ID: 1085235098

View in Genome Browser
Species Human (GRCh38)
Location 11:75008483-75008505
Sequence GTGGATAGGAATAGGGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 546}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085235091_1085235098 15 Left 1085235091 11:75008445-75008467 CCTTGTTTAGCAAAGCTTTCCTG 0: 1
1: 0
2: 0
3: 26
4: 214
Right 1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG 0: 1
1: 0
2: 3
3: 47
4: 546
1085235092_1085235098 -4 Left 1085235092 11:75008464-75008486 CCTGAACACTGTACTGCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG 0: 1
1: 0
2: 3
3: 47
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085235098 Original CRISPR GTGGATAGGAATAGGGAGGA TGG Exonic
900391611 1:2436276-2436298 GAGGAAAGGAGGAGGGAGGAAGG - Intronic
900391693 1:2436510-2436532 GAGGAAAGGAGGAGGGAGGAAGG - Intronic
900574395 1:3375873-3375895 GAAAATAGGAATAGGAAGGAAGG + Intronic
901224729 1:7606701-7606723 GGGGATGGGAACATGGAGGATGG + Intronic
901693586 1:10990327-10990349 GTGGTTAGGAGTTGGGAGCACGG + Intergenic
901844034 1:11971055-11971077 GTGGAGAGGAGTAGGGAGCCTGG + Intronic
901943626 1:12683416-12683438 GTGGAGAGGAAAAGGCAGGAGGG + Intergenic
902186798 1:14731494-14731516 GTGGGAAGGGAAAGGGAGGATGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902722839 1:18315577-18315599 GTGGATGGGTAGAGGGTGGATGG + Intronic
902922101 1:19672204-19672226 ATGGATGGGAGTGGGGAGGAAGG - Intronic
903429297 1:23280327-23280349 GTGGAGGGGAAAAGGGTGGAAGG + Intergenic
903573955 1:24326326-24326348 GTGGAGGGGAAGAGGGAGAATGG - Intronic
904455481 1:30645471-30645493 GTGGAAAGGGAGAGAGAGGAAGG - Intergenic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905405804 1:37731646-37731668 GTGAACAGGAACAGGGAGGCAGG + Intronic
906444429 1:45882574-45882596 GTCGGGAGGAATGGGGAGGAGGG - Intronic
907364484 1:53946897-53946919 TAGGATAGGAATAGAGAGGGTGG + Intronic
907752565 1:57276955-57276977 GTGGAAGGAAAGAGGGAGGAAGG + Intronic
908002567 1:59694898-59694920 TTGGATAGGCATAGAGAGTATGG + Intronic
908937302 1:69391486-69391508 GTGAATAGGAATGGTGAGGGGGG + Intergenic
909847783 1:80417679-80417701 GTTGAGAGGATAAGGGAGGAAGG - Intergenic
909932218 1:81509441-81509463 GTGGATTTGAATAGGGCAGAAGG - Intronic
911250339 1:95569481-95569503 GGGGATAGGATTAGGGAAGTTGG - Intergenic
911367936 1:96962027-96962049 GTGAATAGGAAATGGTAGGAGGG + Intergenic
911575864 1:99577185-99577207 GTGAAAGGGAAAAGGGAGGAGGG + Intergenic
911801966 1:102152189-102152211 GAGTGTAGGAATATGGAGGAAGG - Intergenic
912552290 1:110492116-110492138 GTGCAAAGAAAAAGGGAGGAGGG - Intergenic
912819193 1:112853662-112853684 GGGGCTAGGGATAGGGAGAAAGG + Intergenic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
913397951 1:118393409-118393431 GTGAAGAGGAATAGGAAGGAGGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913460810 1:119084257-119084279 GTTGCTAGGGATGGGGAGGAGGG + Intronic
913488364 1:119355028-119355050 GTTGAAAGGGATGGGGAGGAGGG + Intergenic
913540966 1:119820825-119820847 GGGGATAGGAGTAGAGGGGAGGG - Intergenic
914460328 1:147877868-147877890 GAGGATATGAAAAGTGAGGAAGG + Intergenic
915318446 1:155042887-155042909 GTAGATAGGGAGTGGGAGGAGGG + Intronic
916412333 1:164559013-164559035 GGGGAGAGGAGGAGGGAGGAGGG - Intronic
916763080 1:167834412-167834434 GTTGTTGGGAATAGGGAGGTTGG - Intronic
917621131 1:176797163-176797185 GTTGTTACCAATAGGGAGGAAGG + Intronic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
917808987 1:178639152-178639174 AGGGATGGGAATAGGGATGAGGG - Intergenic
919240592 1:194911361-194911383 GTGGATGGGACCAGGGAGGTAGG - Intergenic
919458282 1:197846152-197846174 GGGGATAGGAAGGGAGAGGAAGG - Intergenic
919706305 1:200679401-200679423 GAGGGAAGGAATAGGGTGGAAGG - Intergenic
920007116 1:202841539-202841561 GTGGACAGGACAACGGAGGAGGG - Intergenic
920097022 1:203492872-203492894 GTGGAAAGGAGTAGGGAACAAGG + Intergenic
920282756 1:204856671-204856693 GGGGATAGGGAGAGGGAGAATGG - Intronic
920846052 1:209593911-209593933 GTGGGTAGGAAGAGGCAGGCAGG - Intronic
921850377 1:219927827-219927849 GTGGAAAGGAAGCGGGAGAAGGG - Exonic
922454834 1:225766290-225766312 GTGCCTGGGAATAGTGAGGATGG - Intergenic
