ID: 1085230310

View in Genome Browser
Species Human (GRCh38)
Location 11:74962056-74962078
Sequence ATCTGAAGGACATTGGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085230306_1085230310 30 Left 1085230306 11:74962003-74962025 CCTGTCATTTACTATTTGTATGG 0: 1
1: 1
2: 0
3: 24
4: 212
Right 1085230310 11:74962056-74962078 ATCTGAAGGACATTGGTTTCTGG 0: 1
1: 0
2: 3
3: 47
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085230310 Original CRISPR ATCTGAAGGACATTGGTTTC TGG Intronic
903185331 1:21625768-21625790 ATCTGTATCAGATTGGTTTCTGG + Intronic
906830649 1:49027831-49027853 ATTTGCAGGACAGAGGTTTCAGG + Intronic
906926065 1:50118182-50118204 ATCTGAAGTAAGTTGGTTTCTGG - Intronic
907378339 1:54063395-54063417 ATCTGTAGGGGATTGGTTCCAGG + Intronic
907790801 1:57661581-57661603 ATCTGCAGGGCACTGGTTCCAGG + Intronic
907799064 1:57746558-57746580 GTCTGCAGGAGATTGGTTCCAGG + Intronic
909327787 1:74373903-74373925 ATCTGCAGGGGATTGGTTCCAGG + Intronic
910463023 1:87468618-87468640 ATCTGAGGGGGACTGGTTTCAGG - Intergenic
910784215 1:90976781-90976803 ATCTGAAGGGGATTGGTTCCAGG + Intronic
912797769 1:112703181-112703203 GCCCGAAGGACAGTGGTTTCAGG - Intronic
914429478 1:147607764-147607786 AACTGAAGGAAAAAGGTTTCAGG + Intronic
916051912 1:161042314-161042336 CTCTGAAGGACTTTGTTTTGGGG - Intronic
916095563 1:161346766-161346788 ATCTGTTGGAGATTGGTTCCAGG + Intronic
916478840 1:165196710-165196732 ATCTGTAGGAGACTGGTTCCAGG + Intergenic
916898410 1:169192555-169192577 ATTTGAGGGAGATTGGTTCCAGG - Intronic
918030995 1:180810857-180810879 ATCTGTTGGAGATTGGTTCCAGG + Intronic
918315855 1:183322233-183322255 GTCTGAATTACATGGGTTTCTGG + Intronic
918525820 1:185463737-185463759 ATCTGCGGGAGATTGGTTCCGGG + Intergenic
919432687 1:197516549-197516571 CTCTGAAGCACAGTGCTTTCAGG + Intronic
919643558 1:200068729-200068751 AGCTGAAGCTCATTAGTTTCAGG + Intronic
919643921 1:200073384-200073406 ATCTGTGGGGGATTGGTTTCAGG + Intronic
921960183 1:221026158-221026180 ATCTCCTGGACCTTGGTTTCAGG + Intergenic
923180516 1:231513909-231513931 TACTGATGGACATTTGTTTCAGG + Intergenic
923266010 1:232314818-232314840 ATCATAAGGACAGTGGTTCCTGG + Intergenic
924004671 1:239595334-239595356 ATCTGCAGGAGATGGGTTCCAGG - Intronic
924152870 1:241146421-241146443 ATCTGCAGGGAATTGGTTCCAGG - Intronic
924316559 1:242803707-242803729 ATCTGATGGACTCTGGATTCTGG - Intergenic
1065218182 10:23470960-23470982 ATCTGAGAAACATTGCTTTCAGG - Intergenic
1065498200 10:26351414-26351436 ATCTGCAGGGAATTGGTTCCAGG + Intergenic
1066170290 10:32836199-32836221 TTTTGAATGACAGTGGTTTCAGG - Intronic
1067774884 10:49156064-49156086 AACTGAAGGCCAGTGGCTTCTGG + Intronic
1068619555 10:59165865-59165887 ATCCATAGGAAATTGGTTTCAGG + Intergenic
1070229691 10:74551813-74551835 ATCTTCAGGGGATTGGTTTCAGG + Intronic
1071030683 10:81176836-81176858 ATCAGCAGGGCATTGGTTTCAGG - Intergenic
1071820102 10:89271275-89271297 TTCTGAAGGACAGTGGTTATGGG + Intronic
1072041778 10:91613344-91613366 ATCTGGAGGACTTTGGCTCCTGG - Intergenic
1074654035 10:115561632-115561654 ATCTGCAGGAGATTGGTTCCAGG - Intronic
1074721172 10:116266552-116266574 ATCTCAAGGGCATTGGCTTTAGG - Intronic
1074923074 10:118037804-118037826 ATCTGAGAGAGATTGGTTCCAGG + Intronic
1078756783 11:14218565-14218587 ATCAGAGGGACATTTGTTCCTGG + Intronic
1078941199 11:16007984-16008006 ATCTGAAAGAGATTAGTTCCAGG + Intronic
