergenic
933162614 2:79042783-79042805 GGGATCTACCTGAGGGTGAAGGG + Intergenic
933168966 2:79104297-79104319 AGGGCCTACTTGAAGATAGAAGG + Intergenic
933271310 2:80235963-80235985 GGGGTCTACTGGAGGGTGGAGGG - Intronic
933285881 2:80384154-80384176 GAGGTCTACTTGAGGGTGGAGGG + Intronic
933355488 2:81205263-81205285 AGGGCCTACTTGAGGGGAAAGGG - Intergenic
933451276 2:82455269-82455291 GGGGTCCACTTGAGGGAAGAGGG + Intergenic
933451782 2:82463140-82463162 AGGGTCTATTTGAGGGTGAAGGG - Intergenic
933498231 2:83078349-83078371 GGGGCCCACTTGAGGGTAGATGG - Intergenic
933554185 2:83811178-83811200 GGGGTCTACTTGAGGGTGGCAGG + Intergenic
933579906 2:84113790-84113812 GGGACCTACTTGTGGGTGGAGGG - Intergenic
933587812 2:84199156-84199178 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
933844041 2:86310985-86311007 AGAATCTACTTCAGTCTAGAAGG + Intronic
934154329 2:89181695-89181717 GGGGTCTACCTGAGGGTGGAGGG + Intergenic
934212902 2:90000245-90000267 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
934580676 2:95435236-95435258 GTGATCTACTTGAGAGTGGAGGG + Intergenic
934598775 2:95641481-95641503 GTGATCTACTTGAGAGTGGAGGG - Intergenic
935491259 2:103723116-103723138 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
935665964 2:105512979-105513001 AGGAACTACTTGAGGGTGGAGGG - Intergenic
935785842 2:106548095-106548117 AGGGTCTACTTGAGGGGGAAAGG - Intergenic
936729411 2:115361824-115361846 AGGATCTGCTTGAGGTGTGATGG + Intronic
936791240 2:116155814-116155836 GGGATCTACTTGAGGTTGGAGGG - Intergenic
936857123 2:116972053-116972075 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
937190198 2:120088422-120088444 GGGATCTACTTGAGTGGGGAGGG + Intronic
937503224 2:122506401-122506423 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
937608321 2:123827861-123827883 GGAGTCTACTTGAGGGTAGAGGG + Intergenic
937728314 2:125194143-125194165 GAGATCTACTTGAGAGTGGAGGG + Intergenic
938095840 2:128462712-128462734 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
938215974 2:129515633-129515655 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
938485276 2:131700589-131700611 AGGGCCTATGTGAGGGTAGAGGG - Intergenic
938507624 2:131903344-131903366 AGAGCCTACTTGAGGGTGGAGGG + Intergenic
938623411 2:133082038-133082060 AGGGCCTACTTGAGGGTGGAGGG - Intronic
938892264 2:135717564-135717586 TGGGTCTACTTGAGGGGAAAGGG + Intronic
939197094 2:138986798-138986820 AGGACATACTTGAGGGTGAAGGG - Intergenic
939197710 2:138992609-138992631 GGGGTCTACTTGAGGGTGGATGG + Intergenic
939274504 2:139983699-139983721 TGGACCTACTTGAGGGCAGAGGG - Intergenic
939335597 2:140823923-140823945 GGATTCTACTTGAGGGTGGAAGG + Intronic
939526147 2:143296819-143296841 GGGATCTACTTGAGGGGAGAGGG - Intronic
939945955 2:148411012-148411034 AGGACCCACTTGAGCGTGGAGGG - Intronic
940038797 2:149337789-149337811 GGGGTCTACTTGAGGGTAAAGGG - Intronic
940078657 2:149774010-149774032 CGGGTCTACTTGACGGTGGAGGG - Intergenic
940539103 2:154988063-154988085 AGGGCTTGCTTGAGGGTAGAGGG + Intergenic
940547520 2:155107522-155107544 AGGACCTACTTTAGGGTGGAGGG + Intergenic
940628664 2:156209593-156209615 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
940708488 2:157133321-157133343 GGGGCCTACTTGAGGGTTGAGGG + Intergenic
940831682 2:158473641-158473663 TGGGTCTACTTGAGGGTAGAGGG + Intronic
941078710 2:161035524-161035546 AGCGTCTACTTGAGGATAGAGGG - Intergenic
941239957 2:163024994-163025016 AGGGCCTACTGGAGGGCAGAGGG + Intergenic
941566005 2:167109023-167109045 GGGGCCTACTTGAGGGTAGAGGG - Intronic
942002161 2:171658857-171658879 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
942159099 2:173163279-173163301 GGGATCTACTTGAAGGTGGAGGG - Intronic
942256729 2:174109958-174109980 GGGGTCTACTTGAGGAAAGAGGG - Intronic
942316374 2:174699907-174699929 AGGATCTGCTTGAGCCCAGAAGG + Intergenic
942510065 2:176688550-176688572 AGAATCTCCCTGATGGTAGAGGG + Intergenic
942843041 2:180387343-180387365 GGAGTCTACTTGAGGATAGAGGG - Intergenic
942917580 2:181330195-181330217 GGGATCTACTTGAGGGTGAAGGG + Intergenic
943030047 2:182675109-182675131 GGGTCCTACTTGAGGGTAGAGGG - Intergenic
943053543 2:182946427-182946449 AGGGCCTACTTGAAGGTAGAGGG + Intronic
943124460 2:183779420-183779442 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
943155565 2:184170509-184170531 AGGGACTACTAGAGGGGAGAGGG + Intergenic
943177241 2:184492375-184492397 AGGTCCTACTTAAGGGTGGAGGG + Intergenic
943322371 2:186461470-186461492 GGGATCTACTTGATGGGAGAGGG + Intergenic
943323839 2:186474920-186474942 TGGGCCTACTTGACGGTAGAGGG + Intergenic
943500819 2:188687440-188687462 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
943611475 2:190039674-190039696 GGGGTCTACTTGAGGGGAGAGGG - Intronic
943911008 2:193567800-193567822 CTGTTCTACTTGAGGGTGGAGGG - Intergenic
943972816 2:194432570-194432592 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
944021299 2:195107697-195107719 AGGGCCTACTTGAGAGTGGAGGG + Intergenic
944058017 2:195543859-195543881 AGGGCCTACTTGAGGGTGGATGG + Intergenic
944085851 2:195847480-195847502 GGGGCCTACTTGAGGGTGGAGGG + Intronic
944171586 2:196785207-196785229 AGTATGTACTTCAGGGTAGTAGG - Intronic
944269537 2:197765847-197765869 GGGGTCTACTTGAGGGTGGAGGG - Intronic
944284675 2:197935600-197935622 GGAACCTATTTGAGGGTAGAGGG + Intronic
944360834 2:198854264-198854286 GGGACCTACTGGAGGGTGGAAGG + Intergenic
944537144 2:200722341-200722363 GGGGTCTACTTGAGGGTTGTGGG + Intergenic
944622293 2:201528745-201528767 AGGGCCTACTTGAGGGTGGAAGG + Intronic
944774185 2:202945465-202945487 GGGGTCTACTTGAGAGTGGAGGG - Intronic
945015831 2:205514992-205515014 GGGGTCTATTTGAGGGTGGAAGG - Intronic
945519209 2:210802243-210802265 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
945604118 2:211906706-211906728 GTGGCCTACTTGAGGGTAGAGGG - Intronic
945798587 2:214395682-214395704 AGGGCCTACTTGAGGGTGGAGGG - Intronic
946135068 2:217639227-217639249 AGGGCCTACTTGAGGGTGCAGGG + Intronic
946344286 2:219095673-219095695 AGGATCTAGTTCAGGGAGGAGGG + Intronic
946520869 2:220463545-220463567 AAGATCTACTTGAGTCTTGAGGG + Intergenic
946594139 2:221287552-221287574 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
946878332 2:224152400-224152422 AGGGCCTACTTGAGAGTGGAAGG - Intergenic
947427841 2:229999862-229999884 GGTGTCTACTTGAGGGTGGAGGG - Intronic
947438441 2:230094249-230094271 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
947477665 2:230465579-230465601 GGGGTCTACTTGAGGATGGAGGG + Intronic
947779355 2:232743564-232743586 GGGGTCTACTTGGGGGTGGAAGG - Intronic
947975087 2:234358362-234358384 AGGGCCTACTTGAGGGTGGGAGG - Intergenic
947998537 2:234548399-234548421 CGGGTCTACTTGGGGGTGGAGGG + Intergenic
948043466 2:234923866-234923888 AATGTCTACTTGAGGGTGGAGGG - Intergenic
948534444 2:238635553-238635575 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
948552283 2:238781616-238781638 AGGGCCTGCTTGAGGGTGGAGGG + Intergenic
948850287 2:240702330-240702352 AGGCTCTACGAGAGGGTAGGGGG - Intergenic
948885611 2:240881701-240881723 AGGTTCTACTTGGAGGGAGAAGG - Intergenic
949054618 2:241921059-241921081 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
949084579 2:242140796-242140818 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1169024640 20:2358860-2358882 AGGGCCTACTTGGGGGTGGAGGG - Intergenic
1169514678 20:6303050-6303072 GGGACCTACCTGAGGGTGGAGGG - Intergenic
1169545907 20:6650434-6650456 AGTTGCTACTTGAGGGTGGAGGG + Intergenic
1169901558 20:10557873-10557895 AGTACCTACTTGAGGGCAGCAGG + Intronic
1169989510 20:11485350-11485372 GGGGCCTATTTGAGGGTAGAGGG - Intergenic
1170053001 20:12167327-12167349 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
1170075905 20:12418736-12418758 CAGATCTACTTGAGGGAGGAAGG + Intergenic
1170108643 20:12780539-12780561 GGGACCTACTTGAGGGTGGACGG - Intergenic
1170143244 20:13146264-13146286 GGGATCTGCTTGAGGGAGGAGGG + Intronic
1170168676 20:13387020-13387042 AAGACCTACTTGAGAGTGGAGGG - Intergenic
1170249516 20:14264731-14264753 AGGATCTAGTTGAAGGAAGAAGG + Intronic
1170350688 20:15437653-15437675 GGGGTCTACTCGAGGGTGGAGGG - Intronic
1170515408 20:17124434-17124456 AGGGTCTACTTGAGGTTGGAGGG + Intergenic
1170521196 20:17187314-17187336 TGGATCTACTTGAGGGTGGAGGG + Intergenic
1170638539 20:18131111-18131133 AGATTCTAATAGAGGGTAGATGG + Intergenic
1171117908 20:22542480-22542502 GGGTCCTACTTGAGGGTGGAGGG - Intergenic
1171153488 20:22848707-22848729 GGGATCTACTTGAAGATGGAGGG + Intergenic
1171158831 20:22902844-22902866 AGGGCCTACTTGAGGATAGAAGG + Intergenic
1171231092 20:23485915-23485937 GGGGCCTACTTGAGGATAGAGGG - Intergenic
1171239665 20:23554949-23554971 AGGGCCTAGTTGAGGGTGGAGGG - Intergenic
1171779093 20:29402518-29402540 GGGGTCTACTTGAGGGGGGAAGG + Intergenic
1172402468 20:34661365-34661387 TGGGCCTACTTGAGGGTGGAGGG - Intronic
1172680223 20:36708326-36708348 AGGATCATCTTGAAGGGAGATGG - Intronic
1173380482 20:42535311-42535333 GGGGAGTACTTGAGGGTAGAGGG + Intronic
1173517652 20:43676273-43676295 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1173559881 20:43995664-43995686 GGGTTCTACTTGAGGGTGGGAGG - Intronic
1173770345 20:45651069-45651091 GGGGTCTACTTGAGGGTGAAGGG - Intronic
1174680845 20:52406759-52406781 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1174936127 20:54871022-54871044 AGGGTCTACTTGAGTGGGGAGGG + Intergenic
1175282354 20:57812465-57812487 GGGACCCACTTGAGGGTGGAGGG - Intergenic
1175675663 20:60944745-60944767 AGGTTCTACTTGGGAGAAGAAGG - Intergenic
1176281159 20:64313290-64313312 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1176865636 21:14052967-14052989 AGGATCTACATGAGGGTGGAGGG - Intergenic
1176934572 21:14851288-14851310 AGGGCCTACTTGAGGGTGGGAGG - Intergenic
1177033959 21:16018673-16018695 AGTCTCCATTTGAGGGTAGAGGG + Intergenic
1177370951 21:20202470-20202492 GGGGCCTACTTGATGGTAGAGGG + Intergenic
1177544699 21:22541320-22541342 GGGGTCTACATGAGGGTGGAGGG + Intergenic
1177673175 21:24260793-24260815 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1177764866 21:25446016-25446038 AGGGCCTATTTCAGGGTAGAGGG + Intergenic
1177884229 21:26729866-26729888 GGGGCCTTCTTGAGGGTAGATGG - Intergenic
1177886413 21:26751220-26751242 GGAGTCTACTTGAGGGTAGAAGG + Intergenic
1178060260 21:28845950-28845972 TGGGCCTACTTGAGGGCAGAGGG - Intergenic
1178203446 21:30435718-30435740 GGGATCTACTTGAGGGAGGAGGG - Intergenic
1178224883 21:30704775-30704797 GGGGTCTAATTGAGGGTGGAGGG - Intergenic
1178489520 21:33040234-33040256 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1178628416 21:34238285-34238307 GGGACCTACTTGAGGCTGGAGGG + Intergenic
1178956037 21:37022838-37022860 AGGGCCTACTTGAGGATGGAGGG - Intergenic
1179086216 21:38220185-38220207 GGGGTCTACTTGAGGGCACAGGG + Intronic
1179092175 21:38276544-38276566 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1179121855 21:38554660-38554682 AGGGGCTGCTTGAGGGTGGAGGG + Intronic
