ID: 1085229298

View in Genome Browser
Species Human (GRCh38)
Location 11:74950834-74950856
Sequence TGAGTGTGAGGCCAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 354}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085229298_1085229303 8 Left 1085229298 11:74950834-74950856 CCATGCACCTGGCCTCACACTCA 0: 1
1: 0
2: 5
3: 53
4: 354
Right 1085229303 11:74950865-74950887 GATACAGAAACATATTCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 238
1085229298_1085229305 13 Left 1085229298 11:74950834-74950856 CCATGCACCTGGCCTCACACTCA 0: 1
1: 0
2: 5
3: 53
4: 354
Right 1085229305 11:74950870-74950892 AGAAACATATTCTGGAGGTTGGG 0: 1
1: 0
2: 3
3: 26
4: 269
1085229298_1085229306 17 Left 1085229298 11:74950834-74950856 CCATGCACCTGGCCTCACACTCA 0: 1
1: 0
2: 5
3: 53
4: 354
Right 1085229306 11:74950874-74950896 ACATATTCTGGAGGTTGGGATGG 0: 1
1: 0
2: 0
3: 21
4: 301
1085229298_1085229302 5 Left 1085229298 11:74950834-74950856 CCATGCACCTGGCCTCACACTCA 0: 1
1: 0
2: 5
3: 53
4: 354
Right 1085229302 11:74950862-74950884 TAAGATACAGAAACATATTCTGG 0: 1
1: 0
2: 2
3: 35
4: 407
1085229298_1085229304 12 Left 1085229298 11:74950834-74950856 CCATGCACCTGGCCTCACACTCA 0: 1
1: 0
2: 5
3: 53
4: 354
Right 1085229304 11:74950869-74950891 CAGAAACATATTCTGGAGGTTGG 0: 1
1: 0
2: 2
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085229298 Original CRISPR TGAGTGTGAGGCCAGGTGCA TGG (reversed) Intronic
900200152 1:1401017-1401039 GCAGTGTCTGGCCAGGTGCACGG - Exonic
900651911 1:3734002-3734024 TGAGTGAGAAGCCAGGTGGGCGG + Exonic
901095161 1:6672949-6672971 TGACTGAGCGGCCAGGTGCAGGG + Intronic
901380939 1:8873707-8873729 TGAGGGGGAGGGGAGGTGCAAGG + Intronic
901924155 1:12555343-12555365 CAAGAATGAGGCCAGGTGCAGGG - Intergenic
901974298 1:12932222-12932244 TTGGTGTGAGGCCAGGGGAAGGG - Intronic
902010877 1:13269546-13269568 TTGGTGTGAGGCCAGGGGAAGGG + Intergenic
903469150 1:23573197-23573219 TGAATCTGGGGCCAGGAGCAAGG + Intergenic
903564326 1:24253357-24253379 TGAGTATAAGGCCTGGTACAGGG - Intergenic
903765525 1:25731911-25731933 CTAGTGTGATGCCAGGTGCATGG - Intronic
904440748 1:30527933-30527955 GGAGTGCCAGGCCATGTGCAGGG + Intergenic
904581026 1:31544459-31544481 TGAGGGTCAGGCCAGGATCAGGG - Intergenic
904997722 1:34643953-34643975 TGAGTTTGAGACGAGGTGCTGGG - Intergenic
905246775 1:36620394-36620416 TAAATGGGAGGCCAGGTGCATGG + Intergenic
905455871 1:38087508-38087530 TGTGTCTGAGGCCAGGTTCGGGG - Intergenic
905650659 1:39654537-39654559 TGAGTGAGAGGGCAGGAGCAGGG - Intergenic
906479690 1:46192074-46192096 TGAGTGGGAGGCAGGGAGCAGGG - Intronic
907217402 1:52876626-52876648 TGAGAGCAAGGCCAGGAGCAGGG - Intronic
908341871 1:63189633-63189655 TTAATGTCAGGCAAGGTGCAAGG - Intergenic
908649181 1:66313464-66313486 TGAGACTGAGGCCAGGAGAAGGG - Intronic
909540710 1:76788251-76788273 TGAAGGTAAGGCCAGGCGCAGGG + Intergenic
910925971 1:92398593-92398615 TGAGGGTGGGGCAAGGAGCAGGG + Exonic
912709067 1:111936971-111936993 AGACTGGGAGGCCAGTTGCAAGG + Intronic
912801643 1:112723167-112723189 TGAGTGAGAGGCCAGGACCCGGG + Intronic
912982241 1:114386047-114386069 TGACTATGAGGCCAGGTGTGGGG - Intergenic
914040572 1:144045902-144045924 TGAGGTTGAGGACAAGTGCATGG + Intergenic
914137515 1:144914577-144914599 TGAGGTTGAGGACAAGTGCATGG - Intronic
915092964 1:153439371-153439393 TGAGTCTGAGGCCAAGGCCAGGG + Intronic
916273799 1:162971951-162971973 TCAGTGTGAGGCCAACAGCATGG - Intergenic
918636956 1:186787860-186787882 TCAGTGACAGGCCAGGTGCGTGG - Intergenic
920487440 1:206384169-206384191 TGAGGTTGAGGACAAGTGCATGG + Intronic
920961100 1:210664785-210664807 TGAGGGAGAGGCCAGGACCATGG + Intronic
920963265 1:210682465-210682487 TGTGTGTGAGGCCAGCAGCATGG + Exonic
922433681 1:225582038-225582060 TGGGGGTGGGGCCTGGTGCAAGG + Intronic
