ID: 1085232942

View in Genome Browser
Species Human (GRCh38)
Location 11:74988775-74988797
Sequence CTCGGTCCCCACCACGGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085232942_1085232965 25 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232965 11:74988823-74988845 CCGAGGGGGCGGGACGGGGAGGG 0: 1
1: 0
2: 12
3: 74
4: 672
1085232942_1085232949 -8 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232949 11:74988790-74988812 GGACCGAGCTGCGGGCTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 191
1085232942_1085232962 21 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232962 11:74988819-74988841 AGCGCCGAGGGGGCGGGACGGGG 0: 1
1: 0
2: 3
3: 30
4: 256
1085232942_1085232951 -5 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232951 11:74988793-74988815 CCGAGCTGCGGGCTGGAGGGAGG 0: 1
1: 1
2: 4
3: 33
4: 425
1085232942_1085232961 20 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232961 11:74988818-74988840 CAGCGCCGAGGGGGCGGGACGGG 0: 1
1: 0
2: 2
3: 19
4: 251
1085232942_1085232954 8 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232954 11:74988806-74988828 TGGAGGGAGGGGCAGCGCCGAGG 0: 1
1: 0
2: 3
3: 64
4: 631
1085232942_1085232953 -3 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232953 11:74988795-74988817 GAGCTGCGGGCTGGAGGGAGGGG 0: 1
1: 1
2: 9
3: 113
4: 837
1085232942_1085232948 -9 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232948 11:74988789-74988811 GGGACCGAGCTGCGGGCTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 291
1085232942_1085232952 -4 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232952 11:74988794-74988816 CGAGCTGCGGGCTGGAGGGAGGG 0: 1
1: 0
2: 4
3: 26
4: 403
1085232942_1085232959 15 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232959 11:74988813-74988835 AGGGGCAGCGCCGAGGGGGCGGG 0: 1
1: 0
2: 2
3: 42
4: 536
1085232942_1085232957 11 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232957 11:74988809-74988831 AGGGAGGGGCAGCGCCGAGGGGG 0: 1
1: 0
2: 7
3: 57
4: 500
1085232942_1085232956 10 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232956 11:74988808-74988830 GAGGGAGGGGCAGCGCCGAGGGG 0: 1
1: 0
2: 5
3: 69
4: 536
1085232942_1085232960 19 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232960 11:74988817-74988839 GCAGCGCCGAGGGGGCGGGACGG 0: 1
1: 0
2: 4
3: 28
4: 385
1085232942_1085232963 24 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232963 11:74988822-74988844 GCCGAGGGGGCGGGACGGGGAGG 0: 1
1: 1
2: 16
3: 135
4: 1063
1085232942_1085232955 9 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232955 11:74988807-74988829 GGAGGGAGGGGCAGCGCCGAGGG 0: 1
1: 0
2: 2
3: 57
4: 579
1085232942_1085232958 14 Left 1085232942 11:74988775-74988797 CCCACGCCGTGGTGGGGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1085232958 11:74988812-74988834 GAGGGGCAGCGCCGAGGGGGCGG 0: 1
1: 0
2: 3
3: 58
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085232942 Original CRISPR CTCGGTCCCCACCACGGCGT GGG (reversed) Exonic
901793006 1:11664312-11664334 CTCGGTCCCCACCCCCGCCCCGG - Intronic
907425044 1:54374239-54374261 CTGGATCCCCAACACGCCGTGGG - Intronic
915835329 1:159171623-159171645 CCCGGTCCCCACCTCGGCCCCGG + Exonic
1072009696 10:91292230-91292252 CTCTGCCCCGACCACGGAGTCGG + Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1075901150 10:126043627-126043649 CTCGGACCCCAGCCTGGCGTGGG - Intronic
1077023143 11:428514-428536 CCCGGTCACCACCACGGCCGTGG + Exonic
1082838499 11:57668612-57668634 CCCGGTCCCCACCACGGGACTGG - Intronic
1085232942 11:74988775-74988797 CTCGGTCCCCACCACGGCGTGGG - Exonic
1087389150 11:97512629-97512651 CTCAGTCCCCACCACCCCCTTGG + Intergenic
1087760901 11:102103527-102103549 ATCGGTCCCCACCCCAGAGTAGG - Intergenic
1088893509 11:114061448-114061470 CTCCGTCCCCACCCCGGGGCGGG + Intronic
1089252989 11:117178803-117178825 CTCGCAGCCCAGCACGGCGTCGG + Exonic
1090366491 11:126211225-126211247 CTCAGTCCTAACCACTGCGTCGG - Intronic