1179164146 21:38922497-38922519 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
1179174509 21:38997958-38997980 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1179466260 21:41575946-41575968 GGGACCTACCTGAGGGTGGAGGG + Intergenic
1179476900 21:41652571-41652593 GGAGTCTACTTGAGGGTGGACGG - Intergenic
1182042160 22:27246691-27246713 AGGATCTATTGATGGGTAGATGG + Intergenic
1182042174 22:27246784-27246806 AGGATCTATTGATGGGTAGATGG + Intergenic
1182044378 22:27262815-27262837 AGTTTCTACTTGATGGAAGAGGG + Intergenic
1182176804 22:28298535-28298557 AGGATTTACTTGAGTCTAGAAGG - Intronic
1182263123 22:29090369-29090391 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1182591143 22:31381115-31381137 GGGACCTACTTGAGGGTGCAGGG - Intergenic
1182807052 22:33081707-33081729 TGGATAGACATGAGGGTAGAAGG - Intergenic
1183758353 22:39791889-39791911 AGGGCCTACTTGAGGGAGGAGGG - Intronic
1184156535 22:42671207-42671229 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1184307242 22:43613599-43613621 GAGACCTACTTGAGGGTGGAGGG + Intronic
1184647620 22:45904677-45904699 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
949225461 3:1688421-1688443 GGGACCTACTTGAGGGTGGAGGG - Intergenic
949270982 3:2216375-2216397 GAGGTCTACTTGAGGGTGGAGGG + Intronic
949376383 3:3394595-3394617 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
949509574 3:4756483-4756505 GAGGTCTACTTGAGGGTGGAGGG - Intronic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
949761350 3:7474337-7474359 AGGGTCTACTTGAGAGGACAGGG - Intronic
949934740 3:9107978-9108000 AGGATGGAATTGTGGGTAGAAGG + Intronic
951015355 3:17725868-17725890 GGGGCCTACTTGAGGGTTGAGGG - Intronic
951070320 3:18320642-18320664 CGGGCCTACTTGAGGGTGGAGGG - Intronic
951309002 3:21100673-21100695 AGGACCCACTTGAGGGTGGAAGG - Intergenic
951517911 3:23582057-23582079 ATGGCCTACTTGAGGGTGGAGGG - Intronic
951571673 3:24070499-24070521 AGGGCTTACTTAAGGGTAGAGGG - Intergenic
951732811 3:25829366-25829388 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
951968870 3:28420459-28420481 AGGGCCTACTAGAGGGTGGAAGG - Intronic
952134598 3:30402919-30402941 GGGACCTACTTGAGGTTGGAGGG - Intergenic
952408919 3:33029787-33029809 AGGGCCTACTTGAGGGTGGTAGG + Intronic
952413503 3:33069960-33069982 GGGGCCTACTTGAGGGTGGAGGG - Intronic
952515521 3:34100558-34100580 ATGATCATCTTGATGGTAGAGGG + Intergenic
952535691 3:34306631-34306653 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
952667630 3:35926021-35926043 GGGGACTACTTGAGGGTAGAGGG - Intergenic
952704234 3:36361089-36361111 GGGGCCTACTTTAGGGTAGAGGG + Intergenic
952757023 3:36878599-36878621 AGGGCCTACTTGAGGATGGAGGG + Intronic
953008731 3:39003182-39003204 GGGGTCTACTTGAGGATGGAGGG - Intergenic
953079639 3:39603752-39603774 GGGACCTTCTTGAGGGTGGAGGG - Intergenic
953122743 3:40061236-40061258 GGGGTCTACTGGAGGGTGGAGGG - Intronic
953184154 3:40622464-40622486 GGGACCTACTTGAGAGTGGATGG - Intergenic
954657823 3:52207635-52207657 GGGACCGACTTGAGGGTGGAGGG - Intronic
954960301 3:54558571-54558593 GGGGCCTACTTGAGGGTGGAGGG - Intronic
954998410 3:54903208-54903230 AGGACCTAATGGAGGGTGGAGGG - Intronic
955141215 3:56271762-56271784 GGGACCTACTTGAGGGTGGAAGG - Intronic
955149139 3:56349566-56349588 AGGGCCTACTTGAGGGTTGAGGG + Intronic
955289191 3:57674963-57674985 GGGGTCTACTTGATGGTGGAGGG + Intronic
955442139 3:58967863-58967885 GGGGTCTACTTGAGGGTGGAGGG - Intronic
955538003 3:59944679-59944701 AGGACATATTTGAGTGTAGAAGG - Intronic
955595567 3:60586831-60586853 GGGACCTGCTTGAGGGCAGAGGG + Intronic
955663962 3:61330773-61330795 GGGGTCTATTTGAGGGAAGAAGG + Intergenic
955846079 3:63164317-63164339 GGGGTCTATTTGAGGGTAGAGGG + Intergenic
955886245 3:63601499-63601521 AGGGTCTACTTGAGAGTGGAGGG - Intronic
955937807 3:64119209-64119231 GGGATCTATTGGAGGGTGGAGGG + Intronic
956032274 3:65051413-65051435 GGGGCCAACTTGAGGGTAGAGGG - Intergenic
956053335 3:65272449-65272471 GCGGTCTACTTGAGGGTGGAGGG + Intergenic
956350759 3:68333464-68333486 GGGACCTACTTGAGTGTAGAGGG + Intronic
956354481 3:68376408-68376430 GGGGCCTACTTGAGGGTAGATGG - Intronic
956372386 3:68577421-68577443 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
956377528 3:68631621-68631643 AGGACTTATGTGAGGGTAGATGG - Intergenic
956447361 3:69338671-69338693 GAGGCCTACTTGAGGGTAGAGGG + Intronic
956577456 3:70768969-70768991 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
956942610 3:74181079-74181101 GGAATCTATTTGAGGGTGGAGGG + Intergenic
956943265 3:74189551-74189573 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
957479976 3:80780231-80780253 AGGAGCTACTTGAAGGTGAATGG + Intergenic
957535703 3:81500943-81500965 AGGGCCTACTTGAGGGTAGAAGG + Intronic
957746489 3:84349519-84349541 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
957901356 3:86497569-86497591 GGGGTCTACTTGAGGGTAGAGGG + Intergenic
958009137 3:87853226-87853248 GGGCCCTACTTGAGGGTGGAGGG - Intergenic
958021949 3:88008339-88008361 GGGGCCTACTTGAAGGTAGAGGG - Intergenic
958688347 3:97427906-97427928 GGGGCCTACTTGAGGGTTGAGGG + Intronic
958822626 3:98993052-98993074 AGGTTCTACTTGAGGATGGAGGG - Intergenic
958838050 3:99170436-99170458 AGGACCTACTTGATGGTGGGAGG + Intergenic
958843277 3:99234634-99234656 GAGGTCTACTTGAGGGTAGAGGG - Intergenic
958849935 3:99312457-99312479 GGGGTCTACTTGAGGATATAGGG + Intergenic
958874734 3:99603288-99603310 GGGACCTACTTGAGGGTGGAGGG - Intergenic
958927370 3:100173472-100173494 AGGAGCTCCTTGAGGGGAAAAGG - Intronic
959098334 3:101981837-101981859 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
959098439 3:101983016-101983038 GGGGTTTACTTGAGGGTGGAAGG - Intergenic
959310802 3:104734401-104734423 AGGACCTACTTGAGGGTGGAGGG - Intergenic
959392821 3:105797431-105797453 AGGGGCTACTTGAGGGTGAAGGG + Intronic
959451391 3:106507400-106507422 AGGGCCTACTTGAGGGCAGAGGG - Intergenic
959610593 3:108290494-108290516 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
959881917 3:111453667-111453689 AGGGCCTACTTTAGGGTAGAGGG + Intronic
959960409 3:112292101-112292123 GGGGCCTACTTGAGGGTAGATGG + Intronic
960098162 3:113708195-113708217 AGAGCCTACTTGAGGGTAGAGGG + Intergenic
960145948 3:114202705-114202727 AGGACCTACTTAAGGGTGGAGGG + Intergenic
960342625 3:116493097-116493119 GGGGCCTACTTGAGGGTGGAGGG + Intronic
960347392 3:116550919-116550941 AGGGCATACCTGAGGGTAGAGGG - Intronic
960400199 3:117187985-117188007 GGGGTCTATTTGAGGGAAGAGGG + Intergenic
960400404 3:117190867-117190889 GGGGCCTATTTGAGGGTAGAGGG + Intergenic
960736323 3:120784974-120784996 AGGGCCTTCTTGAGGGTGGAAGG - Intergenic
960782681 3:121337084-121337106 GGGGTCTACTTGAGGGTGGTGGG + Intronic
961002005 3:123380298-123380320 GGAATCCACTTGAGGGCAGAGGG - Intronic
961417191 3:126767749-126767771 GGGGCCTACTTGAGGGTGGAAGG - Intronic
961987230 3:131149146-131149168 GGGGCCTACTTGAGGGTAGAGGG - Intronic
962036215 3:131654400-131654422 GGGGCCTACCTGAGGGTAGAGGG - Intronic
962073904 3:132060213-132060235 GGGGTCTACTTGAGAGTGGAGGG - Intronic
962506657 3:136053118-136053140 GCGGTCTACTTGAGGGTGGAAGG + Intronic
962691676 3:137905407-137905429 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
962881884 3:139586212-139586234 GGGGTCTACTTGAGGGTGGAGGG + Intronic
962954865 3:140255592-140255614 GGGACCTACTTGAGGTTGGAGGG + Intronic
963035037 3:141018813-141018835 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
963075078 3:141338632-141338654 AGGGTCTACTTGACAGTGGAGGG + Intronic
963296438 3:143551525-143551547 GGGGTCTACTAGAGGGTAGAAGG - Intronic
963381992 3:144542111-144542133 AGGGCCTACTTGAGGGTGAAGGG + Intergenic
963411168 3:144930054-144930076 AGGACTTACTTGAGGATGGAGGG + Intergenic
963609323 3:147445141-147445163 GGGCTCCACTTGAGGGTGGAGGG - Intronic
963674401 3:148290946-148290968 GGGGTCTCCTTGAGGGTGGAGGG + Intergenic
963831204 3:150011604-150011626 GGGGCCTACTTGAGGGTGGAGGG + Intronic
963925916 3:150951131-150951153 GGGATCTTCTTGAGGATGGAGGG + Intronic
963982153 3:151550779-151550801 AGGATCAACTCCAGGGTACATGG - Intergenic
963993844 3:151684265-151684287 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
964054341 3:152434205-152434227 AGGGCCTATTTGAGGGTGGATGG - Intronic
964177463 3:153841456-153841478 GGGATCTACTTGAGGGTGGAGGG - Intergenic
964244862 3:154639854-154639876 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
964255363 3:154769064-154769086 GGGGTCTATTTGAGGGTGGAAGG - Intergenic
964256909 3:154785581-154785603 AGGGCCTACTTGTGGGTAGAAGG - Intergenic
964366335 3:155954419-155954441 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
964458663 3:156897036-156897058 GGGGCCTACTTGAGGATAGAGGG + Intronic
964529864 3:157655852-157655874 GGGGTCTACTTGAGGGTGGAGGG - Intronic
964574631 3:158151475-158151497 ATGACCTACTTCAGGGGAGAAGG + Intronic
964687693 3:159415451-159415473 AGGGTGTACTTGAGGGTAGAGGG - Intronic
964868442 3:161287537-161287559 GGGACCTACTTGAGGGTGGAGGG + Intergenic
964968601 3:162530693-162530715 AGGGCCTATTTGAGGGTGGAGGG + Intergenic
964987349 3:162760459-162760481 AGGACCTATTTGAAGGTGGAGGG - Intergenic
965043868 3:163550004-163550026 AGGGTCTCCTGGAGGGTTGAGGG - Intergenic
965065824 3:163847355-163847377 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
965087884 3:164123030-164123052 AGATTCTACTGTAGGGTAGAAGG + Intergenic
965091715 3:164171611-164171633 ATGACCTAGTTGAGGATAGAAGG - Intergenic
965193264 3:165559429-165559451 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
965230471 3:166045035-166045057 GGGGCCTGCTTGAGGGTAGAAGG - Intergenic
965241214 3:166200899-166200921 GGAATCTACTTAAGGGTAGAGGG + Intergenic
965283484 3:166784341-166784363 AGGGACTACTAGAGGGTAGAAGG - Intergenic
965295370 3:166938567-166938589 AGGGTCTATTTGAAGGTGGAGGG - Intergenic
965464585 3:169012118-169012140 AGGACCTACTTGAGGGTGTAGGG - Intergenic
965563231 3:170081727-170081749 GGGGTCTACTTGAGGGAGGAGGG - Intronic
965725924 3:171715922-171715944 AGGGCCTACTTGAGGGTGGGGGG - Intronic
965742239 3:171887670-171887692 GGTGTCTACTTGAGGGTGGAGGG - Intronic
966042024 3:175503084-175503106 AAGGCCTACTTGAGGGTAGATGG - Intronic
966453538 3:180089842-180089864 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
966647780 3:182266090-182266112 GAGACCTACTGGAGGGTAGAGGG + Intergenic
966651845 3:182310222-182310244 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
966671778 3:182535329-182535351 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
966818347 3:183906787-183906809 AGGGTCTACCTGAGGGTAGAGGG + Intergenic
967374314 3:188783543-188783565 GGGATCTACTTGAGGGTGGAGGG + Intronic
967619077 3:191610034-191610056 GGGACCTACTTGAGAGTGGAGGG - Intergenic
967693455 3:192504177-192504199 AGGGCCTACTTGAGAGTGGAGGG + Intronic
967768636 3:193310023-193310045 GGGGTCTACTTGAGAGCAGAGGG - Intronic