923228976 1:231965780-231965802 TGAGTGTGAGCACAGGGGCTAGG - Intronic
924239904 1:242030844-242030866 TGAAGGTAAGGCCAGGGGCATGG + Intergenic
924733419 1:246732761-246732783 TTAGTGTGGGGCCAGGCACATGG - Intronic
1062923342 10:1296515-1296537 TGAGGGACAGGCCTGGTGCATGG + Intronic
1062996865 10:1874311-1874333 TGAGTGTAGGGCCAGGTGCGGGG + Intergenic
1063570894 10:7213676-7213698 TGAGTGTGAGGCCATGGGTGTGG + Intronic
1064133027 10:12726995-12727017 TGGGTGTGGGGCCACGGGCATGG - Intronic
1064450656 10:15439420-15439442 TGACTTTGAGGCCAGCAGCAGGG + Intergenic
1066349406 10:34623690-34623712 TCAGTGCAGGGCCAGGTGCAGGG + Intronic
1067380909 10:45772470-45772492 TGATTGGGAGGCCAAGTGGAAGG + Intronic
1067888609 10:50113122-50113144 TGATTGGGAGGCCAAGTGGAAGG + Intronic
1068888878 10:62127535-62127557 TGAATGTGATGCCAGCTGCCTGG - Intergenic
1069840617 10:71337183-71337205 TGGGTGTGTGGCCAAGGGCAGGG - Intronic
1070246615 10:74738356-74738378 TGAGTTTGAGGCCAGAATCAAGG + Intergenic
1070509401 10:77146869-77146891 AGAGAGAGAGGCCAAGTGCAGGG - Intronic
1071440559 10:85688690-85688712 TGAATGAGTGGCCAGGTGGATGG + Intronic
1072210993 10:93246940-93246962 TCTGTGGGAGGCCATGTGCAAGG + Intergenic
1072717239 10:97760179-97760201 GGAGTGGGAGGCCAGGTGAGTGG + Exonic
1073253873 10:102138767-102138789 TGAGTGTGGGACCAGGGGAAGGG + Intronic
1073582676 10:104682302-104682324 TGAATATGAGGCCAGGTCCTGGG + Intronic
1073809766 10:107139828-107139850 TTAGTGTTTGGCCAGGTGCATGG - Intronic
1074437918 10:113450135-113450157 TGAGAATTAGGCAAGGTGCAAGG + Intergenic
1074587458 10:114782210-114782232 TTAGCATGAGGCCTGGTGCAGGG - Intergenic
1074833354 10:117265332-117265354 TGAGTGTGTGGCCAGCTGCTGGG + Intronic
1074900886 10:117815668-117815690 TGAAGATGGGGCCAGGTGCAAGG + Intergenic
1074961493 10:118449774-118449796 TGAGTGTGATGGGAGGTGAATGG - Intergenic
1075209621 10:120480083-120480105 TGAGTGTCTGGACAGCTGCAGGG + Intronic
1076013921 10:127012780-127012802 TGAGTGTGAGGCGGAGTGTAGGG - Intronic
1076136732 10:128050270-128050292 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076136763 10:128050399-128050421 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076136777 10:128050454-128050476 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076697277 10:132253008-132253030 TGATTGTGGGGCCTGGTTCAGGG - Intronic
1076700765 10:132271490-132271512 TCTGTGTGAGGCCAGGTGTGGGG - Intronic
1076797603 10:132805777-132805799 TGAGTGTGTGGCCTGGGGCTTGG + Intergenic
1076867345 10:133174593-133174615 TGAGTGGATGGCCAGGTGGATGG + Intronic
1077392677 11:2307313-2307335 TCAGGGTGATGCCAGGAGCATGG - Intronic
1078470147 11:11579995-11580017 TGAGAGGAAGGCCAGGTGGAGGG + Intronic
1078516649 11:12028323-12028345 GGAGGGTGAGGCAAGGTCCAGGG - Intergenic
1079135717 11:17775079-17775101 TGAGGGGGAGGCCAGGGGCAAGG + Intronic
1079277638 11:19056575-19056597 TGAGTTTGAATCCAGGTGCTAGG - Intronic
1083262310 11:61529920-61529942 TGAGTGTGAGGCCGGGTGTGTGG - Intronic
1084433909 11:69127011-69127033 GGAGGGTGAGGCCAGGTGGGTGG + Intergenic
1085229298 11:74950834-74950856 TGAGTGTGAGGCCAGGTGCATGG - Intronic
1085857958 11:80197215-80197237 TCAGTTTGAGGACAGGTGAAAGG - Intergenic
1088811955 11:113398089-113398111 TGAGGGGGAGGCCAGGGGGATGG - Intronic
1088813425 11:113406397-113406419 TGCGTGTGAGGCCAGGGAGAGGG - Intergenic
1088848874 11:113689741-113689763 TGAGTGTGGGGGCAGGAGTAGGG - Intronic
1089027540 11:115287444-115287466 TGCCTGTGAGGCCAGGAGCGTGG - Intronic
1089080981 11:115776030-115776052 AGAGTGTGAGGCCTGCGGCAGGG - Intergenic
1089397836 11:118147421-118147443 TGGGTGTGTGGCCATGAGCAAGG - Intronic
1090161342 11:124498792-124498814 TGAGTGTGACTCCTGGTGGATGG + Intergenic
1090401351 11:126450662-126450684 TGTGTGTGTGTCCATGTGCATGG + Intronic
1090845742 11:130528419-130528441 TGGGTTTGAGGCCAGGGGAATGG + Intergenic