1078961390 11:16276708-16276730 GTCTGAAGGTAAGTGGTTTCTGG - Intronic
1080020530 11:27555077-27555099 ATCTGTGGGGTATTGGTTTCAGG + Intergenic
1081441170 11:43082878-43082900 ATCTGTGGGAAATTGGTTCCAGG - Intergenic
1081704433 11:45172831-45172853 ATCTGAGGGGAATTGGTTCCAGG - Intronic
1083568007 11:63736797-63736819 ATCTGAATGAGATTCGTTCCAGG - Intronic
1085114453 11:73918153-73918175 ATGTGAAGGGGATTGTTTTCAGG + Intronic
1085230310 11:74962056-74962078 ATCTGAAGGACATTGGTTTCTGG + Intronic
1087227700 11:95621157-95621179 TTCTGAAGGACAGCGTTTTCAGG - Intergenic
1087253173 11:95926161-95926183 ATCTGCAGGTTATTGGTTTCAGG - Intergenic
1088163501 11:106902935-106902957 ATCTGTGGGAGATTGGTTCCAGG - Intronic
1088326784 11:108608985-108609007 TTCTCAAGGACAATGGTTGCTGG - Intergenic
1088609992 11:111567742-111567764 ATCTGCAGGATATTGGTTCCAGG - Intergenic
1089477954 11:118781028-118781050 ATCTGGAGGGAATTGGTTTCAGG - Intronic
1089532781 11:119142319-119142341 ATCTGTGGGAGATTGGTTCCAGG - Intergenic
1089656811 11:119953701-119953723 ATCTGCAGGGGATTGGTTCCAGG - Intergenic
1090137952 11:124219060-124219082 AACTAAAGGACATTCTTTTCAGG - Intergenic
1090498623 11:127239794-127239816 TTATGAAGGACACTGGTCTCTGG - Intergenic
1091013124 11:132024327-132024349 ATCTGAGGGGCACTGGTTCCAGG + Intronic
1091098022 11:132842125-132842147 ATCTGAAGGACCTTGATTGAGGG - Intronic
1091135743 11:133187391-133187413 CTCTGCAGTGCATTGGTTTCAGG + Intronic
1092240046 12:6830631-6830653 CTCTGCAGGACACTGGATTCAGG + Exonic
1093543358 12:20315512-20315534 ATCTGACACACATTTGTTTCAGG - Intergenic
1094466948 12:30763413-30763435 ATCTGAAGGTAAATGGTATCAGG - Intergenic
1096384411 12:51185440-51185462 ATCTGTCGGGGATTGGTTTCAGG + Intergenic
1096691974 12:53326991-53327013 AACAGGAGGACATTGGTTTGGGG - Exonic
1097935949 12:65251130-65251152 ATCTGCAGGGGATTGGTTCCAGG + Intergenic
1098548920 12:71741589-71741611 ATCCAAAGGAGATTGGTTCCAGG + Intergenic
1099612832 12:84896748-84896770 CTCTGAAGCACATTGTTTCCTGG - Intronic
1099715087 12:86281839-86281861 ATTTGAAGGACACTTATTTCTGG + Intronic
1100502898 12:95191622-95191644 ATCTGTGGGGGATTGGTTTCAGG + Intronic
1100573912 12:95871450-95871472 ATCTGTAGGGGATTGGTTCCAGG - Intronic
1101367528 12:104089016-104089038 ATCTGCAGGGCTTTGGTTTCAGG + Intronic
1101661343 12:106768208-106768230 ATCTGAATTTCATGGGTTTCAGG - Intronic
1101685385 12:107014751-107014773 ATCTGCAGGAAATTGGTTCCAGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1104307923 12:127626577-127626599 ATCCACGGGACATTGGTTTCAGG - Intergenic
1104793772 12:131501555-131501577 ATCTGCAGGGGATTGGTTCCAGG - Intergenic
1105622195 13:22079156-22079178 ATCTGCAGGGCACTGGTTTCAGG - Intergenic
1106830198 13:33572931-33572953 ATCTGAGGGGAACTGGTTTCAGG - Intergenic
1107308652 13:39051465-39051487 ATCTTAAGGAAATTGCTTTATGG + Intergenic
1107914924 13:45139852-45139874 ACCTGCAGGAGATTGGTGTCTGG + Intronic
1109160886 13:58972509-58972531 ATCTAAAGGACATTGCTTTATGG + Intergenic
1109834750 13:67842414-67842436 ATCTGTGGGAAATTGGTTTCGGG + Intergenic
1110036073 13:70686348-70686370 TTCTCAAACACATTGGTTTCAGG - Intergenic
1110263855 13:73516162-73516184 ATCTCAAGGCATTTGGTTTCAGG + Intergenic
1110531355 13:76602437-76602459 ATCTTAAGGTCATTGATTTAAGG - Intergenic
1111035743 13:82670225-82670247 ATTTGCAGGAGATTGGTTGCAGG + Intergenic
1111436237 13:88212121-88212143 ATCTGTTGGGGATTGGTTTCAGG + Intergenic