967781452 3:193444849-193444871 AGGAGCTACCTGAGGCTGGAAGG + Intronic
967978556 3:195049783-195049805 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
969941506 4:10736633-10736655 AGCTTCTATTTGAGGATAGAAGG + Intergenic
970010430 4:11452910-11452932 GGGTTCTACTTGAGGGTGGAGGG - Intergenic
970012727 4:11477961-11477983 AGGGTCTACTTGAGAGTGGATGG + Intergenic
970170552 4:13284959-13284981 AGGGTTTACTTGAGGGTGAAAGG - Intergenic
970375174 4:15450012-15450034 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
970449585 4:16153861-16153883 GGGACCTACTTAAGGGTGGAGGG - Intergenic
970624707 4:17863985-17864007 AGGGCCTACTTGAGGGCAGAGGG + Intronic
971004091 4:22354743-22354765 GGGGTTTACTTGAGAGTAGAGGG + Intronic
971106487 4:23530356-23530378 AGGGTCTACTTGAAGGTGGAGGG + Intergenic
971390400 4:26180161-26180183 GGGATCTTTTTGAGGGTGGAGGG + Intronic
971434939 4:26610604-26610626 AGGGCCTACTTGATGGTAGAGGG - Intronic
971461728 4:26906263-26906285 TGGGTCAACTTGAGGGTGGAGGG + Intronic
971521151 4:27552069-27552091 GGGATCTACTTGAGGGTGGAGGG - Intergenic
971539502 4:27798082-27798104 GGGATCTATTTGAGGGTGGAAGG + Intergenic
971542695 4:27840865-27840887 GGGGTCTACTTGAGGGGAGAGGG - Intergenic
971668930 4:29530268-29530290 GGGGTCTACTTGAGGGCAGAGGG + Intergenic
971882289 4:32392571-32392593 GGGGCCTACTTGAGGGTAGAGGG + Intergenic
971989665 4:33875908-33875930 GGGACCTGCTTGAGGGTGGAGGG - Intergenic
972010657 4:34176969-34176991 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
972050348 4:34724259-34724281 AGGATTTATTTGTGGGTACAAGG + Intergenic
972125912 4:35765422-35765444 AAGACCTACTTGAGGGTGGAGGG - Intergenic
972143380 4:35989670-35989692 AGGGTCTACTTGAGGGTGAAGGG + Intronic
972147132 4:36042011-36042033 GGGGTCTACTTGAGGGGAGAGGG + Intronic
972175576 4:36401821-36401843 AGGGACTACTTGAGTGTGGAGGG - Intergenic
972724644 4:41736099-41736121 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
973034179 4:45384942-45384964 AAAATTTACTTGAGGGTGGAGGG - Intergenic
973072729 4:45885032-45885054 AGGACCTACTTGACGGTGAAGGG - Intergenic
973528927 4:51814964-51814986 AGGATCTACTTGAGGATATTTGG - Intergenic
973702277 4:53549005-53549027 GGGGTCTACTTGAAGGTGGAGGG + Intronic
973743603 4:53942052-53942074 GGGGTCTACTGGAGGGTGGAGGG + Intronic
973761045 4:54116085-54116107 AGGACCTACCTGAGGGTAGAGGG - Intronic
973977294 4:56275118-56275140 GGAATCTACTTGAGTGTGGAGGG + Intronic
974063876 4:57059583-57059605 TGGGTCTACTTGAGGGTGGAGGG + Intronic
974123055 4:57663161-57663183 GGGGTCCACTTGAGGGTGGAGGG - Intergenic
974159848 4:58124516-58124538 AACGTCTACTTGAGGGTGGAGGG + Intergenic
974461045 4:62188330-62188352 AGGGCCTACTTGAAGGTTGAAGG + Intergenic
974515305 4:62900359-62900381 GGGACCTACTTGAGGGTGGAGGG + Intergenic
974546369 4:63313656-63313678 GGGATCTACTTGATGGTGGAAGG - Intergenic
974598587 4:64045968-64045990 AGGGCCTACTTGAGTGTAGAGGG + Intergenic
974623754 4:64395827-64395849 GGGGCCTACTTGAGGGTGGAGGG - Intronic
974683174 4:65191344-65191366 AGGGCCTACTTGAGGGTGCAGGG - Intergenic
974705034 4:65503102-65503124 AGGCACTACTAGAGGGAAGAAGG + Intronic
974765993 4:66347265-66347287 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
974944193 4:68506184-68506206 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
974954741 4:68623497-68623519 GGGGTCTACTTGAGGGTGGAGGG + Intronic
975031374 4:69621995-69622017 AAGGCCTACTTGAGGGTGGATGG + Intronic
975161513 4:71129970-71129992 AGAGCCTACTTGAGGATAGAGGG + Intergenic
975286187 4:72623773-72623795 GGGACCTACTTGAAGGTGGAGGG - Intergenic
975474091 4:74802517-74802539 AGGGCCTAATTGAGGGTGGAAGG + Intergenic
975494376 4:75021614-75021636 GGGACCTAGTTGAGGGTGGAGGG - Intronic
975598025 4:76068615-76068637 GGGGCCTACTTGAGGGTGGAGGG + Intronic
975904276 4:79190824-79190846 GAGGTCTACTTGAGGGTGGAGGG - Intergenic
976001813 4:80383169-80383191 AGGGCCTACTTGAGGGTGGAGGG + Intronic
976015839 4:80553154-80553176 GGGGTCTACTTGAGGGTGGAGGG - Intronic
976043042 4:80910661-80910683 AGGGGCTACCTGAGGGTAGAGGG + Intronic
976367937 4:84251090-84251112 GGGACCTGCTTGAGGGAAGAGGG + Intergenic
976369603 4:84272154-84272176 GGGGTCTACTTGAGGACAGAGGG + Intergenic
976393915 4:84535320-84535342 GGGATCTACCTGAGAGTGGAAGG + Intergenic
976470728 4:85425595-85425617 GGGGCCCACTTGAGGGTAGAGGG - Intergenic
976481326 4:85549762-85549784 AGGGCCTACTTGAGGGTAGAGGG - Intronic
976503646 4:85820473-85820495 AGGCCCTACTTGAGGCTGGAAGG + Intronic
976640215 4:87329918-87329940 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
976661581 4:87545628-87545650 GGGACCTACTTGAGAGTGGAGGG - Intergenic
976687447 4:87830567-87830589 GGGGTCTACTTGAGGGTGAAGGG + Intronic
976815567 4:89144649-89144671 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
977278669 4:95011241-95011263 GGGGTCTACCTGAGGGTGGAGGG - Intronic
977329468 4:95619335-95619357 AGGGCTTACTTGAGGATAGAGGG + Intergenic
977403485 4:96564648-96564670 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
977412309 4:96683580-96683602 AGGGCCTACTTGAGGGTGGAAGG - Intergenic
977440179 4:97056063-97056085 GAGACCTAATTGAGGGTAGAGGG - Intergenic
977445799 4:97130434-97130456 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
977482845 4:97600076-97600098 AGGACCTACTTGAGGGTGGAAGG + Intronic
977508182 4:97929036-97929058 TGGGTCTACTTGAGGGTGGAGGG - Intronic
977552380 4:98456193-98456215 GGGGTCTACTTGAGAGTAGAGGG + Intergenic
977734743 4:100399916-100399938 TGGGACTTCTTGAGGGTAGAGGG - Intronic
977738475 4:100446743-100446765 GGGGTCTACCTGAGGGTGGAGGG - Intronic
977973249 4:103234571-103234593 AGGTTCTACTTAAGGGTGGAGGG + Intergenic
977987033 4:103395041-103395063 AGGTTCTACTTAAGGGTGGAGGG - Intergenic
978063500 4:104367216-104367238 AGGGCCTACTTAAGGGTGGAGGG + Intergenic
978240917 4:106515296-106515318 AGGATCTACCTGAGGATCAAGGG - Intergenic
978252987 4:106655606-106655628 AGGGCCTACTTGAGAGTAGAGGG + Intergenic
978287051 4:107091827-107091849 GGGGCCTACTTGAGGGTGGAGGG + Intronic
978295122 4:107196062-107196084 AGGATCTGCTTTAGGGTATTAGG - Intronic
978352034 4:107830032-107830054 GGGGCCTACTTGAGGGCAGAGGG - Intronic
978390847 4:108223675-108223697 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
978391503 4:108230960-108230982 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
978593259 4:110349708-110349730 GGTGTCTACTTGAGGGTGGAGGG - Intergenic
978596611 4:110384268-110384290 GGGTCCTACTTGAGGGGAGAGGG + Intronic
978674815 4:111299939-111299961 GGGGTCTACTTGAGGGTAGGAGG - Intergenic
978771721 4:112463857-112463879 GGGACCTACTTGAGGGTGGAAGG + Intergenic
978952416 4:114576762-114576784 AGGGTCAACTTGAGGATGGAAGG - Intergenic
979208481 4:118071414-118071436 AGCACCTACTTGAGGGTGGAGGG - Intronic
979262009 4:118659028-118659050 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
979281908 4:118878194-118878216 AGGGCCTACTTGAGGGTGGAGGG + Intronic
979367044 4:119837751-119837773 TGGGTCTACTTGAGGGTGCAAGG - Intergenic
979590600 4:122475262-122475284 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
979709944 4:123767671-123767693 TGGGCCTACTTGAGGGTAGAGGG + Intergenic
979741930 4:124161794-124161816 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
979780324 4:124643924-124643946 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
979842432 4:125460437-125460459 GGGGTCTACTGGAGGGTGGAGGG - Intronic
980005118 4:127532809-127532831 GGAGTCTACTTGAGGGTGGAAGG - Intergenic
980024222 4:127745959-127745981 GGGATCTACTTGAGGGTGGGTGG - Intronic
980089596 4:128428582-128428604 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
980147953 4:129013143-129013165 GGGATCTACTTGAAAGGAGAGGG - Intronic
980398205 4:132243664-132243686 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
980447782 4:132933429-132933451 AGGGCCTACTTGAGGGTGGATGG + Intergenic
980555427 4:134397265-134397287 AGGGCTTACTTGAGGGTGGAGGG - Intergenic
980670411 4:135997205-135997227 AGGGACTACTGGAGGGGAGAGGG + Intergenic
980824682 4:138059326-138059348 GGGGCCTACTTGAGGGTTGAGGG - Intergenic
981217847 4:142192151-142192173 AGGACCTACTTAAGGGTGGAGGG + Intronic
981253720 4:142635695-142635717 TGGGTCTACTTGAGGGTGGAGGG + Intronic
981275196 4:142891356-142891378 AGGGCCTACTTGAGAGTGGAGGG - Intergenic
981495865 4:145391555-145391577 GGGTTCTACTTGAGGGTGGAGGG + Intergenic
981721301 4:147804156-147804178 GGGGGCTACTTGAGGGTGGAGGG - Intronic
982024164 4:151235191-151235213 AGGTCCTACTGGAGGGTGGAGGG - Intronic
982162324 4:152582813-152582835 GGAATCTACTTGAGGATGGAGGG + Intergenic
982219111 4:153110022-153110044 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
982385344 4:154795181-154795203 AGTTTCTACCTCAGGGTAGAAGG - Intronic
982690517 4:158542946-158542968 GGGGCCTACTTGAGGGTGGAGGG + Intronic
982928462 4:161370304-161370326 GGGTCCTACTTGAGGGTGGAAGG - Intergenic
983155638 4:164344212-164344234 AGGACCTACTTGAGGGTGGAGGG + Intronic
983447286 4:167869496-167869518 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
983486712 4:168340800-168340822 AGGGCCTACTTGAGTGTAGAGGG - Intergenic
984027897 4:174567083-174567105 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
984057229 4:174944683-174944705 AGGGCTTACTTGAGGGTGGAAGG - Intronic
984071410 4:175117979-175118001 GGGGCATACTTGAGGGTAGAGGG + Intergenic
984278266 4:177636403-177636425 GCGATCTACCTGAGGGTGGAGGG - Intergenic
984516633 4:180749494-180749516 AGGGCCTACTTGAGGGTAGAGGG - Intergenic
984861962 4:184248710-184248732 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
985100994 4:186458497-186458519 AGGATCTACTTGTGGGGGGAGGG - Intronic
985229109 4:187796052-187796074 AGGAACTATTTGAAGGGAGAGGG - Intergenic
985324150 4:188748715-188748737 CGGGTCTACTTGAGGGGGGAAGG - Intergenic
985469122 5:26891-26913 GGGGTCTACTTGAGGGGGGAGGG - Intergenic
986353146 5:6898917-6898939 GGGGTCTAGTTGAGGGTGGAGGG + Intergenic
986381020 5:7185827-7185849 AACGCCTACTTGAGGGTAGAGGG + Intergenic
986467379 5:8039241-8039263 AGGGGCCACTTGAGGGTATAGGG - Intergenic
986896658 5:12379168-12379190 AGGGCCTACTTGAGGGTGAAGGG - Intergenic
987013336 5:13790907-13790929 GGGGTCTACCTGAGGGTGGAAGG + Intronic
987388966 5:17357506-17357528 AGAGTCTACTTGATGGTGGAGGG - Intergenic
987394524 5:17409698-17409720 AGGGCCTGCTTGAGGGTGGAGGG - Intergenic
987520841 5:18981407-18981429 GGGCTCTACTTGAGGATGGAGGG - Intergenic
987747970 5:22001642-22001664 AGGGCCTACTCGAGGGCAGAGGG - Intronic
987756722 5:22106117-22106139 GGGTTCTACTTGAGGGTGGAGGG + Intronic
987850340 5:23344540-23344562 GGGACCTACTTGAGGGTGAAGGG + Intergenic
988004068 5:25385077-25385099 GGGATCTACTTGAGGGTAGAGGG - Intergenic
988043789 5:25921506-25921528 AGGGTCTCCTTGAGGGTGGAGGG + Intergenic
988097993 5:26642464-26642486 GGGACCTACTTGAGGGTGGATGG + Intergenic
988163267 5:27548958-27548980 AGGATCTACTTGAGTGTGAAGGG + Intergenic