1091650278 12:2304235-2304257 TGTGTGTGAGGCGAGGTGGAGGG + Intronic
1093090897 12:14919074-14919096 TGCGTGGCAGGTCAGGTGCATGG + Intronic
1093929311 12:24938666-24938688 TGAGTCTGAGCCCAGGAGTATGG + Intronic
1094317526 12:29149546-29149568 TGGGTGTGAGGCCGGGTGGGAGG + Intronic
1095711584 12:45294467-45294489 TGAGAAGGGGGCCAGGTGCAGGG + Intronic
1095894350 12:47265514-47265536 TGAAAGTTAAGCCAGGTGCAGGG - Intergenic
1096621596 12:52869010-52869032 TGATTGAGAGGGCAGGCGCATGG + Intergenic
1101118678 12:101556396-101556418 TGAGGGACAGGCCAGGTGGATGG - Intergenic
1101384933 12:104248573-104248595 TGTGTGTGTGGCCAGGCGCGTGG - Intronic
1101949630 12:109164568-109164590 TGAATGTGAGGGCAGGAGAAAGG + Intronic
1102146925 12:110661223-110661245 TGGGTGCGGGGCCAGGGGCAGGG + Exonic
1102792808 12:115661524-115661546 AGAGTGTGATGCCAGATGCATGG + Intergenic
1103308785 12:119988830-119988852 TGAGAGCGAGGCCGGGTGCGAGG + Intergenic
1103738164 12:123073791-123073813 TGAGTGGTAGGGCAGATGCAGGG + Intronic
1104746092 12:131211339-131211361 TGAGTGTGAGTCCAGGTAGAAGG - Intergenic
1104841139 12:131826544-131826566 TGATCGTGGGGCCAGGGGCAGGG - Intergenic
1104914378 12:132257354-132257376 TGAGTGTCGGGCCGGGTGCTGGG - Intronic
1105785169 13:23740988-23741010 TGTGTATGTGGCCAGGTGGATGG + Intronic
1106351066 13:28931101-28931123 TGAGCGTGAGGCCAGGGCCAGGG - Intronic
1107706452 13:43111717-43111739 TGACTGTTGGGCGAGGTGCAGGG - Exonic
1109333750 13:60965662-60965684 TGATTGTGAGGACAGTTTCATGG + Intergenic
1111726819 13:92021454-92021476 TGATGGCCAGGCCAGGTGCAGGG + Intronic
1111963113 13:94833357-94833379 TGGGTGTGAGGGAAGGTGCCAGG - Intergenic
1112340181 13:98546569-98546591 TGACTGCGAGACCAGGTGGAAGG - Intronic
1112508891 13:99991341-99991363 AGAGGTTGAGGCCAGGTTCAGGG - Intergenic
1116763833 14:49047118-49047140 GGAGTTTAAGGCCATGTGCAAGG - Intergenic
1118774565 14:68965648-68965670 TGAGTGGGAGGCCAGGTGCCTGG - Intronic
1119595329 14:75927721-75927743 AGAGAGTGAGGCCAGGCCCAGGG - Intronic
1119801377 14:77448246-77448268 AGAGTGAGAGGCCAGGGCCAGGG - Intronic
1121714203 14:96061126-96061148 TGAGAATGAGGCCCAGTGCATGG - Intronic
1121786089 14:96662197-96662219 TGAGTGTGTGGCCTTGAGCAGGG + Intergenic
1122088238 14:99321562-99321584 TTAGTGTGAGTACATGTGCATGG - Intergenic
1122113768 14:99517827-99517849 TGGCTGGGAAGCCAGGTGCAGGG + Intronic
1122319554 14:100845577-100845599 TGAGGGTGGGGCCAGCTGCCCGG + Intergenic
1122670711 14:103369545-103369567 TGAGAAAAAGGCCAGGTGCAGGG - Intergenic
1124586290 15:31011950-31011972 TTGGTGTTAGGCCAGATGCAAGG - Intronic
1124688401 15:31801244-31801266 CAACTGGGAGGCCAGGTGCAAGG + Intronic
1124812529 15:32955290-32955312 TGCCTGTGAGGGCATGTGCAGGG + Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1125977707 15:43970209-43970231 TGAGTGTCAGGCCAGCAGCCTGG - Intronic
1128368953 15:67025177-67025199 TGGGTGTCAGGCCTGGTGCCAGG + Intergenic
1128557235 15:68640085-68640107 TCACTGTGAGGTCAGATGCATGG - Intronic
1128745183 15:70109292-70109314 TCAGTCAGAGGCCAGGTGCTGGG - Intergenic
1129168001 15:73789959-73789981 TCAGTGTGAGGCCAGGGTCAAGG + Intergenic
1129193385 15:73950722-73950744 TTAGTGTGTGGCCAGGGTCAGGG + Intronic
1129232187 15:74202977-74202999 TGTGTGTGAAGTCAGGTGCGGGG - Intronic
1129248913 15:74297403-74297425 GGAAAGAGAGGCCAGGTGCATGG + Intronic
1129560524 15:76561853-76561875 TGAGGCAGAGGCCAGGTGCGGGG + Intronic
1129686136 15:77687067-77687089 TCAGTGTGGGGCCAGGATCAGGG + Intronic
1130076045 15:80691286-80691308 AGAATGAGAGGCCAGGTGCAGGG - Intronic
1130903914 15:88226693-88226715 TGAGTGTGGGCCCAGGGGCAGGG - Intronic
1130963969 15:88683676-88683698 TGAGTCTGTGGCTAGGTCCATGG - Intergenic
1132552061 16:557602-557624 CCAGTGTCAGGACAGGTGCAGGG - Intergenic
1132956014 16:2594018-2594040 TGTGTGTGAGGCCAGGCCCTGGG + Intronic