1111907833 13:94276294-94276316 ATGTGTCTGACATTGGTTTCAGG + Intronic
1113100943 13:106717290-106717312 ATCTGCAGGAGATTCGTTCCAGG - Intergenic
1113356124 13:109581839-109581861 ATTTGCAGGGGATTGGTTTCAGG + Intergenic
1114879849 14:26770774-26770796 GTCTGAAGTCCATTAGTTTCAGG + Intergenic
1115274626 14:31593570-31593592 ATCTGCAGGGCATTGGTTCCAGG - Intronic
1116527334 14:45921480-45921502 ATTTAAAAGACATTGGTTTTAGG - Intergenic
1117056784 14:51920242-51920264 ATCTTCAGGGGATTGGTTTCAGG - Intronic
1117280118 14:54232158-54232180 ATCTGCAGGGGATTGGTTCCAGG + Intergenic
1117426986 14:55610203-55610225 ATATGCAGGAGATTGGCTTCAGG + Intronic
1119566377 14:75632563-75632585 ATCTGAAAGACAGTAGCTTCCGG + Intronic
1120043829 14:79784021-79784043 ATTTGAAGGAGAGAGGTTTCAGG - Intronic
1120210166 14:81626355-81626377 ATCTGAGGGGGATTAGTTTCAGG - Intergenic
1121065141 14:90956191-90956213 ATCTGCAGGGAATTGGTTCCAGG - Intronic
1121070941 14:91020499-91020521 ATCCATAGGAGATTGGTTTCAGG - Intronic
1123716008 15:23032281-23032303 ATCTGAGGGGAATTGGTTCCAGG + Intronic
1123960995 15:25400255-25400277 ATCTGCAGGATATTGGTTCCAGG + Intronic
1124191424 15:27580419-27580441 ATCTGCAGGGGATTGGTTCCAGG + Intergenic
1124437239 15:29660959-29660981 ATCTGAGGGGGATTGGTTCCAGG - Intergenic
1126601764 15:50435500-50435522 ATCTGTAGGAGAGTGGTTCCAGG - Intronic
1126653744 15:50954027-50954049 ATCTAAAGGGGATTGGTTTTAGG - Intronic
1126780006 15:52131490-52131512 ATCTGTGGGAGATTGGTTCCAGG - Intronic
1127156243 15:56128297-56128319 ATCTGAGGGATATTGGTCTGTGG - Intronic
1128171825 15:65520047-65520069 ATCTGCAGGGGATTGGTTTCAGG + Intergenic
1129644152 15:77414942-77414964 ATCTGAAGGACAGTTGGTTGAGG - Intronic
1130572521 15:85060605-85060627 ATCTGCAGGGAATTGGTTCCAGG - Intronic
1130777141 15:86996291-86996313 AGGTGCAGGACATGGGTTTCTGG - Intronic
1133200089 16:4198839-4198861 TTCGGAAGGACATTGGATGCAGG - Intronic
1133208146 16:4246501-4246523 ATCTCAAGGACACTGCTTGCTGG - Intergenic
1135140785 16:19919695-19919717 ATCTGTAGGGGATTGGTTTTAGG + Intergenic
1135573075 16:23564144-23564166 ATCTGACGTTCACTGGTTTCAGG + Intronic
1135784728 16:25338616-25338638 ATCTGCAGGGAATTGGTTCCAGG - Intergenic
1135939362 16:26807563-26807585 ATCTTATTCACATTGGTTTCTGG - Intergenic
1137574882 16:49593006-49593028 ATTTGAAGGATTTTGGTTTGGGG - Intronic
1137918979 16:52466369-52466391 ATGTGAAGGGAATTGGTTTCAGG + Intronic
1138706865 16:58924003-58924025 ATCTGCGGGGCATTGGTTCCAGG + Intergenic
1139235076 16:65329287-65329309 CTCTGAAGAACATTGCTTTCTGG + Intergenic
1139260473 16:65588614-65588636 ATCTGTAGGAGATTGGTTCTAGG - Intergenic
1140651155 16:77089982-77090004 TTCTGAGTTACATTGGTTTCTGG + Intergenic
1140991371 16:80215439-80215461 ATCTGAAGACCATGGGTTTTAGG - Intergenic
1141310499 16:82909018-82909040 ATATGGAGAAGATTGGTTTCAGG - Intronic
1143225066 17:5294589-5294611 ATCTGAGGGAAATTGGTTCCAGG - Intronic
1145218788 17:21071878-21071900 ATCTGTTGGAAATTGGTTCCAGG + Intergenic
1146230241 17:31101248-31101270 AACTGGAAGAGATTGGTTTCCGG - Intronic
1146782612 17:35688490-35688512 AATTGAAGGACATGAGTTTCCGG - Intronic
1148019997 17:44547436-44547458 CTATGGAGGACATTGGGTTCTGG - Intergenic
1149727619 17:58912407-58912429 GTCTGAAGAACATTTGTTCCAGG + Intronic
1150377857 17:64696739-64696761 ATCTGAAGGACATAGGGGCCTGG - Intergenic
1150861911 17:68809334-68809356 ATCTGTGGGGCACTGGTTTCAGG + Intergenic