988321371 5:29701477-29701499 AGGTCCTACTTGAGGGTGGAGGG - Intergenic
988329659 5:29818899-29818921 AGGACCTACTTGAAGGTGGAGGG - Intergenic
988675103 5:33425057-33425079 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
988974489 5:36501513-36501535 GAGGTCTACTTGAGGGTGGAGGG + Intergenic
988979752 5:36555053-36555075 GGGATCTACTTGAGGGTGTTGGG - Intergenic
989097301 5:37793189-37793211 AGGTTAGACTTGAGGGCAGAAGG - Intergenic
989126945 5:38063908-38063930 GGGCCCTACTTGAGGGTGGAGGG - Intergenic
989312303 5:40034280-40034302 TGGGCCTACTTGAGGGTGGAAGG + Intergenic
989339933 5:40362797-40362819 AGGGCCTACTGGAGGGTGGAGGG - Intergenic
989491541 5:42060922-42060944 GGGATCTACTTGAGCGTAGAGGG + Intergenic
989526489 5:42459501-42459523 GGGGCCTACTTGTGGGTAGAGGG + Intronic
989980661 5:50640479-50640501 GGGGACTACTCGAGGGTAGAAGG - Intergenic
990024502 5:51168907-51168929 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
990134098 5:52624298-52624320 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
990354078 5:54948498-54948520 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
990687059 5:58316398-58316420 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
990782247 5:59378269-59378291 AGGGCCTACCAGAGGGTAGAAGG + Intronic
990831891 5:59968416-59968438 ATGGACTACTAGAGGGTAGAGGG + Intronic
990898211 5:60722660-60722682 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
990915643 5:60901681-60901703 AGGATCCAGATGAGGGTGGAGGG - Intronic
990998777 5:61761082-61761104 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
991027519 5:62046214-62046236 GGGTCCTACTTGAGGGTGGAGGG - Intergenic
991390911 5:66142666-66142688 GTGGTCTACTTGAGGGTGGAGGG - Intronic
991768148 5:70011446-70011468 AGGGCCTACTCGAGGGCAGAGGG - Intergenic
991847386 5:70886528-70886550 AGGGCCTACTCGAGGGCAGAGGG - Intergenic
992249003 5:74858571-74858593 AGGGCTTACTTGAAGGTAGAGGG + Intronic
992309348 5:75479450-75479472 GGGGTCTACTTGAGGGTAGAGGG - Intronic
992919899 5:81503972-81503994 GGGGCCTACTTGAGGGTGGAAGG + Intronic
992976209 5:82123354-82123376 GGGTTCTACTTGAGGGTGGAGGG + Intronic
993062409 5:83054672-83054694 GGGGCCTACTTGAGGGTGGAGGG + Exonic
993139690 5:84016045-84016067 TGGGTCTACTTGAGGGTGGGTGG - Intronic
993275895 5:85858212-85858234 GGGGTCTACCTGAGGGTAGAGGG + Intergenic
993413386 5:87598109-87598131 GGGACCTACTTGAGGGTGGAGGG - Intergenic
993451686 5:88078864-88078886 AGGGTCTAGTTGAGGGTAGATGG + Intergenic
993465652 5:88243242-88243264 AGGGCCTACTTGAGGATGGAAGG - Intronic
993568704 5:89508710-89508732 AGGGTCTACTTGAGGTGGGAGGG + Intergenic
993697092 5:91074329-91074351 GGGGCCTACTTGAGGGTAGAGGG - Intronic
993747868 5:91624107-91624129 AGGGACTACTTGAGGGAAGAAGG + Intergenic
993801423 5:92347626-92347648 GGGATCTACTTGAGGGTGGAGGG - Intergenic
993894852 5:93522193-93522215 GGGGTCTACCTGAGGGTGGAGGG + Intergenic
994228412 5:97282773-97282795 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
994242990 5:97446104-97446126 AGGTTCTACTTGAGGGTGGAGGG + Intergenic
994412845 5:99431269-99431291 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
994467417 5:100155618-100155640 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
994480996 5:100334451-100334473 GGGGTCTATTTGAGGGTGGAGGG + Intergenic
994590498 5:101766553-101766575 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
994638242 5:102370040-102370062 AGGGCCTACTTGAAGGTGGAGGG + Intergenic
994679845 5:102872906-102872928 GGGGCCTACTTGAGGGTGGAGGG + Intronic
994765100 5:103905506-103905528 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
995013018 5:107278750-107278772 GGGGACTACTTGAGGGTGGAGGG - Intergenic
995099948 5:108288099-108288121 AGGGCCTACTTGAGGGTGGAAGG + Intronic
995170625 5:109107485-109107507 GGGGTCTACTTGAGGGTAGAGGG - Intronic
995429450 5:112058052-112058074 GGGATCTACTTGACGGTGGAGGG + Intergenic
995622675 5:114043919-114043941 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
995653373 5:114396877-114396899 AGGGCCTACCTGAGGGTAGAGGG - Intronic
995717978 5:115099175-115099197 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
995943248 5:117610594-117610616 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
995992897 5:118264117-118264139 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
996081117 5:119259282-119259304 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
996180580 5:120414355-120414377 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
996469404 5:123842728-123842750 AGGGCCTACTTGAGGATGGAGGG + Intergenic
996599157 5:125241531-125241553 AGGGCCTACTTGAGGGTGGGTGG - Intergenic
996698926 5:126429372-126429394 GGGATCTATTGGAGGGTGGAGGG + Intronic
996768311 5:127058193-127058215 AGGGCCTAATTGAGGGTGGAGGG - Intronic
996888247 5:128385213-128385235 AGGGCCTACTTGAGAGTGGAAGG - Intronic
997066195 5:130562335-130562357 TGGGTCTACTTGAGGATGGAGGG + Intergenic
997099733 5:130955921-130955943 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
997518733 5:134508600-134508622 AGGATCAACTTGAGCCCAGAAGG + Intergenic
997541141 5:134663592-134663614 AGGATCCACTTGAGGCCAGGAGG + Intronic
997609465 5:135204811-135204833 GGGGTCTACTTGAGGGTGGAGGG - Intronic
997641858 5:135454509-135454531 GGGGTCTACTTGAGGGTGGGGGG - Intergenic
997760439 5:136443532-136443554 AGGATGTTCTTCAGGGTAAATGG - Intergenic
997897105 5:137728816-137728838 AGGGCCTACTTGAGGATGGAGGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998303048 5:141044639-141044661 GGAGCCTACTTGAGGGTAGAGGG + Intergenic
998417029 5:141953564-141953586 GGGATCAACTTGAGGGTAACAGG - Intronic
998594837 5:143517839-143517861 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
998595663 5:143527317-143527339 GGGGCCTACTGGAGGGTAGAAGG + Intergenic
998776064 5:145604247-145604269 AGGGCCTACTTGAGGGTGGAGGG - Intronic
999054066 5:148554801-148554823 GGGACCTACGTGAGGGTGGAAGG - Intronic
999056040 5:148577806-148577828 GGGGTCTACTTGAGGGTGGAGGG + Intronic
999057299 5:148592221-148592243 GGAATCTACTTGAGGGTGGAGGG + Intronic
999071056 5:148744587-148744609 GGGACCTACTTGAGGGTAGAGGG + Intergenic
999429480 5:151513582-151513604 AGGGCCTACTTGAGGGCAGAGGG + Intronic
999478331 5:151922249-151922271 AGAATGTATTTGGGGGTAGATGG - Intronic
999598245 5:153229891-153229913 AGGATCTACTTGAGGATGAAGGG - Intergenic
999761718 5:154706546-154706568 AGGATTTACTTGAGAGTGGAGGG + Intergenic
999916459 5:156267989-156268011 GGGGTCTACGTGAGGGTGGAGGG - Intronic
1000162717 5:158615499-158615521 AGGGTCTACTTGTGGGTGGAGGG - Intergenic
1000276493 5:159740816-159740838 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1000435921 5:161208719-161208741 GGGTCCTACTTGAGGGTGGAGGG + Intergenic
1000629829 5:163579720-163579742 AGGGCCTACTTGAGGGTGGATGG - Intergenic
1000678441 5:164152919-164152941 AGGATCTACTTGAGGGTGGAGGG + Intergenic
1000731901 5:164845190-164845212 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1000734252 5:164879390-164879412 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
1000759014 5:165197916-165197938 GGGAACTGCTTGAGGGTGGAGGG + Intergenic
1000997881 5:167977159-167977181 GGGTCCTACTTGAGGGTGGAGGG + Intronic
1001012634 5:168112377-168112399 GGGACCTTCTGGAGGGTAGAGGG - Intronic
1001178874 5:169499632-169499654 GGAATCTACTTGAGGGTGGAGGG - Intergenic
1001206280 5:169766224-169766246 GGGGCCTGCTTGAGGGTAGAGGG - Intronic
1001264457 5:170262809-170262831 TGCATCTACATGAGGGTACATGG - Intronic
1001569382 5:172720093-172720115 AGGAACTACTGGAGTGAAGAAGG - Intergenic
1001657888 5:173367063-173367085 GGGACCTATTTGAGGGTAAAGGG - Intergenic
1001754516 5:174158264-174158286 GGAGTCTACTTGAGGGTTGAGGG + Intronic
1001767975 5:174269410-174269432 AGGACCTACTTGAGGGTAGAAGG + Intergenic
1001850971 5:174964832-174964854 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1002096322 5:176833306-176833328 AGGGCTTACTTGAGGGTGGAGGG - Intronic
1002629596 5:180562297-180562319 AGAAGTTACTTTAGGGTAGATGG - Intronic
1002732576 5:181352146-181352168 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1002751961 6:121961-121983 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1002821205 6:726662-726684 GGGGCCTACTTGAGGGTAGAGGG + Intergenic
1002822957 6:745425-745447 AGGGCCTACTTGAGGGTAAAGGG + Intergenic
1002880655 6:1248979-1249001 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
1002907283 6:1459886-1459908 AGGGCCTGCTTGAGGGTGGAGGG - Intergenic
1003436819 6:6097834-6097856 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1003709103 6:8569077-8569099 TGGGCCTACTTGAGGGTAGAGGG - Intergenic
1004034079 6:11904933-11904955 GGGATCTACTTGAGGGTGGAGGG - Intergenic
1004059368 6:12177152-12177174 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1004083128 6:12415882-12415904 AGCATCCACGTGAGGGGAGAAGG + Intergenic
1004332812 6:14737103-14737125 GGGATCTCCCTGAGGGTAGGAGG - Intergenic
1004348789 6:14872691-14872713 AGGACCTGCTTCAGGGGAGAAGG + Intergenic
1004442747 6:15669623-15669645 AGGACCTGCTTCAGGGGAGAAGG - Intergenic
1004470611 6:15925738-15925760 AGGGCTTACTTGAGGGTGGAAGG + Intergenic
1004549033 6:16628618-16628640 GGGTCCTACTTGAGGGTAGAGGG - Intronic
1004564701 6:16785345-16785367 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1004793701 6:19057564-19057586 AGGGCCTACTCGGGGGTAGAGGG + Intergenic
1004818062 6:19333854-19333876 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1005102075 6:22182101-22182123 GGGGTCTACTTGAGGGTAGAGGG - Intergenic
1005244909 6:23872637-23872659 GGGGCCTACTTGAGGGTAGAGGG + Intergenic
1005283237 6:24297298-24297320 GGGGCCTACTTGAGGGTAGAGGG + Intronic
1005775167 6:29123460-29123482 GGGGTCTACTTGACGGTGGAGGG + Intergenic
1005781229 6:29194696-29194718 GGGGTCTACTTGACGGTGGAGGG + Intergenic
1005909681 6:30297542-30297564 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1006044367 6:31281799-31281821 GGGGTCCACTTGAGGGTGGAGGG + Intronic
1006053422 6:31361621-31361643 GGGGTCCACTTGAGGGTGGAGGG + Intergenic
1006863374 6:37188552-37188574 GGGATCTACTTGAGAGGGGAGGG + Intergenic
1007179825 6:39921933-39921955 GGGACCTACTTGAGGGTGGAGGG - Intronic
1007216245 6:40241519-40241541 TGGATCTACTTGAGGGTGGAGGG + Intergenic
1008191123 6:48459404-48459426 GGGGTCTACTGGAGGGTGGAGGG - Intergenic
1008265003 6:49414268-49414290 GGCACCTACTTGAGGGTGGAGGG + Intergenic
1008285456 6:49643865-49643887 AAGATCTGTTTGAGGGTGGAGGG - Intergenic
1008357988 6:50578044-50578066 AGGGCCTACCAGAGGGTAGAAGG + Intergenic
1008449065 6:51628230-51628252 AGGGTCTACTTGAGTGGGGAAGG - Intronic
1008550612 6:52626093-52626115 GGGGTCTACTTGAGAGCAGAAGG + Intergenic
1008611675 6:53190116-53190138 GGGGTGTACTTGAGGGTGGAAGG - Intergenic
1008611787 6:53191093-53191115 AGGGCATACTTGAGGGTGGAAGG + Intergenic
1008642472 6:53478675-53478697 AGCACCTACTTGAGGGTGAAGGG - Intergenic