1133330733 16:4971789-4971811 TGAGTGAATGGCCAGGTGCCAGG - Intronic
1134393294 16:13839642-13839664 TGAGTGCCAGGCCAGGTGCTGGG + Intergenic
1134846987 16:17448669-17448691 TGAGGGTGAGGGGAGGTGGAGGG + Intronic
1135635616 16:24072867-24072889 AGAGAGTTAGGCCAGGTGCGTGG - Intronic
1136283869 16:29230183-29230205 AGAGCCTCAGGCCAGGTGCAGGG + Intergenic
1136695196 16:32073758-32073780 TGAGGGTGGGGCCTGGTGAAAGG + Intergenic
1136795696 16:33017017-33017039 TGAGGGTGGGGCCTGGTGAAAGG + Intergenic
1136874225 16:33837364-33837386 TGAGGGTGGGGCCTGGTGAAAGG - Intergenic
1138389333 16:56658742-56658764 TGAGTGTGAGGCCATCTCCATGG + Intronic
1139323504 16:66134224-66134246 TGAGTGAGATGCCCAGTGCATGG + Intergenic
1139531191 16:67543489-67543511 TGGGTGTGAGGCTAGGTGAGAGG + Intronic
1139801102 16:69523640-69523662 AGAGTCTGAGGCAAGGTGCCTGG + Intergenic
1140043355 16:71424158-71424180 GGTGTGTGAGGCTGGGTGCATGG - Intergenic
1140504083 16:75459444-75459466 TGAGAGTGGGGCCAGCTGGAAGG - Intronic
1140761264 16:78111099-78111121 TGAGTGTGAGTCCACTTGCATGG + Intronic
1141338896 16:83184457-83184479 TAGATGTGAGGCCAGGGGCAGGG + Intronic
1141420580 16:83912765-83912787 TGAGAGTGTGGGCAGGGGCAGGG - Intronic
1142018126 16:87762920-87762942 GGAGAGTGAGGCCAGGTGGGAGG - Intronic
1142088902 16:88199693-88199715 AGAGCCTCAGGCCAGGTGCAGGG + Intergenic
1203097953 16_KI270728v1_random:1278675-1278697 TGAGGGTGGGGCCTGGTGAAAGG + Intergenic
1142603645 17:1069943-1069965 AGTGTGTGAGTCCAGGGGCACGG - Intronic
1142640255 17:1281302-1281324 TCAGAGTGAGGTCAGGGGCAGGG + Intronic
1142781615 17:2185696-2185718 TGAGGGTGAGGGCAGAGGCATGG + Intronic
1142869183 17:2809415-2809437 TGAGTGTGAGGGTATGGGCAAGG + Intronic
1144392743 17:14811098-14811120 TTAGTGGGAGGCCTGGAGCATGG + Intergenic
1144723456 17:17488204-17488226 GGAGTGTGAGGCACAGTGCATGG + Intronic
1144889681 17:18487516-18487538 TCAGTGTGGGGCCAGTTACAGGG - Intronic
1145142530 17:20456780-20456802 TCAGTGTGGGGCCAGTTACAGGG + Intronic
1147979261 17:44264794-44264816 GGAATGTGAGGGCAGGTCCAAGG + Intronic
1148026161 17:44589196-44589218 TGGGTGAGTGGCCAGGTGCAGGG - Intergenic
1148511775 17:48177101-48177123 TGACTACGAGGCCAGGTGCTGGG - Intronic
1149511260 17:57243648-57243670 AGTGTGTGAGGCCGGGTGCGCGG + Intergenic
1149655597 17:58308235-58308257 TGACTGTGATGCCATGTCCAGGG - Intronic
1151927993 17:77212956-77212978 AGAAAGTGAGGCCAGGTCCAGGG + Intronic
1152139160 17:78526119-78526141 TGAGTGGGCTGCCAGGTCCAGGG + Intronic
1152269815 17:79317597-79317619 TGAGTTTGAGACCACGTCCAGGG - Intronic
1152555823 17:81052699-81052721 GGAGGCTGAGGCCAGGTGCTGGG + Intronic
1152767060 17:82147490-82147512 TGAGTGTGTGGGTAGGTGGATGG + Intronic
1152782578 17:82232763-82232785 TGAGCGGGAGGCCTGGGGCAGGG - Intronic
1154134345 18:11762516-11762538 TCAGTGTGACGCCAGCTGCATGG - Intronic
1155347268 18:24870337-24870359 TGACAGTGAGGCCAGATGCTGGG + Intergenic
1156540051 18:37900667-37900689 TGAGTGTGAGGCAGGGCACAAGG + Intergenic
1157563939 18:48667298-48667320 AAAGTGTGATGCCTGGTGCAGGG + Intronic
1157599418 18:48885047-48885069 AGAGTGTGTGGCCTGGGGCAGGG + Intergenic
1157765767 18:50296129-50296151 TGACTGGGAGGCCAGGTGCATGG - Intergenic
1158319884 18:56250977-56250999 TGAGTGTGAGGCACTGTGCAGGG + Intergenic
1159547923 18:69863936-69863958 TGAGAGTGAGGCCAAGACCAGGG + Exonic
1159553082 18:69917300-69917322 TGAGAATGAGCCCAGGGGCAAGG - Intronic
1160971827 19:1772149-1772171 TGAGTGTGGTGGCAGGTGCTTGG - Intronic
1161704924 19:5815157-5815179 TGTGTGTGTGGCCAGGAGGAGGG + Intergenic
1162256501 19:9494444-9494466 TGGGAGGGAGGCCAGGTGCAGGG + Intronic
1162716545 19:12638050-12638072 TGAGTTGGAGGCCAGGAGCAAGG + Intronic
1162788839 19:13052776-13052798 TGTGTGTGTGGACGGGTGCAGGG - Intronic
1163172815 19:15544281-15544303 TGAGTGTGGGGTCAGGGGAATGG + Intronic