1152884688 17:82842727-82842749 ATCTGAAGGTAAATGATTTCTGG - Intronic
1153452460 18:5244783-5244805 ATCTGAAGGGGATTGGTTCCAGG + Intergenic
1154306067 18:13231949-13231971 TTCTGAAGGTCATTGGTCCCAGG + Intronic
1155034752 18:22016617-22016639 ATTTGAAGGACATGAGTCTCTGG - Intergenic
1155134051 18:22969966-22969988 ATCTGTAGGGTATTGGTTCCAGG + Intronic
1155571663 18:27201273-27201295 ATCTGAAGGTCAATGGATTTTGG + Intergenic
1156418454 18:36924445-36924467 ATCTGAATGACCCTGATTTCTGG + Intronic
1157779198 18:50422196-50422218 ATCTGCGGGAGATTGGTTCCAGG - Intergenic
1158277581 18:55785271-55785293 ATCTGTAGGAGACTGGTTCCCGG + Intergenic
1158567666 18:58568879-58568901 ATCTGTAGGGGATTGGTTCCAGG - Intronic
1158657630 18:59353772-59353794 ATCCATAGGACATTGGTTCCAGG + Intronic
1159251510 18:65884180-65884202 ATCTTAAGGAAATGGATTTCTGG + Exonic
1160257570 18:77260182-77260204 ATCTGCAGGAGCTTGATTTCAGG - Intronic
1161843629 19:6697304-6697326 CTCTGAAGGACAAGGGTTTGTGG + Intronic
1161893821 19:7064734-7064756 ATCTGACAGTCATTGGTCTCTGG - Intergenic
1162120891 19:8467191-8467213 AACTGAAGGACCATGTTTTCTGG - Intronic
1163079752 19:14930179-14930201 ATTTGCAGGGGATTGGTTTCAGG - Intergenic
1164926969 19:32138504-32138526 ATCTGAAGCACATGAGTTTTGGG - Intergenic
1165816996 19:38648385-38648407 ATCTGAAGGAGATTGGAATTGGG + Intronic
1167825509 19:51969481-51969503 ATCTGTAGGGTATTGGTTCCAGG + Intronic
926081617 2:9991320-9991342 ATCTGTAGTACATGGGCTTCTGG + Intronic
926834800 2:17006575-17006597 TCCTGCAGGACACTGGTTTCTGG + Intergenic
928816697 2:35304683-35304705 ATGTGAAGGAAATGGGTTTGGGG + Intergenic
930125090 2:47789628-47789650 ATCTGAGGGGGATTGGTTGCAGG + Intronic
930667352 2:54113026-54113048 ATCTGCAGGGGATTGGTTCCAGG + Intronic
932065698 2:68557091-68557113 ATCTGCAGGGGATTGGTTCCAGG + Intronic
932161334 2:69462925-69462947 AAGTGAAGGACATAGGTTTCTGG + Intronic
932320874 2:70821137-70821159 ATCTGCAGGGGATTTGTTTCAGG - Intergenic
935897787 2:107756293-107756315 ATCCCTAGGGCATTGGTTTCAGG - Intergenic
936082005 2:109438658-109438680 ATCAGAAGGTCATGGGTTGCAGG - Intronic
936584205 2:113739140-113739162 ATCTGCAGGGGATTGGGTTCAGG + Intronic
938552858 2:132396687-132396709 ATCTGTGGGAGATTGGTTTCAGG + Intergenic
940207522 2:151220315-151220337 ATCTGCAGGCGATTGGTTCCAGG - Intergenic
940880224 2:158939291-158939313 ATCCGTGGGAGATTGGTTTCAGG + Intergenic
941066095 2:160904478-160904500 ATCTGTGGGAGATTGGTTCCAGG + Intergenic
941425336 2:165337827-165337849 ATCAGATGGAAATTTGTTTCTGG + Intronic
943149037 2:184086454-184086476 ATCTGCAGGAGATTGTTTCCAGG - Intergenic
944028231 2:195198344-195198366 TTCTGTAGGACATGGATTTCTGG - Intergenic
944208488 2:197182624-197182646 ATATGTGGGACATTGGTTCCAGG + Intronic
945000970 2:205350104-205350126 ATCAGAAAGACCTGGGTTTCTGG + Intronic
945030735 2:205661247-205661269 AGATGAAGGAAATTGCTTTCAGG + Intergenic
945092911 2:206192798-206192820 ATCCACAGGACATTGGTTTCAGG + Intronic
945581518 2:211601416-211601438 AACTGAAAGACATAAGTTTCCGG + Intronic
945592241 2:211747856-211747878 ATCTGCAGTAAATTGGTTCCAGG + Intronic
946312110 2:218887986-218888008 ATTTGAAGTAAACTGGTTTCAGG + Intronic
946380046 2:219341381-219341403 ATCTATAGGAGATTGGTTCCAGG + Intergenic
946790984 2:223300195-223300217 ATCTGAAGGACGTTGGTGAAGGG + Intergenic
946908679 2:224440140-224440162 ATCTGTGGGAGATTGGTTCCAGG - Intergenic
947116366 2:226775687-226775709 ATCTGTGGGGGATTGGTTTCAGG + Intronic
