ID: 1085224494

View in Genome Browser
Species Human (GRCh38)
Location 11:74907325-74907347
Sequence CCATTCCCAGGAAGCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085224485_1085224494 29 Left 1085224485 11:74907273-74907295 CCTGTGAGTGCAAAGATCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 165
Right 1085224494 11:74907325-74907347 CCATTCCCAGGAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 24
4: 225
1085224483_1085224494 30 Left 1085224483 11:74907272-74907294 CCCTGTGAGTGCAAAGATCTTGG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1085224494 11:74907325-74907347 CCATTCCCAGGAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085224494 Original CRISPR CCATTCCCAGGAAGCCATGG AGG Intronic
900114604 1:1023133-1023155 CCCTTCCCAGGCAGCCATGAGGG - Intronic
900140632 1:1138088-1138110 CCCATCCCAGGAGCCCATGGAGG + Intergenic
900161035 1:1223874-1223896 GCACTTCCAGGAGGCCATGGAGG - Exonic
900265022 1:1753128-1753150 CCATTCCCAGGGAGGGAGGGAGG - Intronic
900947648 1:5840390-5840412 CCCTTCCCAGGTAGGCATCGGGG - Intergenic
901018812 1:6245786-6245808 CCTTTCCCAGGGACCCCTGGCGG + Intergenic
901023826 1:6268809-6268831 CCACTCCCAGGTGGTCATGGAGG - Intronic
901110070 1:6786247-6786269 CCCTTCCCGGGAAGCGAAGGGGG - Intronic
901882005 1:12199478-12199500 CCATCCCCAAGAGGCCACGGAGG - Intronic
905648564 1:39640975-39640997 TCAGTACCAGGAAGCCCTGGTGG + Intergenic
906058390 1:42932937-42932959 CCGTTCCAAGGACGCCATGCAGG + Intronic
907746662 1:57220350-57220372 CAATTCCCAGGAGGGCTTGGTGG + Intronic
909014391 1:70367445-70367467 GCATTCCCAGGAAGTTAAGGAGG - Intronic
910157978 1:84241684-84241706 ACAATCCCAGCCAGCCATGGTGG - Intergenic
912387002 1:109275963-109275985 CATTTCCAAGGAAGACATGGTGG + Intergenic
915905873 1:159876737-159876759 ACATTCCCAGGATGCCTTGCGGG - Exonic
917977789 1:180251272-180251294 CCATTCCCAGGCATGCTTGGTGG + Intronic
918071139 1:181134082-181134104 CCATTCCCACGCAGGCATGTGGG - Intergenic
921063627 1:211607440-211607462 CCATTCCCAGAAAGGGAGGGAGG + Intergenic
921171093 1:212550366-212550388 CCTTTCTCAGGAAGCTATGGAGG - Intergenic
922718642 1:227889307-227889329 CCCTTCCCAGGTAGCTCTGGGGG + Intergenic
922910037 1:229207825-229207847 CAAATTCCAGGAAGCCAAGGTGG + Intergenic
924412740 1:243823096-243823118 TCATTCCCAGGATGCAATGCTGG + Intronic
1062833710 10:623100-623122 CCCTTCCCAGGGAGCCAGTGAGG + Intronic
1069686239 10:70320869-70320891 CCATTCTCAGGAAGAGAAGGAGG - Intronic
1069796194 10:71053393-71053415 CCATTCTCAGGAGGCCACTGGGG - Intergenic
1072226595 10:93375843-93375865 CCATTCTCAGGAACCCTTGGGGG - Intronic