1163753392 19:19092095-19092117 TGAGGATGAGGCCTGGAGCACGG - Intronic
1164530635 19:29045831-29045853 TGACTGTGAGCTCAGATGCAGGG + Intergenic
1166417547 19:42607080-42607102 TGAGTGTGCGGCCCCGTGCACGG - Intronic
1166668998 19:44698590-44698612 TGCGGGTGAGGCCAGGTGAGAGG - Intergenic
1166670739 19:44708189-44708211 TGAGTGTGTGGGAAGGGGCAAGG + Intronic
1167227107 19:48253183-48253205 TGTGTGAGAGTACAGGTGCAGGG + Intronic
1167569130 19:50276084-50276106 TGAGCGTGTGGCCAGGACCAAGG + Exonic
1167634254 19:50644840-50644862 TGAGTGGATGGCTAGGTGCAGGG + Intronic
1167654173 19:50752736-50752758 TGAGGGTGAGGCAAGGTGAGGGG - Intergenic
1168584496 19:57582134-57582156 TGAGGGTGAGGGCAGGTGTTAGG + Intronic
925504275 2:4543509-4543531 TGACTGTGAGGCCTGGTGGGAGG - Intergenic
926424192 2:12726444-12726466 AGAGTGTGAGGCCAAGTGTCAGG + Intronic
927460638 2:23295523-23295545 GGAGAGAGAGGCCAGGTGTATGG - Intergenic
927689833 2:25200731-25200753 TGCTTTTGAGGCCAGGTGCGTGG + Intergenic
928027410 2:27751582-27751604 TGAGTGTGAAGGCAGGTGACAGG - Intergenic
928228638 2:29476950-29476972 TGAGGGTGAGGCGAGGTGCATGG - Intronic
928383886 2:30847350-30847372 TGAGTGCCAGGTCAGCTGCAGGG + Intergenic
932440591 2:71732176-71732198 TGAGTACAAGGCTAGGTGCATGG + Intergenic
932478316 2:72022984-72023006 TGCGTGTGAGGCCTGGTGCTGGG - Intergenic
932481583 2:72042627-72042649 TCAGTCTGAGGCCAGGTTTAGGG - Intergenic
932487700 2:72094482-72094504 TAGGGGTGAGGCCTGGTGCAGGG - Intergenic
932803259 2:74761657-74761679 TCATTGTGAGGTCAGGAGCAGGG - Intergenic
933893314 2:86789980-86790002 CGGGAGAGAGGCCAGGTGCAGGG - Intronic
933943265 2:87262915-87262937 TGTGTGCCAGGCCAGGTGCCAGG + Intergenic
935282631 2:101532437-101532459 AGAGTGTGATGCCATGTGGAAGG - Intergenic
936245134 2:110820028-110820050 TGAGTGTCAGGCACGGTGCAAGG - Intronic
936336949 2:111598646-111598668 TGTGTGCCAGGCCAGGTGCCAGG - Intergenic
940088756 2:149893230-149893252 TCATTGTCTGGCCAGGTGCATGG - Intergenic
943922219 2:193723406-193723428 TGATTGTGAAGCCGGGGGCATGG + Intergenic
944422219 2:199543751-199543773 TGCGTGTGAGGCTAGGGGCAGGG - Intergenic
945345843 2:208715046-208715068 TGATTATGATTCCAGGTGCATGG + Intronic
945859479 2:215104410-215104432 TGAGAGTCAGGCCAGGAGCTGGG + Intronic
946196449 2:218035225-218035247 GGAGTGTGATGCCAGGAGCCAGG + Intronic
946200731 2:218069389-218069411 GGAGTGTGATGCCAGGAGCCAGG + Exonic
947854038 2:233311293-233311315 TGGGTGAGACGCCAGGAGCAGGG - Intronic
948150316 2:235739652-235739674 TGAGTGTGAGCACACGAGCATGG + Intronic
948893525 2:240918044-240918066 TGAGTGTGAGCCCAGGTCCTGGG + Intergenic
1168854086 20:996842-996864 AGAGAGTGTGGCCAGGTGGAGGG - Intronic
1169662917 20:8000281-8000303 TGAGAGGGAGGCCAGGTTGAAGG - Intronic
1170620661 20:17993189-17993211 TGAGGAAGAGGCCAGGTGTAAGG - Intronic
1171053456 20:21883244-21883266 GGAGTGGGAGGGCTGGTGCATGG + Intergenic
1171393829 20:24818175-24818197 CGAGTGAGGGGCCAGGTGCAGGG - Intergenic
1172062774 20:32197664-32197686 TGAGTGGGTGGCCATGTGCCTGG + Exonic
1172123119 20:32610021-32610043 TGAGTGTCAGGCCCTGTGCTGGG - Intergenic
1172141926 20:32728851-32728873 AAAATATGAGGCCAGGTGCATGG - Intronic
1172312107 20:33926762-33926784 GAAGGGTGAGGCCAAGTGCATGG + Intergenic
1172620292 20:36314013-36314035 TGAGTGTGGCGGCAGGTGAAGGG + Intronic
1172632236 20:36386224-36386246 TTAGTGTGGGGCCAGGGTCAGGG + Intronic
1172632884 20:36390979-36391001 TTAGTCTGAGGCCAGGGTCACGG - Intronic
1174526339 20:51174913-51174935 TGGGTGTGAGGTCAGATGGAAGG + Intergenic
1175386726 20:58600807-58600829 TGACTGTGATGACAGGTGCATGG - Intergenic
1175585197 20:60133591-60133613 TGAGAGTGAGGTCAGGAGTAGGG - Intergenic
1175779292 20:61672106-61672128 TGAGTGTATGGGCAGGTGAAAGG + Intronic
1175932763 20:62500594-62500616 TGCGTGTGAGGGCGTGTGCAGGG + Intergenic