947851731 2:233293848-233293870 TTCTGAAGGAAAATGGTATCTGG - Intronic
948872130 2:240806965-240806987 ATCAGTAGGAGATTGGTTCCAGG + Intronic
948971077 2:241427601-241427623 ATCTGTAGGGGATTGGTTCCAGG - Intronic
1169123526 20:3111273-3111295 TTCTGAAGCAAATTGGTTTGAGG - Intronic
1169155956 20:3329786-3329808 TGCTGAAGGACAATGCTTTCTGG + Intronic
1169958209 20:11129700-11129722 ATCTGAGGTATTTTGGTTTCAGG + Intergenic
1170440426 20:16373978-16374000 ATCTGCAGAGGATTGGTTTCAGG - Intronic
1173137395 20:40451228-40451250 ATCTGTGGGGAATTGGTTTCAGG - Intergenic
1176875844 21:14126758-14126780 ATCTGTGGCAGATTGGTTTCAGG - Intronic
1177572209 21:22901561-22901583 ATCTGCAGGAGATTGGTTCCAGG - Intergenic
1178448391 21:32666890-32666912 ATCTGTGGGAGATTGGTTTCAGG + Intronic
1179096299 21:38318695-38318717 ATCTGAAGGGGATTGGTTCCAGG + Intergenic
1179196031 21:39163278-39163300 ATTTGAAGGCCAGTAGTTTCTGG - Intergenic
1179965194 21:44800595-44800617 ATCTGGAGGGGATTGGTTCCAGG - Intronic
1180022949 21:45140667-45140689 TTCTGAAGGAAACTGGCTTCTGG - Intronic
1181480572 22:23196526-23196548 ATCCGCAGGAAATTGGTTCCAGG + Intronic
1182120879 22:27785891-27785913 GTCTAATGGACATTGGTGTCTGG - Intronic
1182158569 22:28099078-28099100 AACAGCTGGACATTGGTTTCTGG - Intronic
1183128929 22:35814198-35814220 ATCTGCAGGTAATTGGTTCCAGG + Intronic
949676422 3:6459418-6459440 TTCTGGGGGAAATTGGTTTCAGG + Intergenic
949854181 3:8444916-8444938 ATCTAAAGTACATAGGTTACAGG + Intergenic
951873443 3:27393331-27393353 ATCTTAAAGTCATTGTTTTCTGG - Intronic
951920326 3:27847639-27847661 ATCTGCAGGGTATTGGTTTCAGG - Intergenic
952177472 3:30880734-30880756 ATCTGCAGGGAATTGGTTCCAGG - Intronic
953348589 3:42197231-42197253 ATCTGAGGGGGATTGGTTCCAGG + Intronic
954641018 3:52097880-52097902 ATCTGAAGCACGTTGATTCCTGG - Intronic
955817429 3:62860403-62860425 ATCTGCAGGAGATTGGTTCTAGG + Intronic
955838327 3:63083344-63083366 ATCTCCAGGACATTGGTCTTGGG - Intergenic
956709815 3:72029413-72029435 TTTTGAAAGACATTGCTTTCAGG + Intergenic
956799262 3:72742014-72742036 ATCTGTGGGAGATTGGTTCCAGG - Intergenic
958870601 3:99554473-99554495 ATGTGTAGGACATTGATTTCTGG + Intergenic
959612324 3:108309081-108309103 ATCTCTAGGACATTGGTCTGGGG - Intronic
959930392 3:111975438-111975460 ATCTAAAGGACATTGGCTACTGG - Exonic
960496033 3:118376169-118376191 ATCTGCAGGAAATTGGTTCCAGG - Intergenic
961003110 3:123387231-123387253 ATCTGAAAATCATTGGTATCAGG + Intronic
961222968 3:125214157-125214179 ATCTGCAGGAAATTAGTTCCAGG + Intergenic
961337280 3:126188401-126188423 ATCTGCAAGGCATTGGTTCCAGG - Intronic
964604117 3:158540875-158540897 ATGTGTAAGACATTGTTTTCAGG + Intronic
964822625 3:160789838-160789860 ATCTGCAGGAGATTGGTTCCAGG + Intronic
965662344 3:171054781-171054803 AAATGCAGGACATTAGTTTCAGG - Intergenic
965878348 3:173356274-173356296 ATCTGCAGAAGATTGGTTCCAGG + Intergenic
966468630 3:180261868-180261890 ATCTCCAGGACATTGGTCTGGGG + Intergenic
966924355 3:184634842-184634864 AGCTGAAGGGTAGTGGTTTCAGG - Intronic
967842880 3:194021028-194021050 TTCTTAAGGACATTAGATTCCGG - Intergenic
967948467 3:194822581-194822603 AGCTGAGGGACCTGGGTTTCAGG - Intergenic
968024904 3:195433061-195433083 ATCCATAGGACATTGGTTCCAGG + Intronic
968143797 3:196280331-196280353 ATCTGCAGGGCACTGGTTCCAGG + Intronic
970777976 4:19700010-19700032 ATCTGAGGTAAATTGGTTTCAGG + Intergenic