1074426694 10:113357869-113357891 TCATTCTCAGCCAGCCATGGGGG + Intergenic
1075472360 10:122701193-122701215 CCCTTACCAGAAATCCATGGTGG + Intergenic
1076133658 10:128030123-128030145 GCCTTCCCAGGAAGACTTGGTGG + Intronic
1080522065 11:33076195-33076217 CCAGTCCCAAAAAGCCATTGGGG + Intronic
1080895967 11:36449056-36449078 ACATTCCCAGGAAGCCCTCAGGG - Intronic
1081472798 11:43392138-43392160 CCTTTCCCAGGAAGAGATGCTGG + Intronic
1082773140 11:57224299-57224321 CTAGTCCCAGGAAGCCAGGCAGG - Intergenic
1084462692 11:69304733-69304755 CCATGGCCAGGAAGCCATCCTGG + Intronic
1085108746 11:73868707-73868729 CCATTCCCAGGATTCCATGGTGG - Intergenic
1085224494 11:74907325-74907347 CCATTCCCAGGAAGCCATGGAGG + Intronic
1085683193 11:78597299-78597321 CCCTCCCCAGGAAGCCATAGAGG - Intergenic
1086046548 11:82539458-82539480 CAATACCCAGAAAGCCAGGGTGG + Intergenic
1088423820 11:109678326-109678348 GATTTCCAAGGAAGCCATGGTGG + Intergenic
1089319816 11:117617925-117617947 CCATGCCCAGGTAACCATGCAGG + Intronic
1089586424 11:119512566-119512588 CCATCCCCAGGGAGCCCTGGAGG - Intergenic
1089884125 11:121803013-121803035 CAAGTCACAGGAAGCCAAGGGGG - Intergenic
1090082738 11:123624891-123624913 CCATTCCCAGGAGGAAAAGGTGG + Intronic
1090603256 11:128394411-128394433 AGATTCCCAGGAAGCATTGGAGG - Intergenic
1092167116 12:6349000-6349022 CCATTCCTAGGAAAGAATGGGGG + Exonic
1095812448 12:46384475-46384497 CCTTTCCCAGGAAGACATCGTGG + Intergenic
1096549934 12:52365303-52365325 CCATTCCCAGGCCCCCAGGGAGG + Intronic
1098571571 12:71993427-71993449 CCATTCCCAGACAACCATAGGGG + Intronic
1101875819 12:108596550-108596572 CCTTTCCCTGGAAGCCAGGAGGG - Intronic
1103530931 12:121601158-121601180 CCATCCCCGGGCACCCATGGAGG + Intergenic
1103958761 12:124594405-124594427 CCCTTCCCTGCAAGGCATGGTGG + Intergenic
1105704812 13:22962288-22962310 CCCTTACCAGGAAACCGTGGAGG - Intergenic
1105857774 13:24387446-24387468 CCCTTACCAGGAAACCGTGGAGG - Intergenic
1106104089 13:26718692-26718714 CAATTCACAGGCAGCCACGGTGG - Intergenic
1106659289 13:31781655-31781677 CAAATCCCTGGAAGTCATGGAGG - Exonic
1106852484 13:33809448-33809470 GCATACACAAGAAGCCATGGGGG - Intergenic
1108197186 13:48006912-48006934 CCAATCCCAGCCAGGCATGGTGG + Intergenic
1111985075 13:95057748-95057770 ACAACCCCAGGAAGCCATGCAGG + Intronic
1113379999 13:109795652-109795674 CCTTCCCCAGGAAGCCAGGTTGG - Intergenic
1113389003 13:109877916-109877938 CCATTCCCTGGCAGGCAGGGTGG + Intergenic
1113420691 13:110169720-110169742 TCAATCCCAGGAAGCCCTGGAGG + Exonic
1114058697 14:18999653-18999675 CCATGCCCAGGAAGCAAGGCTGG - Intergenic
1114103847 14:19402101-19402123 CCATGCCCAGGAAGCAAGGCTGG + Intergenic
