ID: 1085232088

View in Genome Browser
Species Human (GRCh38)
Location 11:74981012-74981034
Sequence ACTTGGGCATAGAGGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085232081_1085232088 22 Left 1085232081 11:74980967-74980989 CCTGTGGGCAGAAACCAGGTGAA No data
Right 1085232088 11:74981012-74981034 ACTTGGGCATAGAGGGATTCAGG No data
1085232082_1085232088 8 Left 1085232082 11:74980981-74981003 CCAGGTGAATTGTTAGAACTTTG No data
Right 1085232088 11:74981012-74981034 ACTTGGGCATAGAGGGATTCAGG No data
1085232079_1085232088 29 Left 1085232079 11:74980960-74980982 CCTTATTCCTGTGGGCAGAAACC No data
Right 1085232088 11:74981012-74981034 ACTTGGGCATAGAGGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085232088 Original CRISPR ACTTGGGCATAGAGGGATTC AGG Intergenic
No off target data available for this crispr