972233877 4:37106429-37106451 ATCTGTAGGGGATTGGTTCCAGG - Intergenic
972274486 4:37544371-37544393 AATTGAAGGACATGAGTTTCTGG - Intronic
972653201 4:41039930-41039952 ATCTCCAGGACATTGCTTTTTGG - Intronic
973231943 4:47849746-47849768 ATCTGTAGGAAATTGGTTCTAGG + Intronic
973628835 4:52799527-52799549 ATCTGAAGGGGATTGGTTCCAGG - Intergenic
977044904 4:92057170-92057192 ATCTCCAGGACATTGTTCTCAGG + Intergenic
978130842 4:105195466-105195488 ATCTGTGGGAGATTGGTTCCAGG + Intronic
980292593 4:130863153-130863175 ATCTCCAGCACATTGGTTCCAGG + Intergenic
981121150 4:141052233-141052255 ATTTGAAGGTAATTGGTTCCTGG - Intronic
981276958 4:142911826-142911848 ATAGGAATAACATTGGTTTCAGG - Intergenic
981666565 4:147233669-147233691 ATCTGCAGGAGATTGGTTTCAGG + Intergenic
982149231 4:152434143-152434165 ATCTGCAGGGGATTGGTTCCAGG - Intronic
982489383 4:156010164-156010186 ATCTTAAGGACGGTGGTTTCTGG + Intergenic
983112827 4:163774048-163774070 ATCTGTGGGGGATTGGTTTCAGG + Intronic
983293081 4:165831240-165831262 ATCTGCGGGGGATTGGTTTCAGG + Intergenic
983620884 4:169759456-169759478 AACTGAAGAACATGTGTTTCAGG - Intergenic
985876464 5:2602377-2602399 ACCTGGAGGACACTGGTTCCTGG - Intergenic
986769472 5:10958554-10958576 ACCTGAAGGAGACTGTTTTCTGG - Intergenic
986774208 5:10998928-10998950 ATCTGTGGGAAATTGGTTACAGG - Intronic
986973063 5:13359875-13359897 ATCTGAAGGAACTTAGTTTAAGG + Intergenic
987242416 5:16014150-16014172 ATCTGAAGAACAGTGGTTAAGGG + Intergenic
988438997 5:31210579-31210601 ATCTGTAGAGAATTGGTTTCAGG + Intronic
989329363 5:40238155-40238177 TTCTCAAAGACAGTGGTTTCAGG + Intergenic
990311966 5:54548819-54548841 ATCTGCAGGGCATTGGTTCCAGG + Intergenic
990716748 5:58645937-58645959 ATGTGAACGACATTTGTTTCTGG - Intronic
990833357 5:59985733-59985755 ATATGTAGGGGATTGGTTTCGGG + Intronic
991296574 5:65087929-65087951 ATTTGCAGGACATTGGGTTGTGG - Intergenic
992221451 5:74577615-74577637 ATCTGAGGAAGATTGGTTCCAGG + Intergenic
993447807 5:88036195-88036217 ATCTGCAGGAGATTAGTTCCAGG + Intergenic
994005989 5:94837717-94837739 ATCTGAAGCACTTGGGTTTCAGG + Intronic
994620636 5:102157240-102157262 CTCTGAAGAACATTAGTTTTAGG + Intergenic
994696755 5:103081003-103081025 ATCAGCAGGAGATTGGCTTCAGG + Intergenic
995166342 5:109046902-109046924 ATCTGTAGGAGACTGGTTCCAGG - Intronic
996128049 5:119748911-119748933 ATCTGAATGAAATTAGTTTGAGG - Intergenic
996362455 5:122665021-122665043 ATCTGTGGGAGATTGGTTCCAGG - Intergenic
997805135 5:136910019-136910041 AGCTGGAGTACATTGTTTTCGGG + Intergenic
998089224 5:139353385-139353407 ATGTTAAAGACATTTGTTTCTGG + Intronic
998519715 5:142788789-142788811 ATCTGTGGGGCATTGGTTCCAGG - Intronic
999197685 5:149793602-149793624 GTCTGAAGGAGAATGGTTTGGGG - Intronic
999408673 5:151330040-151330062 ATATATAGGACATTGGTTCCAGG - Intronic
999526986 5:152417459-152417481 ATCTGCAGGGGATTGGTTCCAGG + Intronic
999927154 5:156391717-156391739 ATCTGCAGCAGATTGGTTTCAGG - Intronic
1000039728 5:157476422-157476444 ATCTGCAGGGGATTGGTTCCAGG + Intronic
1000244513 5:159438235-159438257 GTCTGGAGGATAGTGGTTTCAGG + Intergenic
1000753260 5:165123840-165123862 ATCTGAGGGGGATTGGTTTCAGG + Intergenic
1000932378 5:167267137-167267159 ATCTGACTGACATTTGATTCTGG + Intergenic
1001050815 5:168412923-168412945 ATCTGCAGGGGATTGGTTCCAGG - Intronic
1001450090 5:171817937-171817959 TTCTGCAGGCCAGTGGTTTCAGG - Intergenic