1116081993 14:40186248-40186270 CCCTCCCCAGGAAGCCACAGAGG - Intergenic
1118318719 14:64741158-64741180 CCATCCCCAGAAGGCCCTGGTGG - Exonic
1118744410 14:68763334-68763356 CCATCCCTAGGGAGCCAGGGAGG - Intergenic
1119112567 14:71988779-71988801 TTATTTCCAGGAACCCATGGAGG + Intronic
1121456946 14:94044325-94044347 CCAAACCCAGGTAGTCATGGTGG + Intronic
1122814977 14:104307778-104307800 GCATGGCCAGGAAGCCAGGGAGG - Intergenic
1127761995 15:62148471-62148493 CCACTCTCAGGGTGCCATGGAGG + Intergenic
1129280774 15:74483338-74483360 CAATTCCCAGCCAGGCATGGTGG + Intergenic
1129737750 15:77975432-77975454 GCATTCCCTGGCAGCGATGGCGG - Intergenic
1129771648 15:78206770-78206792 CCATTCAGATGAAGCCATTGAGG + Intronic
1130067257 15:80615105-80615127 CCTTTTCCAGGATGCCAGGGAGG + Intergenic
1130408302 15:83622996-83623018 CCATCTCCAGGAAGCAATGCAGG - Intergenic
1131383842 15:91986263-91986285 TCTTCCCCAGGAAGCCAGGGAGG - Intronic
1132135310 15:99331825-99331847 GCATTCCCAGCAGGGCATGGCGG - Intronic
1132584964 16:702106-702128 CCATTCCCAGACGGCCATGTGGG + Intronic
1135459301 16:22627674-22627696 GCAATCCCAGGAGGCCAAGGTGG + Intergenic
1135559291 16:23463172-23463194 CCATTCCCAGGCAGCCAAGCAGG - Intergenic
1136079906 16:27845047-27845069 CCATTCCCAGGAGGCCTGTGGGG + Exonic
1139319416 16:66101439-66101461 CCTTTCCCAGGAGGGCATGCTGG - Intergenic
1140240073 16:73192356-73192378 GAAATCCCAGGAAGCCAGGGCGG - Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141553096 16:84819354-84819376 GCGTTCCCAGGAATCCAGGGAGG - Intergenic
1141916731 16:87102793-87102815 ACATTCTCAGAATGCCATGGAGG - Intronic
1142030322 16:87835302-87835324 CCATGCCCAGGTCCCCATGGGGG + Intronic
1142287079 16:89175851-89175873 GGACTCCCAGGAGGCCATGGAGG + Intronic
1142367625 16:89658312-89658334 GCATTCCCAGGAAGCCAGGCAGG + Exonic
1143366596 17:6412798-6412820 CCTTTCCCAGGAAGTTCTGGGGG - Intronic
1143837536 17:9703912-9703934 CCTTTCCTAGGAAGCCACTGAGG - Intronic
1144653136 17:17019373-17019395 TCAGGGCCAGGAAGCCATGGGGG + Intergenic
1146789065 17:35741499-35741521 GCTGTCCCAGGAAGCCACGGGGG - Exonic
1146923033 17:36726563-36726585 CCATCCCCAGGAAGGCATGCGGG - Intergenic
1147854472 17:43468404-43468426 CCATTGCCTGAAACCCATGGAGG - Intergenic
1150273313 17:63880715-63880737 CCAGTCCCTGGAAGCCAGTGGGG + Exonic
1150633532 17:66897236-66897258 CCATTCCCAGGGAGGCTGGGAGG + Intergenic
1151968540 17:77445080-77445102 CCGTCCCCAGGCAGGCATGGTGG - Intronic
1152237489 17:79146182-79146204 CAGTTCCCACCAAGCCATGGAGG + Intronic
1153459499 18:5318089-5318111 CCTTTGCCAGGTAGGCATGGGGG - Intergenic
1155148754 18:23105766-23105788 CCATTCACAGGAAGCCAGCGTGG + Intergenic