1176265549 20:64207490-64207512 TGAGTGGTAGGTCAGGTGGAGGG + Intronic
1176430470 21:6572306-6572328 TGTGTGTGAGTCCCTGTGCATGG + Intergenic
1176844835 21:13868733-13868755 TGAAAGTGGGGCCAGGTGGAAGG - Intergenic
1179345241 21:40550138-40550160 TGAGTGTCAGGCCTGGGGCTCGG - Intronic
1179705864 21:43179768-43179790 TGTGTGTGAGTCCCTGTGCATGG + Intergenic
1179914551 21:44467729-44467751 TGAGTGTGAGGACAGGAGACAGG - Intergenic
1180141901 21:45898155-45898177 TCTCTGTGAGGCCAGGTGCACGG + Intronic
1180911171 22:19451627-19451649 TTAGTGGGGAGCCAGGTGCAGGG - Intronic
1181278430 22:21702120-21702142 TGAGTGTGTGGCCTGGTGCTAGG + Intronic
1181392196 22:22591665-22591687 TGAATTTGAGGACAGGGGCAGGG - Intergenic
1181718033 22:24749361-24749383 TGAGTGTGTGTACATGTGCATGG - Intronic
1181848175 22:25730017-25730039 GGAGTGTGTAGCCAGGTCCATGG + Intergenic
1182039985 22:27230506-27230528 TGTGTCTGTGGCCAGCTGCAGGG + Intergenic
1182301626 22:29340332-29340354 TGACTGTGATGCCAGGATCAGGG + Intronic
1182347143 22:29674275-29674297 GGCATGTGAGGCCTGGTGCAGGG - Intronic
1183110780 22:35646985-35647007 AGTGTGGGAGGCCAGGAGCAGGG + Intergenic
1183741239 22:39669716-39669738 TGAGTGGGAGGATAGGTGGATGG + Intronic
1184919613 22:47596498-47596520 TGGGAGTGAGGTCAGGTGCATGG - Intergenic
950127844 3:10521212-10521234 TTTGTGTGGGGGCAGGTGCAGGG - Intronic
950933228 3:16811786-16811808 GGAGTCAGAGGCCACGTGCATGG - Intronic
950963069 3:17125820-17125842 TGAGTGTGAGGCACAGAGCAGGG - Intergenic
951357906 3:21691394-21691416 TGAGGGTGAGGTTAGGGGCATGG - Intronic
951933949 3:28001328-28001350 TGATGTTTAGGCCAGGTGCAGGG + Intergenic
952264690 3:31774261-31774283 AGAGTGTGAGGTCAGGTGAGGGG + Intronic
952414275 3:33076248-33076270 TGCGTGTGAGGCCTGGGGGAGGG + Intronic
952750004 3:36817372-36817394 TGAGTGAGAGGACAGTTGCCAGG - Intergenic
952887066 3:38018440-38018462 CCAGTGTGAGCCAAGGTGCAGGG - Intronic
953075795 3:39569295-39569317 TGTGTGTGAGGCCCTGTGCCAGG + Intergenic
953519132 3:43624369-43624391 TGGGGGTGGGGCCTGGTGCAAGG + Intronic
954379275 3:50211042-50211064 TCACTGTGTGGCCAGGGGCAGGG - Intronic
954405510 3:50343008-50343030 TGAGAGAGAGGCTAGGGGCAGGG + Exonic
954835823 3:53467095-53467117 TTTGTGTGTGGCCAGGTGCAGGG + Intergenic
957798477 3:85043389-85043411 TGTCTGTTAGGCCGGGTGCAGGG + Intronic
958151500 3:89699411-89699433 TGCTTGTGAGGCCAGGTGCCCGG - Intergenic
959849997 3:111073662-111073684 TGAGTGAGAGGACAGTTGGAGGG + Intronic
960860479 3:122147763-122147785 TGAGTGTGGGGCCTGGTGCCAGG - Intergenic
961496401 3:127295206-127295228 TTAGGTTGAGGCCAGGTGCCTGG - Intergenic
961684209 3:128618141-128618163 CGTGCGTGAGGCCAGGTCCACGG + Intergenic
961747667 3:129075660-129075682 TGAAGGTGAGGCCTGGTGGAAGG - Intergenic
961863042 3:129933451-129933473 TGAGTGTGTGGACATGTGAATGG + Intergenic
962737385 3:138338073-138338095 TGAAGGTGAGGCCAGGTGAGAGG - Intergenic
962939669 3:140114370-140114392 TAAGGGTGATGCCAGATGCAGGG - Intronic
963192526 3:142488416-142488438 ATCGTGTGAGGTCAGGTGCAGGG - Intronic
963525315 3:146408876-146408898 TGGGTCTCAGGCCAGGTGGAGGG + Intronic
963810425 3:149771399-149771421 TTGGTGTGAGGACAGGTGAAAGG - Intronic
966028611 3:175317429-175317451 GGATTGTGAGGTCAGGTTCAGGG - Intronic
966571519 3:181449375-181449397 TCAGTGTGAGGCCAGGCGCAGGG + Intergenic
966906319 3:184528451-184528473 TATGAGTGAAGCCAGGTGCATGG + Intronic
967214303 3:187197553-187197575 GGAGAGTGAGGGTAGGTGCAGGG - Exonic
967633483 3:191774576-191774598 TAAGTGTGTGGCCAACTGCATGG - Intergenic
967714682 3:192748945-192748967 TGCGTTTGCAGCCAGGTGCAGGG + Intronic
967724876 3:192852184-192852206 TGAGTGTGAATCCTGGTGAAAGG - Intronic
968159190 3:196411224-196411246 AAAGTGTGATGCCAGGTGCTGGG - Intronic
968631935 4:1656349-1656371 GGAGAGCAAGGCCAGGTGCATGG + Intronic
968660311 4:1796039-1796061 TGAGTGGGAGCCCAGGGGCTTGG + Intronic