1002181722 5:177434204-177434226 TACAGAAGGACATTGGTTTGGGG + Intronic
1002335325 5:178473649-178473671 ATCTTCAGGGCATTGGTTCCAGG - Intronic
1002758817 6:185972-185994 ATCTGTAGGAAATTGCTTCCAGG - Intergenic
1002861002 6:1079480-1079502 ATCTGAAGGACAGAGGCTTCGGG - Intergenic
1003205348 6:4004633-4004655 ATCTGTAAGAGATTGGTTCCAGG + Intergenic
1003575752 6:7293021-7293043 ATCTGCAGGAAATTAGTTCCAGG + Intronic
1003956385 6:11169158-11169180 CTGGGAAGGGCATTGGTTTCTGG + Intergenic
1004738445 6:18432245-18432267 ATCTGAAGGGCACTGGTTCCAGG - Intronic
1005172945 6:23009083-23009105 ATCTGTAGGACATTGATTCAGGG + Intergenic
1007990713 6:46252451-46252473 ATCTCAAGCTCTTTGGTTTCAGG + Intronic
1008700177 6:54089495-54089517 AGCTGAAAGACTTGGGTTTCAGG + Intronic
1009419454 6:63449124-63449146 GTCTGCAGGGCATTGGTTCCAGG - Intergenic
1010381528 6:75231276-75231298 ATCTGCAGGGGATTGGTTCCAGG + Intergenic
1010403842 6:75479901-75479923 ATATTAAGGACATTTGTTCCTGG + Intronic
1010624857 6:78125539-78125561 ATCTGTAGGATATTGGTTCCAGG + Intergenic
1010755001 6:79656821-79656843 ATCTGAAGGGAATTAGTTTCAGG - Intronic
1012061647 6:94491789-94491811 AGTCGAAGGACTTTGGTTTCTGG - Intergenic
1012194470 6:96323076-96323098 ATCAGGAGGAAATTGGTTCCAGG + Intergenic
1013030050 6:106324417-106324439 ATCTGTGGGAGATTGGTTCCAGG - Intronic
1013395359 6:109731784-109731806 ATCTGTGGGGGATTGGTTTCAGG - Intronic
1013614487 6:111829061-111829083 TTCTGAAGCACATTGGTCCCAGG - Intronic
1014247059 6:119079961-119079983 ATTTGTAGGATATTTGTTTCTGG - Intronic
1014688741 6:124534871-124534893 ATCTGTGGGAGATTGGTTCCAGG + Intronic
1016873382 6:148840516-148840538 ATCTGCAGGGGATTGGTTCCAGG + Intronic
1017064001 6:150511841-150511863 ATATGAATGACATTTGTTTAAGG + Intergenic
1017223751 6:151996174-151996196 ATCTGAAGGACAGGGACTTCAGG + Intronic
1018660730 6:166084725-166084747 ATCTGCAGGGGATTGGCTTCAGG - Intergenic
1020476486 7:8601120-8601142 ATCTGAGGGGCATTGGTTCCAGG - Intronic
1021169609 7:17382886-17382908 CTATGAATAACATTGGTTTCTGG + Intergenic
1021363345 7:19745004-19745026 ATGTGCAGGAGATTGGTTTTGGG + Intronic
1022598601 7:31735834-31735856 ATCTGTGGGAGATCGGTTTCAGG + Intergenic
1023025580 7:36047055-36047077 ATCTGAATGAAATTGGTTATAGG - Intergenic
1023234538 7:38070477-38070499 ATCTGCAGGGTATTGGTTCCAGG + Intergenic
1023432261 7:40106887-40106909 ATCTGTGGGAGATTGGTTCCAGG + Intergenic
1023901224 7:44481217-44481239 ATCTGCAGGGGATTGGTTCCTGG - Intronic
1026073015 7:67139501-67139523 ATCTGCAGGGGATTGGTTCCAGG + Intronic
1026661181 7:72304113-72304135 GTCTGAAAGACGGTGGTTTCGGG - Intronic
1026946550 7:74319897-74319919 ATCTGAAGGACACAGGGTTTGGG + Intronic
1027777118 7:82480324-82480346 ATCTGAAGGGGATTAGTTCCAGG - Intergenic
1028030290 7:85903841-85903863 ATCTGAAGAAGATTAGTTTCAGG + Intergenic
1029202738 7:98849841-98849863 ATCTGAAAGACAGTGCCTTCAGG + Intronic
1030489370 7:110212871-110212893 TTCTGTAGGGCATTGGTTACAGG - Intergenic
1030978768 7:116161585-116161607 ATCTGCAGGATACTGGTTCCAGG - Intergenic
1031074957 7:117202883-117202905 ATCTGCAGGGGATTGGTTCCAGG + Intronic
1031283544 7:119836941-119836963 ATCTGTGGGAAATTGATTTCAGG + Intergenic
1032207503 7:129880693-129880715 ATCTGTAGGGGATTGGTTCCAGG - Intronic
1033203845 7:139399395-139399417 ATCTGTGGGAGATTGGTTCCAGG - Intronic
1033772125 7:144564339-144564361 AACTGATGGACTTTGGCTTCGGG - Intronic
1036517765 8:9460420-9460442 ATCTGAATGATATTGGTTCCAGG - Intergenic