1160571219 18:79818818-79818840 TCATTCCCAGGCAGCAAAGGGGG + Intergenic
1161232371 19:3180655-3180677 CCCAGCCCAGGAAGCCAAGGTGG - Intergenic
1161260810 19:3336867-3336889 CGTTTCCCAGGCAGCCGTGGGGG - Intergenic
1161543537 19:4866792-4866814 CCAGTTCCAGGAAGTCATGGTGG - Intronic
1162564165 19:11435959-11435981 TCATTGCCTGGAAGCGATGGAGG + Intronic
1165104532 19:33461325-33461347 CCATTACCTGGAAGGCATGAGGG + Intronic
1165281648 19:34803140-34803162 CCCTTCCCAGTAAGCCTTTGGGG + Intergenic
1166033114 19:40147901-40147923 CCAGTCCCAGGCAGCCCTGCAGG - Intergenic
1166894379 19:46014983-46015005 CCATTCCCACTACTCCATGGGGG - Intronic
1167593370 19:50415948-50415970 CCACACCCAGGCTGCCATGGGGG - Intronic
925045653 2:771305-771327 CCCTTCCCAGGACTCCAGGGCGG + Intergenic
926378814 2:12263304-12263326 CTAGTCCCAGGAATCCAGGGGGG + Intergenic
927527561 2:23760371-23760393 CCATTTCCAGCTAGGCATGGTGG + Intronic
928409938 2:31047233-31047255 TCAGACCCAGCAAGCCATGGTGG + Intronic
929728385 2:44457862-44457884 CCATCACCAAGCAGCCATGGAGG - Intronic
930019628 2:46993675-46993697 CCTTTCCCACGCAGCCAGGGAGG + Intronic
934858150 2:97741574-97741596 CCATACCCAGGGAGCCTGGGCGG - Intergenic
937047830 2:118861465-118861487 CCACACCCTGGAAGCCCTGGGGG - Intergenic
937091258 2:119207832-119207854 CAATTCCCCAGATGCCATGGAGG - Intergenic
937859403 2:126696332-126696354 CCACTCCCAGGGACCCAGGGAGG + Exonic
938184238 2:129214455-129214477 CCACTCCCAGGAAGCCAAGAGGG - Intergenic
938282500 2:130074564-130074586 CCATGCCCAGGAAGCAAGGCTGG + Exonic
938310450 2:130285628-130285650 CCAAAGCCAGGAAGCCCTGGGGG - Intergenic
938333129 2:130463136-130463158 CCATGCCCAGGAAGCAAGGCTGG + Exonic
938356682 2:130657535-130657557 CCATGCCCAGGAAGCAAGGCTGG - Exonic
938379410 2:130828185-130828207 CCATCACCAGGATGCCTTGGAGG + Intergenic
938433118 2:131264341-131264363 CCATGCCCAGGAAGCAAGGCTGG - Exonic
938477165 2:131626924-131626946 CCATGCCCAGGAAGCAAGGCTGG - Intergenic
939950635 2:148468580-148468602 CCATTCCGTGGCAGCCATGGAGG + Exonic
940229904 2:151439694-151439716 CCATTCTCAGCCAGGCATGGTGG + Intronic
942155320 2:173121757-173121779 CCATTCCCAGGAGGTGATGGTGG - Intronic
943249288 2:185496203-185496225 GCCTACCCAGGATGCCATGGAGG - Intergenic
943617116 2:190105724-190105746 GCATTACCAGGAAGCCCTGAGGG - Intronic
944914990 2:204350595-204350617 CCATTCTCAGGAAGCAAGGTTGG - Intergenic
947666836 2:231911243-231911265 GCATTTCCCTGAAGCCATGGAGG + Intergenic
947983523 2:234429386-234429408 GTATTCCCAGGAAACCATTGAGG - Intergenic
948041982 2:234909425-234909447 CCACTTTCAGGAAGCCATGTGGG + Intergenic