968708189 4:2093478-2093500 TGACTGTGTGGCCTTGTGCAAGG - Intronic
968920337 4:3519095-3519117 TGAGTGCCAGGCCAGGTTCTTGG + Intronic
968944123 4:3654701-3654723 AGAGTGTGGGGCGTGGTGCATGG + Intergenic
969538705 4:7772440-7772462 TGAGAGTTAAGCCAGGTGCTGGG - Intronic
969563012 4:7961328-7961350 TGCTTGTGAGCCCAGGGGCATGG - Intergenic
973769691 4:54195246-54195268 TAAGTGGGATGCCAGGTGAAGGG - Intronic
973836709 4:54817480-54817502 TCAGTATGAGGCCTGGTGCAGGG - Intergenic
976359035 4:84155911-84155933 TGGGAGTGAGGGCAGGTGCAAGG - Intergenic
981582706 4:146266411-146266433 TGTGTGTGTGTCCATGTGCATGG - Intronic
982580201 4:157167891-157167913 TGAGAGGGAGGGCAGGTGCTAGG + Intronic
983347964 4:166551109-166551131 TTAATGTGAGGCCATTTGCAAGG - Intergenic
983929606 4:173438975-173438997 TGAGACTGAGTCCTGGTGCATGG + Intergenic
985586887 5:745027-745049 TGTGTGTGAGGCTCTGTGCATGG - Intronic
985601462 5:837209-837231 TGTGTGTGAGGCTCTGTGCATGG - Intronic
985681126 5:1256502-1256524 AGTGGGTGAGGCCAGGTACATGG - Intronic
986290628 5:6396527-6396549 TGAGTGTGTGGCCCTGTGCGTGG + Intergenic
986573530 5:9189643-9189665 GGTGTGTGAGGCCAGCTGTAGGG - Intronic
986708418 5:10470425-10470447 GGAGTGTGAGGCCAGGTGGGTGG - Intronic
986842318 5:11711903-11711925 TGTGTGTGAGGCATGGTGCCTGG + Intronic
987355045 5:17056425-17056447 TGAGAATGAAGCCAGGTGCCGGG - Intergenic
987770020 5:22289939-22289961 TCAGTGTTAGGCCAGCTTCAGGG + Intronic
989292041 5:39779265-39779287 TGTTGGTGAGGCCAGGGGCAGGG - Intergenic
990597890 5:57329597-57329619 TGGATGTGAGGGCAGGGGCAGGG + Intergenic
991713549 5:69431081-69431103 TGAGGTTGAGGCCAGGTGCAGGG - Intronic
992034110 5:72754467-72754489 TGAGTGTGAGGCCAGGCTTATGG + Intergenic
992467355 5:77019922-77019944 TGTGTGCTAGGCCTGGTGCAAGG - Intergenic
994324591 5:98434996-98435018 TGAGGGTGAGGACAGGGGAACGG - Intergenic
994717155 5:103335597-103335619 GGACTCTGAGGCCAGGTGGAGGG + Intergenic
997709443 5:135991284-135991306 TTAGTGCCAGTCCAGGTGCAAGG + Intergenic
997781416 5:136662618-136662640 TGAGTGGGAGGCCATGTTAATGG + Intergenic
998080992 5:139274647-139274669 TGACTGTGAGGCCGGGCGCGTGG + Intronic
998113201 5:139517819-139517841 GGAGTGTGAGGACAGGTGGAAGG + Intergenic
998397438 5:141827728-141827750 TGAGTGTGAGGGAAGCAGCAGGG - Intergenic
1000058286 5:157628916-157628938 TGAGTGTGAGCCACCGTGCACGG + Intronic
1000759931 5:165210150-165210172 TGAGTGTCAGAACAGGTGAAAGG - Intergenic
1000926863 5:167204621-167204643 TCACTGTGATGCCAGGGGCAGGG + Intergenic
1001557200 5:172644871-172644893 TGAGAGTGAGGGGAGGTGGAGGG + Intronic
1003039508 6:2674001-2674023 TGATGGTGAGGCAAGGGGCAGGG + Intronic
1003989775 6:11474215-11474237 TCAGTGTCAGGCTAGTTGCAAGG - Intergenic
1004683030 6:17915227-17915249 TGAGAGTCAGTCCAGGAGCAGGG + Intronic
1005066603 6:21824230-21824252 TGTGAGTGGGGCCAGGTGAAAGG + Intergenic
1006371064 6:33643733-33643755 TGTGTGTGGGGGCAGGTGCCAGG + Intronic
1006589981 6:35147795-35147817 TGTGTGTGTGGCCAAGTACATGG + Intronic
1007098959 6:39231472-39231494 TGGGTGAGAGGCCTGGTGCTGGG - Intergenic
1007180505 6:39926094-39926116 TCAGTGGGAGGCCAAGGGCATGG + Intronic
1007628486 6:43259708-43259730 TGGGTCTGGGGCCAGGGGCATGG + Intronic
1008536096 6:52507484-52507506 TGAGTGTGTGGACAGATGCATGG + Intronic
1008641024 6:53462951-53462973 TGGGCATGTGGCCAGGTGCAGGG - Intergenic
1008655242 6:53605540-53605562 AGGGTGTGAGGTTAGGTGCATGG + Intronic
1014786383 6:125624470-125624492 GAAGTGTGAGGCCAGGGTCAGGG - Intergenic
1017727774 6:157287584-157287606 TGTGTGTGAGACCAGGTCCTGGG - Intergenic
1017729532 6:157302928-157302950 TGGGTGTGAGTCCAGGTGAAAGG - Intronic
1017978196 6:159376018-159376040 TGAGCTTGGAGCCAGGTGCACGG - Intergenic
1018051505 6:160012913-160012935 TGTGTGTGGGGCCAGGCGCAGGG - Intronic
1018867116 6:167754855-167754877 TGAGTCGGAGGACAGGGGCAGGG + Intergenic