1008736666 6:54552945-54552967 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1008779528 6:55086211-55086233 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1008954614 6:57201036-57201058 AGGATCTGCTTCAGAGGAGAAGG - Intronic
1009302056 6:62036379-62036401 AGGGCCTATTTGAGGGTGGAGGG + Intronic
1009467238 6:63986766-63986788 GGGGTCTACTTGAGGGTAAAGGG + Intronic
1009497387 6:64368097-64368119 AGGACCTACTTGAAGGCGGAGGG - Intronic
1009505168 6:64468657-64468679 AGGACCTACTTGAAGGTGGAGGG - Intronic
1009509105 6:64525510-64525532 GGGGACTACTTGAGGGTGGAGGG + Intronic
1009547388 6:65037297-65037319 AGGACCTACTTGAAGGTCAAGGG + Intronic
1009753626 6:67905118-67905140 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1009764157 6:68047737-68047759 GTGGTCTACTTGAGGGTGGAAGG + Intergenic
1009997312 6:70910327-70910349 TGGACCTACTTGAGGGTGGAGGG - Intronic
1010096810 6:72056250-72056272 AGGGCCTACTTGAGGATGGAGGG + Intronic
1010193503 6:73217189-73217211 AAGTTCTACTTGAGGGTGGAGGG + Intronic
1010195198 6:73232640-73232662 GCGGTCTACTTGAGGGTGGAGGG + Intronic
1010252606 6:73723730-73723752 GGGGCCTACTGGAGGGTAGAGGG + Intronic
1010466408 6:76171767-76171789 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1010507225 6:76675412-76675434 GGGGCCTATTTGAGGGTAGAGGG - Intergenic
1010523518 6:76872232-76872254 GGGTTCTACTTGAGGGTGGAGGG - Intergenic
1010802102 6:80188343-80188365 GGGATCTACCTGAGGGTGGAGGG + Intronic
1010899419 6:81407877-81407899 GGGATCTACTTGAGGGTGGAAGG - Intergenic
1010914665 6:81601124-81601146 GGGGTATACTTGAGGGTGGAAGG + Intronic
1011257031 6:85433002-85433024 AGGGTCTACTTGAGGGTGGAAGG - Intergenic
1011281458 6:85681928-85681950 AGGGCCTCCTTGAGGGTGGAGGG - Intergenic
1011294782 6:85814891-85814913 GTGGTTTACTTGAGGGTAGAGGG + Intergenic
1011405619 6:87012385-87012407 AGAGCCTACATGAGGGTAGAGGG + Intronic
1011765400 6:90614343-90614365 ATGATCTGCTTCAGGGGAGAAGG + Intergenic
1012337472 6:98078971-98078993 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1012345590 6:98181397-98181419 GGGGTCTACTTGAGGGGCGAGGG + Intergenic
1012485656 6:99719885-99719907 AGGGCCTACTTGTGGGTGGAGGG - Intergenic
1012577146 6:100816741-100816763 GGGGCCTACCTGAGGGTAGAGGG + Intronic
1012586520 6:100929882-100929904 AGGACCTACTTGAGGGTACGGGG - Intergenic
1012591449 6:100985993-100986015 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
1012722753 6:102767675-102767697 GGGATCTAGTTGAGGGTAGGGGG - Intergenic
1012834554 6:104248828-104248850 AGAGTCTACTTGAGTGTGGAGGG + Intergenic
1012991809 6:105933829-105933851 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1013314793 6:108931076-108931098 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1013316751 6:108950612-108950634 GGGACCTACTTGAGGGTGGAGGG + Intronic
1013376894 6:109526121-109526143 GGGGCCTACTTGAGGGTAGAGGG + Intronic
1013390045 6:109677078-109677100 AAGGCCTACTTGAGGGTAGAGGG + Intronic
1013456839 6:110337260-110337282 GGGTTCTACTTGAGGGTCGAGGG + Intronic
1013766433 6:113579350-113579372 GGGGTCTACTTGAGGGTTGAGGG + Intergenic
1013766578 6:113581009-113581031 GGGGTCTCCTTGAGGGTTGAGGG + Intergenic
1014075450 6:117229868-117229890 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1014124891 6:117765532-117765554 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1014207345 6:118670383-118670405 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1014317282 6:119883785-119883807 AGGATATTCTTGGGGGAAGAGGG - Intergenic
1014339242 6:120182053-120182075 GGGGACTAGTTGAGGGTAGAGGG + Intergenic
1014356102 6:120411996-120412018 AGGGCCTGCTTGAGGGTGGAGGG - Intergenic
1014402390 6:121006645-121006667 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1014613767 6:123577300-123577322 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1014901855 6:126975516-126975538 GGAATCTAATTGAGTGTAGAAGG - Intergenic
1014961207 6:127687478-127687500 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1015170641 6:130248734-130248756 AGGCTCTCCTTGAGGGTAGAAGG + Intronic
1015395159 6:132725614-132725636 AGGGTTTACTTGAGGGGGGATGG - Intronic
1015470893 6:133604958-133604980 AGGGCCGACTTGAGGGTTGAGGG - Intergenic
1015474027 6:133638830-133638852 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1015477310 6:133668264-133668286 AGGCTTTACTTGAGGGGTGAGGG + Intergenic
1015488032 6:133793948-133793970 GGGACCAACTTGAGGGTGGAGGG - Intergenic
1015493835 6:133859218-133859240 GGGGTCTACTTGGGGGTAGAGGG - Intergenic
1015567678 6:134590435-134590457 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1015697637 6:135999419-135999441 GGGGCCTACTTGAGGGTGGAAGG - Intronic
1015769435 6:136753803-136753825 AGGATGCACTTGAGGGTAGATGG + Intronic
1015931102 6:138360535-138360557 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
1016084693 6:139898727-139898749 GGCACCTACTTGAGGGTGGAGGG - Intergenic
1016238086 6:141892172-141892194 AGAGCCTACTTGAGGGTGGAGGG + Intergenic
1016298573 6:142602978-142603000 GGGGTCTACTTAAGGGTGGAGGG - Intergenic
1016546739 6:145232493-145232515 GAGAACTACTTGAGGGCAGAGGG - Intergenic
1016777937 6:147925836-147925858 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1016935270 6:149445189-149445211 AGGAGCTTCTTGAGCTTAGAGGG + Intergenic
1017305088 6:152908841-152908863 AGGTCCTACTTGACGGTAGAGGG - Intergenic
1017593203 6:155999241-155999263 AGGATCTGCTTGAGCCTAGGAGG - Intergenic
1017762066 6:157577016-157577038 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1017803367 6:157920413-157920435 AGCTTCTCCGTGAGGGTAGAAGG - Intronic
1017929860 6:158942367-158942389 AGGGCCTACTTGAGGGTAGAAGG - Intergenic
1018001445 6:159582007-159582029 GGGGTCTACCTGAGGGTAGAGGG + Intergenic
1018671629 6:166182546-166182568 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1019099325 6:169615379-169615401 GGGGTCTGCTTGAGGGTGGAGGG - Intronic
1019183057 6:170204371-170204393 GGGACCTACTTGAGGGTGGAGGG - Intergenic
1019236831 6:170624464-170624486 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1020485970 7:8721166-8721188 AGGACCTGCTTAAGGGTAAATGG + Intronic
1020651004 7:10876126-10876148 AGGGACTACTTGAGGGTAGAGGG - Intergenic
1020799268 7:12713885-12713907 ATGATCTGCTTCAGGGGAGAAGG + Intergenic
1020861368 7:13495991-13496013 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1020862405 7:13511269-13511291 GGGATCTACTTGAGGGAGGAGGG - Intergenic
1020985943 7:15134455-15134477 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1021366149 7:19781304-19781326 AGCACCTACTTGAGGGTGAATGG - Intergenic
1021419439 7:20428893-20428915 AGGGCCTACTTGAGAGTGGAGGG + Intergenic
1021426188 7:20502313-20502335 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1021500261 7:21324830-21324852 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1021572490 7:22080606-22080628 GGGGTCTACTTGAGGGAAGAGGG + Intergenic
1021618481 7:22527092-22527114 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1021787780 7:24169628-24169650 TTGGTCTACTTGAGGGCAGAGGG + Intergenic
1021824375 7:24533416-24533438 AGGGCCTACTTGAGGGTGAAGGG - Intergenic
1022694896 7:32695027-32695049 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1022928076 7:35076545-35076567 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1023406364 7:39837334-39837356 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1023457147 7:40352464-40352486 AGGGCCTACTTGAGAGTAGAGGG - Intronic
1023505444 7:40895299-40895321 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1023567517 7:41538352-41538374 AGGACCAACATGAGGCTAGAGGG + Intergenic
1023571333 7:41575601-41575623 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1023657677 7:42441450-42441472 AGGACCTACTTGAGGGAGGAGGG - Intergenic
1023782865 7:43673982-43674004 AGGACCTACTTAAAGGTGGAGGG + Intronic
1024040998 7:45554164-45554186 GTGGCCTACTTGAGGGTAGAAGG + Intergenic
1024254591 7:47531094-47531116 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1024313376 7:47990937-47990959 GAGATCTACTTGAGGGTGGGGGG + Intronic
1024627539 7:51220792-51220814 AGGGCCTACTTGAGGGCGGAAGG - Intronic
1024726282 7:52200026-52200048 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1024848320 7:53677612-53677634 GGGACCTTCTTGAGGGTGGAGGG - Intergenic
1024969839 7:55058675-55058697 GGGGCCTACTTGAGGGTAGAGGG + Intronic
1026046800 7:66911349-66911371 AGGATCTACTTGAATTTGGAAGG + Intergenic
1026099569 7:67373299-67373321 GGGATCTATGTGAGGGTGGAGGG - Intergenic
1026116532 7:67500445-67500467 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1026143505 7:67725971-67725993 AGGGCGTACTTGAGGGTGGAAGG - Intergenic
1026209585 7:68292084-68292106 GGGGTCTCCTTGAGGGTAGCAGG + Intergenic
1026295165 7:69045207-69045229 AGGGCCTATTTGAGGGTGGATGG - Intergenic
1026411073 7:70123502-70123524 AGGGTCTGCTTGAGGGTGAAAGG - Intronic
1026422160 7:70250852-70250874 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1026576232 7:71573830-71573852 GGGGCCTACTTGAGGGCAGAGGG - Intronic
1027429678 7:78097651-78097673 GGTGTCTACTTGAGGGTGGAGGG + Intronic
1027476092 7:78633230-78633252 GGGGTCTACTTGAGGGCGGAAGG + Intronic
1027481608 7:78704991-78705013 GGGGCCTACTTGAGGGTAGAGGG + Intronic
1027678153 7:81184814-81184836 GGGTACTACTTGAGGGTGGAAGG + Intronic
1027736830 7:81942960-81942982 GGGCTCTACTTGATGCTAGAGGG + Intergenic
1027754133 7:82189006-82189028 GGGACCTACTTGAGTGTAGAGGG + Intronic
1027875361 7:83761626-83761648 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1027894802 7:84026833-84026855 GGACTCTACTTGAGGGTGGAGGG + Intronic
1027957143 7:84895122-84895144 GGGGTCTACATGAGGGTGGAGGG - Intergenic
1028143967 7:87301118-87301140 GGGGCCTACTTGAGTGTAGAGGG + Intergenic
1028215576 7:88128122-88128144 AGGATCTCCGAGAGGGTACAGGG - Intronic
1028233048 7:88328731-88328753 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1028374201 7:90129043-90129065 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1028615130 7:92757306-92757328 GGAGTCTACTTGAGGGTGGAAGG - Intronic
1028640372 7:93035733-93035755 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1028757972 7:94459795-94459817 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1028839396 7:95411348-95411370 AGGCCCATCTTGAGGGTAGAAGG - Intronic
1028865686 7:95708779-95708801 AAGACCTACTTGAGGGAGGAGGG + Intergenic
1028908240 7:96178419-96178441 AGCATCTAATAGAGGGCAGAAGG + Intronic
1029064983 7:97840439-97840461 ATGATCTACTCCAGGGAAGAAGG - Intergenic
1029195151 7:98800285-98800307 GGAGTCTACTTGAGGGTGGAGGG - Intergenic
1029334950 7:99890708-99890730 AGGGACTACTTGAGGGTAGAGGG + Exonic
1029932549 7:104387944-104387966 GGGGCCTACTTGAGGGTGGAAGG - Intronic
1029939023 7:104460011-104460033 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1030454410 7:109754967-109754989 AGGCTTTACTTGAGGTTGGAGGG - Intergenic