1095965227 12:47863088-47863110 CTGGGTTCCCACCACGTGGTAGG + Intronic
1100403136 12:94249783-94249805 GTCTGTCCCCATCACAGCGTAGG - Intronic
1103820554 12:123694465-123694487 CTAGTTCCCTACTACGGCGTAGG - Intronic
1103910822 12:124351143-124351165 CTGTGTCCCCACCACTGCGTGGG + Intronic
1105405543 13:20129226-20129248 CTCCGTCCTCACCACCGCGATGG - Intergenic
1111396301 13:87672624-87672646 CGCGGTCGCCACCGCGGCGGCGG + Exonic
1126172263 15:45704806-45704828 CTCGGTCCCCTCCACTGCACTGG + Intergenic
1129228789 15:74184934-74184956 CTCCTTCCCCACCTCGGCGCTGG + Intronic
1133333089 16:4988243-4988265 CTCGTTCACCACCACGCGGTTGG - Exonic
1134699970 16:16257169-16257191 CTCACACCCCACCAGGGCGTAGG + Intronic
1134971855 16:18537490-18537512 CTCACACCCCACCAGGGCGTAGG - Intronic
1138191296 16:55016302-55016324 CTCGGTCCTCACCCCGAGGTTGG + Intergenic
1138475918 16:57270556-57270578 CTCGGTCCCCACCCCCGCTCTGG + Intronic
1142129439 16:88426003-88426025 CTCTGTCCCCAGCACGAGGTTGG - Intergenic
1151468847 17:74305223-74305245 CTCGGTCCCCACCATGAACTTGG - Exonic
1154303929 18:13217546-13217568 CCGGGTCCCCACCGCGGAGTGGG + Intronic
1158250597 18:55483082-55483104 CTCAGTACCCAGCACGGGGTAGG + Intronic
1161550379 19:4909392-4909414 CTCGCTTCCCGCCACTGCGTCGG + Intronic
1162211271 19:9094033-9094055 CTCGGTCCTCACCACTGTGAAGG + Exonic
1163008576 19:14411086-14411108 CGGGGTCCCCACCACGACATGGG + Exonic
1163827641 19:19532620-19532642 CTCTGTCCCCAGCACCGCGGAGG + Exonic
1167159298 19:47756786-47756808 CTCGGTGGGCACCACGGGGTGGG - Intronic
1167262500 19:48467118-48467140 CTCGGTCCAGAACACGGGGTGGG - Intronic
1168332781 19:55579549-55579571 CACGGCCCCGACCACGGCCTCGG + Exonic
926109565 2:10173391-10173413 CCTGATCCCCACCACTGCGTTGG + Intronic
932308886 2:70724247-70724269 CTCGCTCCACAGCACGGGGTGGG - Intronic
937856167 2:126673360-126673382 CTCTGTCCTCACCACAGCCTGGG + Intronic
948384332 2:237572213-237572235 CTGGGTCCCCACCCCGGCTGAGG + Intergenic
1172482285 20:35278034-35278056 CCCGGAACCCACCTCGGCGTCGG + Intergenic
1173799719 20:45887302-45887324 CCCAGTCCCCAACACGGAGTAGG + Intronic
1179527769 21:41994817-41994839 CTGGGTCCCTCCCACGACGTGGG - Intronic
1179993018 21:44958462-44958484 CACTGTCCCCACCACAGGGTGGG + Intronic
1181312393 22:21952467-21952489 CTCGGTCCCTACCAGGCCCTCGG + Intronic
1183590899 22:38778845-38778867 CTTGGTCCCCACCAAGGCTGGGG + Exonic
1183785438 22:40026591-40026613 CTCGGCCCCCACAACACCGTGGG - Intronic
961349142 3:126287841-126287863 CTCCGTCCCCATCACCGCGAGGG + Intergenic
961377386 3:126475866-126475888 CTTGGTCCCAGCGACGGCGTCGG + Exonic
968325820 3:197814355-197814377 CTGGGTCCCTCCCACAGCGTGGG + Intronic
969077740 4:4593560-4593582 CTCGGGACCCACCACCCCGTGGG - Intergenic
969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG + Intergenic
973954587 4:56049644-56049666 CTCGGTCCCGACCGCGGCAAGGG + Intergenic
1002033666 5:176448816-176448838 CTTAGTCCCCACCGCGGAGTTGG + Intronic
1006641271 6:35490996-35491018 CTCAGGCCCCACCCCGGCCTTGG - Intronic
1010690965 6:78910684-78910706 CCCGCTCCTCACCTCGGCGTGGG + Intronic
1013793436 6:113859539-113859561 CTCCCTCCCCACAACGGCGGGGG + Intronic
1019618279 7:1977061-1977083 CTCTGCCCCCAGCCCGGCGTGGG - Intronic
1020083185 7:5297242-5297264 CTCTGTCCCCACCGCTTCGTCGG + Intronic
1025211099 7:57019957-57019979 CTCTGTCCCCACCGCGACGTAGG - Intergenic
1025660856 7:63556890-63556912 CTCTGTCCCCACCGCGACGTAGG + Intergenic
1033261382 7:139846833-139846855 CTCTGTCCCCACCACACCATTGG - Intronic
1038355477 8:26825184-26825206 CTCGGTCCCCACATCTGTGTTGG + Intronic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1055148592 9:72966527-72966549 ATAGGTGCCCACCACTGCGTCGG + Intronic
1062117385 9:134816734-134816756 TTCGGTCCCCACCACAACCTGGG - Intronic
1185846966 X:3446847-3446869 CTCGGTCCCTCCCATGACGTGGG - Intergenic
1186487478 X:9944720-9944742 CTCGGCCCCCAGCACGGTGTTGG - Exonic
1197774648 X:130111079-130111101 CGCGGTCGCCAGCACGGCATGGG + Intergenic