948424180 2:237877297-237877319 CCAGTTCCAGGTAGACATGGAGG + Exonic
1168997949 20:2146677-2146699 TCATTCCCAGAGAGCCACGGGGG + Exonic
1169164008 20:3407364-3407386 CCGTCCCGAGGAAGCCATGTCGG + Intronic
1170304026 20:14917820-14917842 CCATTCCAGGGAAGCAGTGGGGG + Intronic
1170665779 20:18384870-18384892 CAGTGCCCCGGAAGCCATGGTGG + Intronic
1172625034 20:36342030-36342052 CATTTCCCAGGAACCCCTGGTGG + Intronic
1172867243 20:38109698-38109720 CCATGACCAGGAAGACATGTTGG + Intronic
1173934392 20:46848351-46848373 CCATTCCCAGGAATTCTTGAAGG + Intergenic
1175092760 20:56518516-56518538 CCATGGCCAGGAAGCCCTGTGGG + Exonic
1175125422 20:56747815-56747837 CCATTCCCAGGTCTCCTTGGAGG - Intergenic
1175553471 20:59831728-59831750 CAAAGCCCAGGAAGCCCTGGCGG + Intronic
1176300874 21:5098374-5098396 CCGCTCCCAGGAAGCCTTTGTGG + Intergenic
1177670599 21:24220551-24220573 CCATTCTCAGAAAGACATGGAGG - Intergenic
1178506729 21:33168855-33168877 CCAGTCCCAGCAGCCCATGGAGG - Intronic
1179644540 21:42767415-42767437 CAGTTCCCAGGAAGCCATTCAGG - Intronic
1179716214 21:43290127-43290149 CCCTCCCAAGGCAGCCATGGGGG - Intergenic
1179856162 21:44163579-44163601 CCGCTCCCAGGAAGCCTTTGTGG - Intergenic
1180477183 22:15722272-15722294 CCATGCCCAGGAAGCAAGGCTGG - Intergenic
1180737831 22:18031825-18031847 CCAAGCCCAGGAAGCCACGCTGG - Intergenic
1181293488 22:21816390-21816412 CCATTCCCAGGCAATCCTGGGGG - Intronic
1182395996 22:30036357-30036379 CCAGTCCCAGGAAGGGTTGGTGG - Intergenic
1182897350 22:33869662-33869684 CCCTTCCCAGGATGACATGAGGG - Intronic
1183061418 22:35338595-35338617 CCATTTCCAGGCAGGCCTGGAGG + Intronic
1183269727 22:36853593-36853615 CCCTGCCCTGGAAGCCATGTTGG - Intergenic
1184731860 22:46375007-46375029 CCACTGCTGGGAAGCCATGGAGG + Intronic
1184912899 22:47548025-47548047 CCCATGCCAGGAAGCCAGGGCGG - Intergenic
1185215781 22:49599270-49599292 CCACTCCCTGGAAGTCAGGGTGG - Intronic
949414027 3:3797944-3797966 CCACTCCCAGGAAGGCAGGCTGG + Intronic
950478872 3:13232471-13232493 GCATTCCCAGCAAGGCAGGGAGG + Intergenic
950565259 3:13765866-13765888 TCATTCCCAGGAGCCCTTGGAGG - Intergenic
950581319 3:13864121-13864143 CCATCCCCAGGAGCACATGGCGG + Intronic
951218469 3:20045501-20045523 CCAATCCCAAGCAGGCATGGTGG - Intronic
955095446 3:55792819-55792841 CTATTCCCTGGAAGACATGGTGG - Intronic
956601951 3:71032145-71032167 CCATTCACAGGAAGGCATCGGGG - Intronic
958892189 3:99794931-99794953 CCAATCCCTGGAAGGCCTGGGGG - Exonic
960816059 3:121674006-121674028 GCAATCCCAGTCAGCCATGGTGG - Intronic
961379788 3:126489414-126489436 TCTTTACCAGGAAGCCATGGTGG - Intronic
961390568 3:126550243-126550265 GATGTCCCAGGAAGCCATGGGGG + Intronic