1030699979 7:112627430-112627452 GGGACCTACTTGAGAGTGGAGGG - Intergenic
1030711151 7:112750931-112750953 GGGACCTACTTGAGGGTAGAGGG + Intergenic
1030732437 7:113006011-113006033 AGGGCCTACTTGAGGGTGAAGGG + Intergenic
1030982766 7:116206262-116206284 GGTACCTACTTGAGGGTAGAGGG + Intergenic
1030989074 7:116278468-116278490 AGGGCTTATTTGAGGGTAGAGGG + Intergenic
1031023880 7:116659273-116659295 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1031181959 7:118430731-118430753 ACAGCCTACTTGAGGGTAGAAGG - Intergenic
1031258220 7:119483390-119483412 AGGGCCTACTTGAGGGTGCAGGG - Intergenic
1031294888 7:119989119-119989141 CGGGTCTACTTGAGGTTGGAGGG + Intergenic
1031405468 7:121380537-121380559 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1031550662 7:123108131-123108153 GGGGCCTACTTGAGGGGAGAGGG - Intergenic
1031647745 7:124247471-124247493 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
1031858418 7:126949444-126949466 AGGGTCTTCTTGGAGGTAGAAGG - Intronic
1031911641 7:127523048-127523070 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1032361667 7:131261977-131261999 AGGACCTACTGGAGTGTGGAGGG + Intronic
1032371938 7:131364631-131364653 TGGGACTACTTGAGGGTGGAGGG - Intronic
1032586984 7:133156011-133156033 GGGACCTACTTGAAGGTGGAGGG + Intergenic
1032593830 7:133218915-133218937 AGGAACTACTAGAGGGAGGAGGG - Intergenic
1032625008 7:133582129-133582151 GGGGCCTACTTGAGGGTAGAGGG - Intronic
1032647543 7:133841816-133841838 GGGACCTACTTGAGGGTGGTGGG - Intronic
1032778285 7:135138746-135138768 AGGGCCTACTTGAGGGTGAAGGG - Intronic
1032960937 7:137033332-137033354 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1033143492 7:138849718-138849740 GGGGCCCACTTGAGGGTAGAGGG - Intronic
1033709142 7:143921122-143921144 GGGGTCTACTTGAGGGTAGGAGG - Intergenic
1033769041 7:144527924-144527946 CGGGCCTACTTGAGGGCAGAGGG + Intronic
1033782667 7:144691454-144691476 AGAACCTACTTGAGGGCAGAAGG + Intronic
1033877336 7:145838575-145838597 AGGGCCTACTTGAGGGTGTAAGG + Intergenic
1034156181 7:148957925-148957947 GGGATCTGCTTGAGGGTGGAGGG - Intergenic
1034204944 7:149307244-149307266 AGGTTCTACTGGAGGGTGGAGGG + Intergenic
1034237502 7:149584042-149584064 GGCACCTACTTGAGGGTGGATGG - Intergenic
1034359193 7:150479151-150479173 AGGGTATACTTGAGGGTGGAGGG + Exonic
1035148850 7:156849346-156849368 AGGGTCTACTTGAGGATGGGAGG + Intronic
1035195475 7:157216508-157216530 GGGATCTACTTGAAGGGGGAGGG - Intronic
1035510941 8:182146-182168 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1035911104 8:3567257-3567279 AGGAACTACTGGAGGGTGCAGGG + Intronic
1036055050 8:5242631-5242653 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1036490061 8:9216684-9216706 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1036634104 8:10536853-10536875 AGGACCTACTTAAAGGTAGAGGG + Intronic
1036786526 8:11691709-11691731 TGGATCTAGTTGAGGCTGGAGGG - Intronic
1036920414 8:12848300-12848322 GGGGTCTACTTGAGGATGGAGGG + Intergenic
1037061503 8:14516301-14516323 AGGTCCTCCTTGAGGGTGGAGGG - Intronic
1037114363 8:15206015-15206037 GGGGTCTACTTGAGGATGGAGGG + Intronic
1037177078 8:15960543-15960565 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1037191430 8:16130635-16130657 GGGGTCTACTTGAGGGTGGAAGG - Intronic
1037253826 8:16928826-16928848 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1037371791 8:18187691-18187713 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1037373024 8:18200523-18200545 GGGATCTACTTAAGGGTAAAGGG + Intronic
1037397422 8:18457872-18457894 AGGACCTACTTGAGGATGGAAGG + Intergenic
1037617745 8:20534677-20534699 GGGGTCTACTTGAGGGTGAAAGG - Intergenic
1038116772 8:24564753-24564775 AGGGCATACTTGAGGGTAGAGGG + Intergenic
1038261059 8:25994775-25994797 TGGGACTACTTGAGGGTGGAGGG + Intronic
1038270658 8:26072628-26072650 GGGTTCTACTTGAGGGTGGAGGG - Intergenic
1038750427 8:30290010-30290032 AGGGCCTAGTTGAGGGTGGAGGG - Intergenic
1038817562 8:30920792-30920814 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1038854335 8:31314688-31314710 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1038904193 8:31879711-31879733 CAGGTCTACTTGAGGGTGGAGGG - Intronic
1038920861 8:32082370-32082392 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1038949708 8:32401130-32401152 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1038990821 8:32865841-32865863 AGTGCCTACTTGAGGGTGGAGGG + Intergenic
1039028223 8:33281420-33281442 GGGATCTACCTGAGGATGGAGGG + Intergenic
1039245750 8:35606578-35606600 GGGGTCTACTCGAGGGGAGAGGG - Intronic
1039335001 8:36579100-36579122 AGGGGCTACTTGAGGGTAAAGGG + Intergenic
1039342215 8:36663342-36663364 GGGCTCTACTTGAGGGTGGAGGG - Intergenic
1039383789 8:37112112-37112134 AGGTCCTACTTGAGGGTAAATGG + Intergenic
1039638305 8:39190918-39190940 GGGTCCTACTTGAGGGTGGAAGG - Intronic
1040357095 8:46629237-46629259 GGGAACTACTTGAGGGTGGAGGG + Intergenic
1040407613 8:47121796-47121818 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1040505648 8:48045540-48045562 AGGGTCTGCTTCAGGGGAGAAGG + Intronic
1040943927 8:52861916-52861938 GGAACCTACTTGAGGATAGAGGG - Intergenic
1040961515 8:53038569-53038591 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1041013493 8:53567920-53567942 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1041075791 8:54168568-54168590 GGTATCTACTTGAGGCTGGAGGG + Intergenic
1041180628 8:55244220-55244242 GGGGTCTACTTGAGGCTGGAGGG - Intronic
1041306656 8:56468836-56468858 GGGGTCTACTTGAGGGGGGAAGG + Intergenic
1041399723 8:57429133-57429155 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
1041471112 8:58209990-58210012 AGGGCTTACTTGAGGGTGGAAGG - Intergenic
1041577836 8:59420387-59420409 CGGGTCTACTTGAGGGTGAAGGG + Intergenic
1041695243 8:60728971-60728993 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1041715760 8:60930635-60930657 AGGGCCTACTTGAGGGTAAAGGG - Intergenic
1041791873 8:61705233-61705255 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1042046300 8:64655998-64656020 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1042143030 8:65698691-65698713 AGGGCCTACTTGAGAGTAGAAGG - Intronic
1042401026 8:68347115-68347137 GGGGTCTACTTGAGAGTGGAGGG - Intronic
1042464171 8:69107970-69107992 AGGGCCTACTTAAGGGTGGAGGG - Intergenic
1043067201 8:75589945-75589967 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
1043227726 8:77752991-77753013 AGTGTCTACTTGAAGGTGGAGGG + Intergenic
1043230882 8:77799739-77799761 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1043310135 8:78848698-78848720 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
1043361663 8:79479639-79479661 GGGATGTACTTGAGGGTGGAGGG + Intergenic
1043407818 8:79956634-79956656 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1043433539 8:80216734-80216756 GGGGTCTACCTGAGGGTGGAGGG + Intronic
1043569437 8:81585996-81586018 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1043587151 8:81782589-81782611 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1043737960 8:83770531-83770553 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1043738613 8:83777762-83777784 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1043784076 8:84374696-84374718 ATGGCCTACTTGAGGGTGGAGGG + Intronic
1044170576 8:89046745-89046767 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1044193536 8:89347809-89347831 AGGGCCTACTTGAGAGTGGAAGG - Intergenic
1044200101 8:89424664-89424686 AGGGCCTACATGAGGGTAGAGGG + Intergenic
1044307595 8:90656031-90656053 AGTACCTACTTGATGGTAGAGGG + Intronic
1044557926 8:93584839-93584861 GAGGTCTACTTGAGGGTGGAGGG + Intergenic
1044574373 8:93752273-93752295 GGGTACTACTTGAGGGTGGAGGG + Intergenic
1044662887 8:94608819-94608841 AGGACCTCCTTGAGGGTGGAGGG + Intergenic
1044960848 8:97529289-97529311 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1045127462 8:99108000-99108022 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1045239436 8:100386240-100386262 GGGATTTCCTTGAGGGTGGAAGG + Intronic
1045412948 8:101937343-101937365 GGGTTCTACTTGAGGGTGGAGGG - Intronic
1045592902 8:103618309-103618331 AGGATCTACTTGAATGGGGAGGG + Intronic
1045619550 8:103958392-103958414 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1045636884 8:104201133-104201155 AGGGCCTACTTGAGGGGAGAGGG - Intronic
1045691752 8:104766463-104766485 AGGGTCTACTGGAGGGTAGAGGG + Intronic
1045813251 8:106249332-106249354 AGGGTCTACCTGAGGGGAGAGGG + Intergenic
1045945864 8:107795194-107795216 AGGGCTTACTTGAGGGTGGAGGG + Intergenic
1046024688 8:108708032-108708054 AGTACCTACTTTAGGGTGGATGG - Intronic
1046072035 8:109267278-109267300 AGAGCCTACTTGAGGGTGGAGGG - Intronic
1046139544 8:110072351-110072373 GGAGTCTACTTGAGGGTAGAGGG - Intergenic
1046164275 8:110409517-110409539 GGGCTCTACTTAAGGGTGGAGGG + Intergenic
1046195347 8:110856699-110856721 AGGGCCTACATGAGGGCAGAGGG + Intergenic
1046255216 8:111687882-111687904 AGGGATTACTTGAGGGTGGAGGG - Intergenic
1046449560 8:114370802-114370824 GGGGTCTACTTGAGGATGGAAGG + Intergenic
1046499228 8:115054283-115054305 GGGATCTACTTGAGGATGGAGGG - Intergenic
1046596474 8:116267036-116267058 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1046709417 8:117493046-117493068 GGGGTCTACTTGAGGACAGAGGG - Intergenic
1046722065 8:117631621-117631643 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1046865359 8:119143438-119143460 ATGGCCTACTTGAGGGTGGAGGG + Intergenic
1046886176 8:119369696-119369718 AGGGCCTACTTGAGAGTGGAGGG + Intergenic
1046975476 8:120271212-120271234 AGGGCCTACTTGTGGGTGGAGGG + Intronic
1046979745 8:120324059-120324081 GGGACCTACTTGAGGGTGGAGGG + Intronic
1047032080 8:120893016-120893038 AGGACCTTCTTGAGAGAAGAGGG + Intergenic
1047033461 8:120909776-120909798 AAGACCTACTTGATGGTGGAAGG + Intergenic
1047159101 8:122356547-122356569 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1047162979 8:122402305-122402327 GGGCTCTTCTTGAGGGTGGAGGG + Intergenic
1047264888 8:123297233-123297255 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1047277975 8:123420068-123420090 GGGGCCTACTTGAGGGTAGAGGG - Intronic
1047299810 8:123603863-123603885 GTGGTCTACTTGAGGGTGGAGGG + Intergenic
1047438530 8:124856352-124856374 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1047467288 8:125129250-125129272 AGGAGCCACTGGAGGGTAGGAGG + Intronic
1047595019 8:126369663-126369685 GGGATCTTCTTGAGGGTGGAGGG - Intergenic
1047660380 8:127027362-127027384 GGGGTCTACTTGAGGATGGAGGG + Intergenic
1048658081 8:136565028-136565050 AGGACCTACTTGAGGGGGAAGGG - Intergenic
1048668716 8:136693432-136693454 AGGATGTACTTGAGGATAGAGGG - Intergenic
1048723042 8:137348936-137348958 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1049137236 8:140914578-140914600 GGGATTTACTTGAGGGTGGAGGG - Intronic