1036628667 8:10494918-10494940 ATCTGTGGGAAATTGGTTCCAGG - Intergenic
1036909066 8:12737605-12737627 ATCTGTGGGAGATTGGTTCCAGG - Intronic
1037574458 8:20188116-20188138 ATCTGTGGGGCATTGGTTCCAGG - Intergenic
1037599700 8:20383797-20383819 TTCTGAAGCACATTGGCTTGGGG + Intergenic
1038734986 8:30160798-30160820 ATCTGTGGGAGATTGGTTCCAGG - Intronic
1040863721 8:52026601-52026623 ATCTGAAGGACACTAGTTTCTGG + Intergenic
1041078503 8:54190910-54190932 ATCTGTAGGGGATTGGTTCCAGG - Intergenic
1043297076 8:78679296-78679318 ATCTGTGGGAGATTGGTTCCAGG + Intronic
1043332224 8:79131473-79131495 ATCTGAACGACATTCTTTCCAGG - Intergenic
1043491776 8:80756178-80756200 ATCTAAAAGACTTGGGTTTCTGG - Intronic
1044146473 8:88721269-88721291 ATCTGAGGGGAATTGGTTTTAGG - Intergenic
1044756824 8:95471958-95471980 ATCTGCAGGGGATTAGTTTCAGG - Intergenic
1044831714 8:96256276-96256298 ATCAGGAGGACAGTGGCTTCAGG + Intronic
1046837783 8:118822039-118822061 ATCTGCAAGAAATTGGTTCCAGG + Intergenic
1047536765 8:125727098-125727120 ATCTGAAGGTAAGTGGTTGCTGG - Intergenic
1048427316 8:134334827-134334849 TTCTGAAAGACCTTGGTTTCCGG + Intergenic
1051070549 9:13161029-13161051 ATCTGTTGGGGATTGGTTTCAGG - Intronic
1051235621 9:14995633-14995655 AAATGAAGGAGATTGGTTCCAGG + Intergenic
1051330390 9:16019237-16019259 ATCTGAAGGATATTTTTTCCAGG - Intronic
1051457511 9:17276646-17276668 ATCTGTGGGGGATTGGTTTCAGG + Intronic
1051764114 9:20502746-20502768 ATCTGCAGGGGATTGGTTCCAGG - Intronic
1052208209 9:25869433-25869455 ATCAGAAGGACATGGGATTTTGG - Intergenic
1055035112 9:71810268-71810290 ATCTGCAGGGGATTGGTTCCAGG - Intronic
1056731635 9:89170945-89170967 ATCTGAGGGGGATTGGTTCCAGG - Intronic
1056972202 9:91215280-91215302 ATCTGCAGGGGATTGGTTACAGG + Intronic
1058071865 9:100609626-100609648 ATCTGCAGGGAATTAGTTTCAGG + Intergenic
1058232286 9:102442016-102442038 ATCTGCAGGGGATTGGTTCCAGG - Intergenic
1058510076 9:105708427-105708449 ATCTGTAGGGGACTGGTTTCAGG - Intronic
1058934863 9:109760569-109760591 ATTTGAAGGACATTGTTTTGTGG + Intronic
1060437000 9:123602097-123602119 ATCTGAGGGGGATTGGTTCCAGG + Intronic
1186255467 X:7713622-7713644 ATCTAGAGGGGATTGGTTTCAGG + Intergenic
1188251120 X:27896243-27896265 ATCTGTGGGGGATTGGTTTCAGG - Intergenic
1189149065 X:38685871-38685893 ATCTGTTGGAGATTGGTTCCAGG - Intronic
1189638518 X:43040658-43040680 ATCTGTAGGGGATTGGTTCCAGG - Intergenic
1189831315 X:44976398-44976420 ATCCGTGGGGCATTGGTTTCAGG + Intronic
1190852656 X:54261411-54261433 ATCTGTAGGGGATTGGTTCCAGG - Intronic
1190983420 X:55478921-55478943 ATCTGCAGGGGATTGGTTCCAGG - Intergenic
1190985279 X:55494262-55494284 ATCTGCAGGGGATTGGTTCCAGG + Intergenic
1193463858 X:81823171-81823193 ATCTGTAGGGGATTGCTTTCAGG - Intergenic
1193730536 X:85097249-85097271 ATATGCAGGAGATTGGTTCCAGG - Intronic
1196292547 X:113960369-113960391 ATCTGAAGGACAATTGTTTCAGG - Intergenic
1196636146 X:118005190-118005212 ATCTGTGGGGCATTGGTTCCAGG - Intronic
1198057496 X:133009408-133009430 ATCTGTGGGGCATTGGTTCCAGG - Intergenic
1198742710 X:139857844-139857866 GTGAGAAGGACATGGGTTTCAGG + Intronic
1199275551 X:145938101-145938123 ATCTGCAGGGGATAGGTTTCAGG + Intergenic
1199871793 X:151904811-151904833 CTCAGAAGGGCATTGGTTTGGGG + Intergenic
1201220068 Y:11760252-11760274 ATCTGATGGACTCTGGATTCTGG - Intergenic
1201525927 Y:14934358-14934380 ATCTGTGGGAGATTGGTTTGAGG + Intergenic