966402575 3:179562804-179562826 CCAATCGAAGGCAGCCATGGGGG - Intergenic
967588766 3:191246831-191246853 CCATTCAAAGCCAGCCATGGCGG + Intronic
968226947 3:196978726-196978748 CTATTCCCAGCACGTCATGGAGG + Intergenic
969095915 4:4732700-4732722 CCATTCCCATGGGGGCATGGTGG + Intergenic
969351089 4:6598323-6598345 CCAGCCCCAGGCACCCATGGCGG + Exonic
969878956 4:10157286-10157308 CTTTTCCCAGGAAGCCAGGCTGG - Intergenic
970738069 4:19197876-19197898 CCATTCCTTGGAATCCATGAGGG - Intergenic
972789117 4:42353840-42353862 CCATGCACAGGAAACCCTGGAGG - Intergenic
976948583 4:90799931-90799953 CCATTCCCTGGGAGCCACTGGGG + Intronic
979805943 4:124971267-124971289 ACGTCCCAAGGAAGCCATGGGGG - Intergenic
982239604 4:153285608-153285630 CAATTCCCAGCTAGGCATGGTGG - Intronic
982799657 4:159688413-159688435 CAACTTCCAGGAAGCCAGGGTGG + Intergenic
989702844 5:44291080-44291102 GTAATCCCAGGAAGCCAAGGAGG - Intergenic
991983594 5:72259180-72259202 CGATTCCCAGCTAGGCATGGTGG + Intronic
995132112 5:108641851-108641873 CAGTGCCCTGGAAGCCATGGGGG - Intergenic
996921394 5:128771702-128771724 CCATGCCCAGGAAACCTTTGTGG + Intronic
997654542 5:135545411-135545433 CCATCCCCAGGCAGCCACAGGGG - Intergenic
998054438 5:139062417-139062439 CCCTTGCCTGGAAGCCATGCTGG - Intronic
999877040 5:155818806-155818828 CCATTCCCAGCCAAGCATGGCGG - Intergenic
1002574252 5:180162475-180162497 CCTTTCACAGGCAGCCATGTGGG + Intronic
1004553110 6:16668885-16668907 CCTTACCCAGGAGGCCAAGGTGG - Intronic
1005281901 6:24283496-24283518 CAATTCCTAGAAAGCCATGTAGG + Intronic
1005812078 6:29525077-29525099 CCAAACCCAGGCTGCCATGGTGG + Intergenic
1006167377 6:32073101-32073123 CTGTGCCCAGGAAGCCATGAGGG + Intronic
1006396124 6:33788769-33788791 CCCTACCCAGGAAGCCGCGGAGG + Exonic
1006478690 6:34274380-34274402 CCATTGACAGGAAGCATTGGAGG + Intergenic
1007606437 6:43121259-43121281 CCACTCCCAGGAGGCCCTGGAGG - Intronic
1009558324 6:65203694-65203716 CCATTGCTAGGAAGCCAGGATGG - Intronic
1015275913 6:131383316-131383338 CCATTCTCAGGAAGGCACAGAGG - Intergenic
1019102138 6:169640138-169640160 CCATTCCCTGTGAGCTATGGAGG - Intronic
1019999701 7:4748672-4748694 CCTTTCCCAGGAAGCGACTGGGG - Intronic
1022467355 7:30660762-30660784 CCCTTCCCAGAAAGCCTTGGTGG + Intronic
1022470129 7:30676941-30676963 CCATTCCCAGTAGGACATTGCGG + Intronic
1024500900 7:50104609-50104631 CCATTCCCACAATACCATGGGGG + Intronic
1026223927 7:68424334-68424356 CCTTTCCCTGCAAGCCACGGGGG - Intergenic
1026742916 7:72990258-72990280 CCAATTCCAGGAGGCCAAGGCGG + Intergenic
1027100819 7:75374820-75374842 CCAATTCCAGGAGGCCAAGGCGG - Intergenic
1029710282 7:102295467-102295489 ACCTTCCCTGGAGGCCATGGTGG + Intronic