1049222976 8:141436280-141436302 AGGATGCAGTTGTGGGTAGAAGG - Intergenic
1049652673 8:143780477-143780499 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1049823588 8:144652746-144652768 AGGGTCTACCTGAGGGTGGAGGG + Intergenic
1050041402 9:1497777-1497799 AGGACCTACTGGAGGGAGGAGGG - Intergenic
1050127486 9:2374040-2374062 GGGACCTACTTGAAGGTAGAGGG + Intergenic
1050145441 9:2562350-2562372 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1050181713 9:2930136-2930158 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1050498079 9:6265532-6265554 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1050606324 9:7305046-7305068 GGGGTCTACTTGAGGGTAGGAGG - Intergenic
1050672170 9:8009847-8009869 GGGGCCTACTTGAGGGCAGAGGG + Intergenic
1050728315 9:8677510-8677532 AGGGCCTAATTGAGGGTGGAGGG + Intronic
1050764738 9:9118273-9118295 AGGATCTACCTGAGAATACATGG + Intronic
1051054359 9:12966433-12966455 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1051089816 9:13393207-13393229 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
1051861776 9:21633417-21633439 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1051930830 9:22383379-22383401 AGGGCCTACTTGAGGGTTGAGGG + Intergenic
1052071455 9:24086776-24086798 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1052393539 9:27909779-27909801 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1052446519 9:28568313-28568335 GGGGTCTACTTGTGGGTAGAGGG + Intronic
1052530095 9:29672034-29672056 AGGATCTATTCGAGGGTGGAAGG - Intergenic
1052618769 9:30877963-30877985 AGAGTCTACTTGAGAGTGGAGGG - Intergenic
1052626819 9:30986027-30986049 GGTGTCTACTTGAGGGTAGAGGG + Intergenic
1052638906 9:31138684-31138706 CGGTCCTACTTGAGGGTGGAGGG + Intergenic
1052669207 9:31534099-31534121 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1053035120 9:34820387-34820409 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1053115092 9:35493138-35493160 AGGGTCTTCTTGAGGGTAGAAGG - Intronic
1053548706 9:39052038-39052060 AGGACCTATTTGAGGGCGGAAGG + Intergenic
1053570266 9:39297113-39297135 GGGGCCTACTTGAGGGTAAAGGG + Intergenic
1053812821 9:41872097-41872119 AGGACCTATTTGAGGGCGGAAGG + Intergenic
1054091888 9:60856123-60856145 GGGGCCTACTTGAGGGTAAAGGG + Intergenic
1054113302 9:61131713-61131735 GGGGCCTACTTGAGGGTAAAGGG + Intergenic
1054126883 9:61321893-61321915 GGGGCCTACTTGAGGGTAAAGGG - Intergenic
1054594398 9:67050456-67050478 GGGGCCTACTTGAGGGTAAAGGG - Intergenic
1054617774 9:67315342-67315364 AGGACCTATTTGAGGGCGGAAGG - Intergenic
1054750481 9:68899920-68899942 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1054932472 9:70650145-70650167 AGGACTTACTTGAGGGTGGAGGG + Intronic
1055015933 9:71618191-71618213 AGGGCCTACTTGAGGGTGGGAGG + Intergenic
1055034396 9:71802793-71802815 AGGTTCTACTTGATGGGGGAGGG + Intronic
1055133160 9:72798672-72798694 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1055361958 9:75501143-75501165 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1055367419 9:75559616-75559638 AGGGCCTGCTTGAGGGTGGAAGG - Intergenic
1055387808 9:75782570-75782592 AGGACTTACTTGAGAGTGGAGGG - Intergenic
1055472945 9:76631824-76631846 AGGGACTACTAGAGGGTGGAGGG - Intronic
1055531394 9:77187866-77187888 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1055624128 9:78155749-78155771 GGGGTGTACTTGAGGGTGGAGGG + Intergenic
1055990988 9:82105351-82105373 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1056201925 9:84285385-84285407 TGGATCCACTTGAGGAAAGAAGG - Exonic
1056485311 9:87051035-87051057 GGGGTCTACTTGAGGATGGAGGG - Intergenic
1056502133 9:87220311-87220333 GGAGCCTACTTGAGGGTAGAGGG - Intergenic
1056669180 9:88609312-88609334 AGGGCTTACTTGAGGGTGGAGGG - Intergenic
1056776544 9:89516990-89517012 GGGACCTATTTGAGGGTGGAGGG - Intergenic
1056959500 9:91110347-91110369 AGGGCCTACTTGAAGGAAGAGGG + Intergenic
1057096219 9:92312487-92312509 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1057360319 9:94367309-94367331 GGGGACTACTTGAGGGTGGAGGG - Intergenic
1057408038 9:94791328-94791350 AGGGCCTGCTTGAGGGTGGAGGG + Intronic
1057663023 9:97020768-97020790 GGGGACTACTTGAGGGTGGAGGG + Intergenic
1057695415 9:97319488-97319510 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1058178027 9:101760970-101760992 AGGGCCTACTTGACGGTGGAGGG - Intergenic
1058199029 9:102015429-102015451 GGGGTCTACTTGAGGGTGGCGGG + Intergenic
1058238336 9:102522546-102522568 AGAGCCTACTTGAGGGTGGAGGG - Intergenic
1058313891 9:103539996-103540018 AGGAGCTACTGGAGGGTGGAGGG + Intergenic
1058460988 9:105182367-105182389 GGGCTCTACTTGAGGGTGGATGG - Intergenic
1058669953 9:107352425-107352447 GGGGTCTGCTTGAGGGTGGAGGG - Intergenic
1058831360 9:108820206-108820228 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1058833473 9:108839910-108839932 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1058930446 9:109713966-109713988 AGGAGAAACTTGAGGGTATATGG + Intronic
1058942067 9:109822528-109822550 AGGGCTTACTTGAGGGTAGAAGG - Intronic
1059003332 9:110374155-110374177 GGAGCCTACTTGAGGGTAGAGGG - Intronic
1059017392 9:110534180-110534202 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1059036583 9:110760549-110760571 GGGATCTACCTGAGGGTAGAGGG + Intronic
1059633080 9:116145683-116145705 AGGGCCTACTTGAGGGTGTATGG + Intergenic
1059839763 9:118200768-118200790 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1059890342 9:118795100-118795122 GGGATCTACCTGAGAGTGGAGGG - Intergenic
1059901903 9:118936815-118936837 AGGCTCTAATTCAGGGTGGATGG - Intergenic
1060117702 9:120956868-120956890 AGAGCCTACTTGAGGGTAGAGGG + Intronic
1060122014 9:121000833-121000855 AGGGCCTGCTTGAGGGTGGAGGG - Intronic
1061616197 9:131780877-131780899 GAGGTCTACTTGAGGGTAGAGGG + Intergenic
1062299164 9:135854923-135854945 GGGGTCTCCTTGAGGGTGGAGGG - Intronic
1062756981 9:138304470-138304492 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1185660174 X:1721433-1721455 AGGGTCCACTTGAAGGTAGAGGG - Intergenic
1185670412 X:1805046-1805068 GGGGTCTACTTGAGGGTAAAAGG - Intergenic
1185775412 X:2799244-2799266 AGGGCCTACTTGAGGGCAGAGGG - Intronic
1185881973 X:3749409-3749431 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1185908623 X:3961417-3961439 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1185912309 X:3993597-3993619 GGGGTCTACTTGAGAGTGGAAGG + Intergenic
1185918879 X:4066916-4066938 GGGGACTACTTGAGGGTGGAGGG + Intergenic
1185919010 X:4068390-4068412 GGTATCTACTTGAAGGTGGAGGG + Intergenic
1185930557 X:4198397-4198419 AGGGTCTACTTGAGGGTGAAGGG - Intergenic
1185932495 X:4218642-4218664 GGGGACTACTTGAGGGTGGAGGG + Intergenic
1186018488 X:5226623-5226645 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1186032656 X:5386834-5386856 GGGGCCTACTTGAGGGTAGAAGG - Intergenic
1186052092 X:5607582-5607604 AGGGCCTACTTGAGGATGGAGGG + Intergenic
1186330264 X:8525029-8525051 GGGACCTACTTGAGGGTGGAAGG - Intergenic
1186373292 X:8968628-8968650 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1186378204 X:9031609-9031631 TGGGCCTACTTGAGGGTGGAGGG + Intronic
1186402338 X:9271353-9271375 AGGGCCTACATGAGGGTGGAGGG - Intergenic
1186632396 X:11364191-11364213 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1186862578 X:13688429-13688451 AGGGCCCACTTGAGGGTTGAGGG - Intergenic
1186921007 X:14280258-14280280 GGGGTGTACTTGAGGGTAGAGGG - Intergenic
1186947398 X:14584038-14584060 GGGACCTACTTGAGGGTGGAGGG + Intronic
1187053635 X:15718820-15718842 CTTACCTACTTGAGGGTAGAGGG + Intronic
1187054292 X:15727343-15727365 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1187132450 X:16515956-16515978 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1187295298 X:17993486-17993508 AGGATCCATTTGAGAGCAGAAGG + Intergenic
1187306538 X:18100203-18100225 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
1187492997 X:19770201-19770223 GGGGCCTACTTAAGGGTAGAGGG - Intronic
1187600286 X:20821733-20821755 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1187712055 X:22064301-22064323 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1187746426 X:22414215-22414237 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1187755865 X:22525535-22525557 GGGGTCTACTTGAGAGTGGAGGG + Intergenic
1187756427 X:22532168-22532190 GGAGTCTACTTGAGGGTAGAAGG + Intergenic
1188111666 X:26201084-26201106 AGATTCTACTTGAGGGTGGAAGG - Intergenic
1188148240 X:26640729-26640751 GGGGTCTACTTGAGGATGGATGG - Intergenic
1188172572 X:26945977-26945999 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1188259149 X:28001918-28001940 GGGACTTACTTGAGGGTGGAGGG - Intergenic
1188261975 X:28033558-28033580 AGGATTTAGTAGAGGGCAGAAGG + Intergenic
1188362310 X:29271015-29271037 AAGGTCTACTTGAGGGTGGAGGG - Intronic
1188471015 X:30539270-30539292 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1188516580 X:30994020-30994042 AGAGGCTACTTGAGGGTGGAGGG - Intergenic
1188573524 X:31618061-31618083 AGGATCTACTCTAGGGTGGAGGG + Intronic
1188645691 X:32564015-32564037 GGGATCTACTTGAGGTGGGAGGG - Intronic
1188715248 X:33452000-33452022 GGGTTCTAGTTGAGGGTGGAGGG + Intergenic
1188738657 X:33749959-33749981 AGGGCCTACTTGAGGATGGAGGG - Intergenic
1188810563 X:34649537-34649559 GGGGTCTACTTGAGGGTTGAGGG + Intronic
1188848786 X:35106615-35106637 AGGACTTACTTGAGGGTGGAGGG + Intergenic
1188992581 X:36840693-36840715 GGGGTCTACTTGAGGGTGGATGG - Intergenic
1189095664 X:38136394-38136416 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1189132063 X:38509901-38509923 AGAGCCTACTTGAGGGTGGAGGG + Intronic
1189388332 X:40555564-40555586 AGGGCCTACTCGAGGGTGGAGGG + Intergenic
1189497881 X:41525877-41525899 AGCATCTTCTTGTGGGTTGAGGG + Intronic
1189570814 X:42294499-42294521 TGGGTCTACTTAAGGGTGGAAGG - Intergenic
1189611232 X:42738342-42738364 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1189638741 X:43043924-43043946 GGGGCCTCCTTGAGGGTAGAGGG - Intergenic
1189720659 X:43912923-43912945 GGGGCCTACTTGAGGGTGGATGG - Intergenic
1190127523 X:47720018-47720040 GGGGTCTACTTGACGGTGGAGGG + Intergenic
1190133322 X:47771017-47771039 GGGGTCTACTTGAGGGTGTAGGG + Intergenic
1190167926 X:48088551-48088573 AGGGCCTACTTGAGAGTGGAGGG + Intergenic
1190447937 X:50549247-50549269 GGGGTCTACTTGAGGGTAGAGGG - Intergenic
1190513789 X:51202091-51202113 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1190905861 X:54727271-54727293 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1191020430 X:55854158-55854180 AGGGCCTACTTAAGGGTGGAAGG - Intergenic
1191046237 X:56140591-56140613 AGGGCCTACTTGAGGGTGGATGG + Intergenic
1191088109 X:56590836-56590858 AGGGCCCATTTGAGGGTAGAAGG - Intergenic
1191091585 X:56628979-56629001 AGAGTCTACTTGAGGGTGAAGGG - Intergenic
1191130752 X:57007222-57007244 AGGACCTACTTAAGGGTGCATGG - Intergenic