1018932740 6:168252541-168252563 TGAGTGTGAGACCAGAGGAAGGG - Intergenic
1019432956 7:1007807-1007829 TGAGGCTGAGGACAGGAGCAGGG + Intronic
1019545658 7:1574178-1574200 TGAGAGTGAGGCCACGCCCATGG - Intergenic
1020699036 7:11454409-11454431 TGAGTTAGAGGCAAGGGGCAAGG - Intronic
1023473598 7:40552433-40552455 GTAGGGTGAGCCCAGGTGCAGGG - Intronic
1024233568 7:47380928-47380950 CTAGTGGGAGGCCAGGTGCCTGG - Intronic
1024260192 7:47568569-47568591 TGTGTGTGAGGCCCTGTGCGGGG - Intronic
1027338229 7:77177122-77177144 TTAATTTTAGGCCAGGTGCAGGG - Intronic
1028810210 7:95077764-95077786 TGTGTGTGAGGCCAGTTGTGGGG + Intronic
1028931292 7:96415567-96415589 CAATTGTGAGGCAAGGTGCATGG + Intergenic
1029260188 7:99296919-99296941 TGAGTCTGAGGGCAGGTGGATGG + Intergenic
1029777498 7:102693671-102693693 TTAATTTTAGGCCAGGTGCAGGG + Intergenic
1032448030 7:132001382-132001404 TCTGAGTGAGGGCAGGTGCATGG + Intergenic
1034497364 7:151430930-151430952 TCAGTGGGGGGCCAGGTGCATGG - Intronic
1034897080 7:154883254-154883276 TGTGTGTGAGAGCAGGTGTATGG - Intronic
1035375781 7:158405784-158405806 TCAGTGTGCGGCCACATGCATGG - Intronic
1035689508 8:1550562-1550584 AGAGGCTGTGGCCAGGTGCAGGG - Intronic
1035909514 8:3550131-3550153 AGATTTTGAGGCCACGTGCATGG - Intronic
1036497919 8:9286201-9286223 TGAGAGTAAGGCCAGGTGTGGGG + Intergenic
1038016078 8:23516280-23516302 TAATTTTGAGGCCAGGCGCAAGG + Intergenic
1039377976 8:37056308-37056330 GGGGTATGAGGCCAGGTGCTGGG + Intergenic
1040610586 8:48978080-48978102 TGGGTGCAAGGCTAGGTGCAGGG - Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1040995344 8:53395623-53395645 TCAGTGAGAGGCAAGTTGCAAGG + Intergenic
1042120748 8:65485450-65485472 TTAGAGTTAGGCCAGGTGCATGG - Intergenic
1046447270 8:114339148-114339170 TGAGTTTGAGGCCAGGCACCTGG - Intergenic
1049362277 8:142217863-142217885 TCAGTGTGTGGCCAGGATCAGGG + Intronic
1049362299 8:142218007-142218029 TCAGTGTGTGGCCAGGATCAGGG + Intronic
1049372366 8:142273935-142273957 TGGGTGTGAGGCCAGGGTCCAGG - Intronic
1049428209 8:142546899-142546921 TCAGTGTGTGGCCAGGGTCAGGG + Intergenic
1049846200 8:144803023-144803045 TGGGTGTGAGGCAAGCTGTAAGG - Intronic
1051170555 9:14315313-14315335 TCAGAGCGAGGCCACGTGCACGG - Intronic
1052169560 9:25376978-25377000 TGAGTGTGTGGGTGGGTGCAGGG - Intergenic
1053281894 9:36825881-36825903 TGTGTGTGACCCCAGGTGGAGGG - Intergenic
1053498593 9:38566853-38566875 TGATTGTGAGGACAGTAGCAAGG + Intronic
1056854264 9:90111712-90111734 TTTGTTTGGGGCCAGGTGCAGGG + Intergenic
1057262464 9:93592814-93592836 GGACTGTGAGCCAAGGTGCAAGG - Intronic
1057678042 9:97151346-97151368 TGATTGTGAGGACAGCAGCAAGG + Intergenic
1059813662 9:117886493-117886515 TGAGTGTGGTGCCTGGTACAGGG + Intergenic
1059984877 9:119812169-119812191 GGAGTGTGAGGGCAGAGGCAGGG + Intergenic
1060051192 9:120379606-120379628 TGAGTCTGTGGCAAGGTGCAGGG - Intergenic
1060312515 9:122475188-122475210 AGAGGGCGAGGCCAGGGGCAGGG + Intergenic
1060659040 9:125392341-125392363 TGAGAGTGAGGCCTGGGGCCTGG - Intergenic
1061004575 9:127921308-127921330 AGAGTATCAGGCCAGGAGCAGGG + Exonic
1061083917 9:128388372-128388394 TGAGTGTGTGTGCATGTGCATGG - Intronic
1061842160 9:133365077-133365099 TGTCTGTGAGACCAGGTGCAGGG + Intronic
1062083455 9:134636637-134636659 TGAGAGTGGGGCCAGCTGGAGGG - Intergenic
1062600071 9:137315570-137315592 TGAGTGGGAGACCCGGTGCCGGG - Intronic
1191110528 X:56800300-56800322 TGAGTGTGAGCACAGGTGCCTGG - Intergenic
1191897730 X:66011422-66011444 TAAGTGTCAGGCATGGTGCAAGG - Intergenic
1192781349 X:74296475-74296497 TTAACGTTAGGCCAGGTGCAAGG - Intergenic
1198159140 X:133989704-133989726 TGCGTGTGTGGCCATGTGCACGG - Intergenic
1199085770 X:143629308-143629330 TGAATGTAATGGCAGGTGCAGGG + Exonic
1200812571 Y:7501067-7501089 TGAGAGTGAGGACAGGGGCCTGG - Intergenic