1030326982 7:108230133-108230155 CCATTCCCAGAAACCCATGGCGG - Intronic
1036149365 8:6283622-6283644 GCATTGCCAGGAAGGAATGGAGG - Intergenic
1036645817 8:10611085-10611107 CCATTCTCTGGAAGGCCTGGGGG - Exonic
1038879089 8:31587871-31587893 CCACTCCCAGGAAGCCAAACTGG + Intergenic
1041051458 8:53938942-53938964 TTATTCCCAGGAAGCCAGGCAGG - Intronic
1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG + Intergenic
1042051330 8:64711403-64711425 CCCTTCCCAGGAAGCAGCGGTGG - Intronic
1043871482 8:85438502-85438524 CCATCCCCAAGAATGCATGGAGG + Intronic
1044197619 8:89396424-89396446 CCATTTCCAGGATTCCATGCTGG + Intergenic
1045757001 8:105555867-105555889 CCATTCTCAGAAAGTTATGGGGG + Intronic
1046764694 8:118056940-118056962 CCATTACCAAAAAGCCATGGAGG + Intronic
1048323898 8:133424176-133424198 CCCTTTCCAGGAAGGCATGTTGG - Intergenic
1048500952 8:134974604-134974626 CCATTCCCAGGATGGCACAGAGG + Intergenic
1048929189 8:139297323-139297345 CCCTGGCCTGGAAGCCATGGTGG + Intergenic
1049093478 8:140534325-140534347 ACATGCCCAGGAGGCCCTGGTGG + Intronic
1049795861 8:144497007-144497029 CCAGGCCCAGGCAGCCCTGGGGG - Exonic
1051374078 9:16386618-16386640 CCATTCCCGGTAGACCATGGAGG - Intergenic
1051455156 9:17247190-17247212 CAATTCCCAGGCAGTCTTGGTGG - Intronic
1051932650 9:22405903-22405925 CCATTCCCAAGGAGCCATTTAGG - Intergenic
1053113545 9:35482368-35482390 CTATTCCCAGAAAGGCAAGGAGG + Intergenic
1053144975 9:35706081-35706103 TCACACCCAGGAAGCCCTGGAGG - Exonic
1054809286 9:69422082-69422104 CCAGACCCAGGAGGCCCTGGAGG - Intergenic
1054825436 9:69568164-69568186 ACATTCTCAGGAAGCCCTTGTGG - Intronic
1056563171 9:87750763-87750785 CCTCTCCCAGGGAACCATGGAGG - Intergenic
1060415691 9:123428218-123428240 TCATCCCCAGGAAGCAAGGGTGG + Intronic
1061951676 9:133939801-133939823 CCACCCCCAAGAAGCCACGGAGG + Intronic
1062552901 9:137098245-137098267 CCAGTCCCAGGCAGCTCTGGGGG + Intronic
1189609328 X:42715066-42715088 CCATTCCCTGGAACTCATTGTGG - Intergenic
1190742776 X:53301205-53301227 GCTTTCCCAGCAAGCCCTGGTGG - Intronic
1190784354 X:53629715-53629737 CCATTCCCAACCAGCAATGGAGG + Intronic
1192147347 X:68690416-68690438 CCATTCCCAGGCAGGCAGGGCGG + Intronic
1195798226 X:108677520-108677542 CCATTTCCAGGGAGACCTGGAGG - Exonic
1197913034 X:131505587-131505609 TCATTCCCAGAAAGCAATGATGG - Intergenic
1197939913 X:131778798-131778820 TCCTTCCCAGGAAGCTATGGGGG + Intergenic
1198022313 X:132671094-132671116 CCTTTGCCAGGAAGTCATCGAGG - Intronic
1200077146 X:153556834-153556856 CCCTGCCCAGGGAGCTATGGGGG - Intronic
1200095313 X:153656751-153656773 CCATGCCCAGCAAGCCAGGAGGG - Intergenic