1191219286 X:57969683-57969705 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1191661928 X:63660380-63660402 GGGGTTTACTTGAGGGTGGAAGG + Intronic
1191710681 X:64147439-64147461 GGGACCTACTTGAGGGATGATGG - Intergenic
1191738376 X:64411055-64411077 GGATTCTACTTGAGGGTAGAGGG - Intergenic
1191763806 X:64673680-64673702 AGGGCCTACTTGAGGGTTGAGGG + Intergenic
1191817321 X:65260404-65260426 AGGGACTACTTGAGGGTGTAGGG + Intergenic
1191818751 X:65278803-65278825 GGGGTCTACTTGAGGGGGGAGGG - Intergenic
1191850699 X:65583819-65583841 AGGGCCTACTTGAGGGTGAAGGG - Intergenic
1191878715 X:65822932-65822954 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1191926420 X:66315743-66315765 AGGGGCTACTTGAGAGTAGAGGG + Intergenic
1191927718 X:66331879-66331901 AGGGTGTACTTGAGGGTGGAGGG - Intergenic
1192019427 X:67369559-67369581 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
1192042107 X:67633289-67633311 AGGGCCTACTTGATGGTGGAGGG - Intronic
1192075787 X:67994723-67994745 GGAATGTACTTGAGGGTGGAGGG - Intergenic
1192338998 X:70246742-70246764 AGGGCCTACTTGAGAGTGGAGGG + Intergenic
1192354824 X:70391772-70391794 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1192364552 X:70460351-70460373 AGAAGTAACTTGAGGGTAGATGG + Intronic
1192397753 X:70800230-70800252 GAGGTCTACTTGAGGGTGGAGGG + Intronic
1192415076 X:70972541-70972563 GGGGCCTACTAGAGGGTAGAGGG + Intergenic
1192616194 X:72625256-72625278 AGGACCTTCTTGAGGATGGAGGG - Intronic
1192767507 X:74157169-74157191 AGCACCTACTTGAGAGTGGAGGG + Intergenic
1192839526 X:74839567-74839589 GGGGTCTACTTGAGGGTGAAGGG - Intronic
1192849325 X:74937718-74937740 AGGGTCTACTTAAGGGTGGAGGG - Intergenic
1192955743 X:76068701-76068723 AGGGCCTACTTGAGGATGGAGGG + Intergenic
1193085166 X:77442408-77442430 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1193096989 X:77561164-77561186 AGGACATACTTGAAGGTATATGG + Intronic
1193187063 X:78525971-78525993 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
1193252274 X:79305706-79305728 AGGGTCTACTTGAAGGTGAAAGG + Intergenic
1193263974 X:79445766-79445788 GGGACCTACTTGAAGGTGGAGGG + Intergenic
1193264083 X:79447178-79447200 GGGGTCTACTTGATGGTGGAGGG - Intergenic
1193270462 X:79523758-79523780 AGGTCCTACTTGAGAGTGGAAGG + Intergenic
1193275659 X:79584312-79584334 AGGCCCTAGTTAAGGGTAGAAGG - Intergenic
1193289694 X:79757178-79757200 AGGACCTACTTCAGGATGGAGGG - Intergenic
1193299585 X:79873801-79873823 GGGGTCTACTTGAGAGGAGAGGG + Intergenic
1193308784 X:79980537-79980559 GGGACCTACTTTAGGGTGGAGGG - Intergenic
1193340533 X:80343953-80343975 AGGGCCTACTTGAGGGAGGAGGG - Intronic
1193429360 X:81382083-81382105 AGGACCTACTGGAGGGTGGAGGG - Intergenic
1193472961 X:81928808-81928830 AGGGTCTATTTGAGGGTGGAGGG + Intergenic
1193482074 X:82039016-82039038 AGGGCCTACCTGAGGGTGGAGGG + Intergenic
1193515457 X:82456437-82456459 AGGACCTACCTGAGGGTGAAGGG + Intergenic
1193570437 X:83134952-83134974 TGGCTCTACTTGAGTGTGGAGGG + Intergenic
1193609561 X:83612913-83612935 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1193637178 X:83965967-83965989 GGAGTCTACTTGAGGATAGAGGG + Intergenic
1193674353 X:84431022-84431044 AGTACCTACTTGAAGGTGGAAGG - Intronic
1193722197 X:85000281-85000303 GGGGCCCACTTGAGGGTAGAGGG - Intergenic
1193748746 X:85316877-85316899 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1193825377 X:86219463-86219485 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1193851739 X:86545390-86545412 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1193987718 X:88266574-88266596 GGGGTCTACTTGAGGGCAGAGGG + Intergenic
1194078536 X:89428752-89428774 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1194091919 X:89587781-89587803 AGGGGCTACTTGAGGGTGGAGGG + Intergenic
1194140229 X:90199663-90199685 ATGATCTGCTTCAGGGAAGAGGG - Intergenic
1194167432 X:90536272-90536294 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194179249 X:90692530-90692552 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194234429 X:91364693-91364715 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194243204 X:91477190-91477212 AAGGTCTACTTGAGGTTTGAGGG - Intergenic
1194260963 X:91695152-91695174 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1194290020 X:92060486-92060508 AGGGTCTACTTCAGGGTGGAGGG - Intronic
1194407192 X:93511273-93511295 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1194410209 X:93548072-93548094 GGGGCCTACTTGAGGGTAGAGGG + Intergenic
1194415840 X:93610619-93610641 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194425602 X:93733655-93733677 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1194484205 X:94467068-94467090 GGGGTGTACTTGAGGGTAGAGGG + Intergenic
1194593454 X:95830020-95830042 GGGGTCTGCTTGAGGGTGGAGGG - Intergenic
1194780857 X:98024039-98024061 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
1194912564 X:99664830-99664852 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1194948599 X:100097864-100097886 GGGGTCTACTTGGGGGTGGAAGG + Intergenic
1195155693 X:102121732-102121754 AGGGCCTACTTGAAGGTGGATGG + Intergenic
1195207655 X:102619097-102619119 GGGCCCTACTTGAGGGTTGAAGG - Intergenic
1195209252 X:102636336-102636358 GGGGTCTACTTGAGAGTTGAGGG + Intergenic
1195280253 X:103326531-103326553 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1195412185 X:104579593-104579615 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1195448493 X:104981286-104981308 AGGGCCTACTTGAGGGTGAAGGG - Intronic
1195448553 X:104981977-104981999 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1195472948 X:105253703-105253725 GGGGTCTACTTGAAGGTGGAAGG - Intronic
1195540027 X:106052931-106052953 GGGGCTTACTTGAGGGTAGAGGG + Intergenic
1195586609 X:106572181-106572203 GGGGCCTACCTGAGGGTAGAGGG + Intergenic
1195617902 X:106927548-106927570 AAAATCTACTCCAGGGTAGATGG - Intronic
1195909375 X:109874475-109874497 GGGGACTACTTGAGGGTGGAGGG - Intergenic
1195971314 X:110476994-110477016 AGGGACTACTTGAGGGTGGGAGG - Intergenic
1195979721 X:110564352-110564374 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1196010553 X:110882985-110883007 AGGACCTTCTTGAAGGTGGAGGG - Intergenic
1196080695 X:111627621-111627643 TGGGTCTACTTGAGGGCGGAGGG + Intergenic
1196472330 X:116042571-116042593 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1197045491 X:121992272-121992294 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1197107798 X:122736422-122736444 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1197177014 X:123496738-123496760 GGGTCCTACTTGAGGGTGGAGGG - Intergenic
1197256772 X:124271935-124271957 GGAGTCTACTTGAGGGTGGAGGG + Intronic
1197259262 X:124299687-124299709 GGTGTCTACTTGAGGGTGGAGGG + Intronic
1197353597 X:125406345-125406367 GAGGTCTACTTGAGGGTAGAGGG - Intergenic
1197367235 X:125579157-125579179 AGGACCTACTTGAGGGTGGAGGG - Intergenic
1197437318 X:126447393-126447415 GGGGTCTACCTGAGGGTTGAGGG - Intergenic
1197595903 X:128464018-128464040 AGCATGTACTTGAGGGTGGAGGG - Intergenic
1197791070 X:130254747-130254769 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1197913174 X:131507560-131507582 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1198063205 X:133068240-133068262 AGGGCCTACTTGAGGGTAGAGGG + Intronic
1198076577 X:133199057-133199079 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1198107037 X:133471639-133471661 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1198426899 X:136529639-136529661 GGGACCTACTTGAAGGTGGAAGG + Intergenic
1198579170 X:138044933-138044955 GGGATCTATCTGAGGGTGGAGGG + Intergenic
1198722298 X:139635877-139635899 CGGGTCTACTTGAGGGTGGAGGG - Intronic
1198794146 X:140377935-140377957 GGGGTCTACTTGTGGGTGGAGGG + Intergenic
1198796526 X:140402503-140402525 GGGGTCTATTTGAGGGTGGAGGG + Intergenic
1198837721 X:140821836-140821858 AGGGCCTACTTGAGGATGGAGGG - Intergenic
1198875591 X:141222557-141222579 AGTATTTACTAGAGGATAGATGG - Intergenic
1198945462 X:142008165-142008187 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1199197981 X:145054654-145054676 AGGGCCTACTTGAGGGTTCAGGG + Intergenic
1199257747 X:145735978-145736000 AGGACCTACTTGAGGACAGAGGG + Intergenic
1199290136 X:146095890-146095912 CGGGCCTACTTGAGGGTGGAAGG + Intergenic
1199338470 X:146647212-146647234 GGGGCATACTTGAGGGTAGAGGG - Intergenic
1199365589 X:146978325-146978347 GGGATCTACTTCAGGGGAGAGGG - Intergenic
1199469144 X:148174537-148174559 GGGGCCTACTTGAGGGTAGAGGG - Intergenic
1199531415 X:148851878-148851900 GGGGTCTACTTGAGAGGAGAGGG - Intronic
1199640333 X:149854458-149854480 AGGGCCTATTGGAGGGTAGAGGG + Intergenic
1199845542 X:151690351-151690373 AGGGCCCACTTGAGGGTTGATGG - Intergenic
1199877002 X:151940781-151940803 AGGACCTGCTTGAGGGTGGAGGG - Intergenic
1199995114 X:153019146-153019168 GGGACCTACTTGAGAGTGGAGGG + Intergenic
1200035388 X:153324726-153324748 GGGGTCTACTTGAGGATGGAGGG - Intergenic
1200431144 Y:3083874-3083896 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1200444559 Y:3243843-3243865 AGGGACTACTTGAGGGTGGAGGG + Intergenic
1200485975 Y:3768629-3768651 ATGATCTGCTTCAGGGAAGATGG - Intergenic
1200513695 Y:4114050-4114072 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1200525914 Y:4274695-4274717 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1200579614 Y:4933954-4933976 AGGGCCTATTTGAGGGTGGAGGG - Intergenic
1200607532 Y:5285060-5285082 AGGATCTACTTCAGGGTGGAGGG - Intronic
1200783060 Y:7234231-7234253 AGGGCCTACTTGAGGGTTTAGGG + Intergenic
1201248259 Y:12028714-12028736 GGGTTCTACTTGAGGGGGGAGGG + Intergenic
1201249051 Y:12037451-12037473 AACACCTACTTGAGGGTGGAGGG + Intergenic
1201294501 Y:12452155-12452177 AGGGCCTACTTGAAGGCAGAGGG + Intergenic
1201336330 Y:12884348-12884370 AAGACCTACTTGGGGGTGGAAGG - Intergenic
1201384303 Y:13421752-13421774 GGGATCTACTTGAGAGTGGAGGG + Intronic
1201399483 Y:13589218-13589240 GGCACCTACTTGAGGGTGGAGGG + Intergenic
1201432921 Y:13923548-13923570 GGGACCTACTTGAGGGTGGAAGG + Intergenic
1201666551 Y:16463367-16463389 GGGACCTACTTGAGGATGGAGGG + Intergenic
1201713503 Y:17017795-17017817 AGGGCCTACTTGAGGTTGGAGGG + Intergenic
1201753387 Y:17459601-17459623 GAGACCTACTTGAGGGTGGAAGG + Intergenic
1201790248 Y:17832009-17832031 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1201811306 Y:18073980-18074002 GGGACCTACTTGAGGGTGGAGGG - Intergenic
1201848166 Y:18446382-18446404 GAGACCTACTTGAGGGTGGAAGG - Intergenic
1201967768 Y:19756793-19756815 AGGATCTACTTCAGGGTGGAGGG - Intergenic
1201984460 Y:19950482-19950504 AGGTTCTAACTGAGGGCAGAGGG - Intergenic
1202300719 Y:23410952-23410974 GGGGTCTACTTCAGGGTGGAGGG + Intergenic
1202351892 Y:24001755-24001777 GGGACCTACTTGAGGGTGGAGGG + Intergenic
1202518887 Y:25668364-25668386 GGGACCTACTTGAGGGTGGAGGG - Intergenic
1202570092 Y:26259646-26259668 GGGGTCTACTTCAGGGTGGAGGG - Intergenic