922504458 1:226118550-226118572 GGAGATGGGAAGAGGGAGGAAGG + Intergenic
922849145 1:228717521-228717543 CTGGAGAGGGATAGGTAGGATGG + Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1064336377 10:14447232-14447254 GTGGAAAGGAAGAGGGAGAGAGG + Intronic
1064531934 10:16319310-16319332 GTGGACATGAATAGAGAGCAAGG - Intergenic
1064698163 10:17988833-17988855 GTGAAAGGGAAAAGGGAGGAAGG - Intronic
1064953186 10:20877629-20877651 TTGGAAAGGAAAAGGGAAGATGG - Intronic
1065788822 10:29241532-29241554 CGGGATAGAAATAGAGAGGATGG + Intergenic
1065834195 10:29642036-29642058 CTAGACAGGAATAGGAAGGATGG - Intronic
1066282658 10:33932664-33932686 GTGGATGGGAAGAGGAAGAAGGG - Intergenic
1066533857 10:36369139-36369161 ATGGAAAGTAATAGGAAGGAAGG + Intergenic
1066743574 10:38581561-38581583 GTGGAAAGGAATAGAGTAGAAGG + Intergenic
1067552152 10:47243702-47243724 GTGGAAGGGAATAGGGAGAGTGG + Intergenic
1067947782 10:50701304-50701326 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1068886013 10:62097875-62097897 GAGGGAAGGAATTGGGAGGAGGG + Intergenic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069818852 10:71215318-71215340 GTGGATAAGAATAGGAGGGAGGG - Intronic
1070473879 10:76813126-76813148 GTAGATAGGGATAAGGAGGTTGG - Intergenic
1070883099 10:79866297-79866319 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1071649667 10:87382612-87382634 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1072167585 10:92829116-92829138 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1072255548 10:93617043-93617065 GAGGAAAGGAAGAGAGAGGAAGG - Intronic
1072444820 10:95489840-95489862 GGGGGTTGGAATAGGAAGGAAGG - Intronic
1072913923 10:99525807-99525829 GTGGATGGGCATGGGGAAGAAGG - Intergenic
1074074776 10:110113054-110113076 GTTGATATGAAAAGGTAGGAGGG - Intronic
1076350484 10:129811716-129811738 GTGGATAGGGATGGGGAGAAGGG - Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076934000 10:133555439-133555461 CTGGACAGGAAGAGGTAGGATGG + Intronic
1077532877 11:3105523-3105545 GTGGAGAGGGTTAAGGAGGACGG - Intronic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078143014 11:8705246-8705268 GTGGAGAGAAATAGGGAAGAGGG - Intronic
1078447354 11:11414380-11414402 GTGGTAAGGAAGCGGGAGGATGG - Intronic
1080438091 11:32264783-32264805 CTGGATAGGAATGGCGAGAAAGG + Intergenic
1080547615 11:33336446-33336468 CTGAATGGGAATAGAGAGGAAGG - Intronic
1080807552 11:35668357-35668379 GTGGATAGGGGGTGGGAGGAAGG - Intronic
1081134778 11:39426710-39426732 GTGGAGAGGAAAGGGGAGGATGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082791271 11:57348091-57348113 GGGGAAGGGAAGAGGGAGGAAGG + Intronic
1083300106 11:61735679-61735701 GAGGACAGGAAGAGGGAGGCAGG - Intronic
1084852725 11:71955896-71955918 GTGGGTAGGAAAAGGAAGGAGGG + Intronic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1084978944 11:72818383-72818405 AGGGACAGGAATAGGGAGGAGGG - Intronic
1085147916 11:74219745-74219767 GTGGATGGGGAGAGGGAGGTGGG + Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1085697143 11:78714694-78714716 GTGGCCAGGTGTAGGGAGGATGG - Intronic
1086393551 11:86390692-86390714 GTGGGTAGGAAGAGGAAGGAAGG + Intronic
1087076976 11:94134636-94134658 GGGGAGAGGAAGAGGGAGGGGGG - Intronic
1087300192 11:96424132-96424154 GTGGGGAGGAATATGGAAGAGGG - Intronic
1087322198 11:96676754-96676776 TTGGAAAGGAAAAGGGAAGATGG + Intergenic
1087686620 11:101272687-101272709 GTCTATAGGAACAGGGAGGTTGG + Intergenic
1088231422 11:107677134-107677156 GGGGTGAGGTATAGGGAGGAGGG + Intergenic
1088616468 11:111634624-111634646 TTTGATAGTAATATGGAGGATGG - Intronic
1088744468 11:112794065-112794087 GGGGAAAGGGATAGTGAGGAAGG + Intergenic
1088919860 11:114252863-114252885 GAGGATGTGAATTGGGAGGACGG + Intergenic
1090246068 11:125216736-125216758 GTGGAGGGGAGGAGGGAGGAGGG - Intronic
1090477796 11:127039222-127039244 TTGGATGGGAATAGACAGGATGG + Intergenic
1090779977 11:129999274-129999296 GGGGATAGGTAGAGGCAGGAGGG - Intronic
1090983834 11:131748556-131748578 GTGGATGGGCACAGGGAGGAGGG - Intronic
1091131742 11:133152510-133152532 GTGGAGAGGATTAGGGAGGGTGG - Intronic
1091294557 11:134464492-134464514 GTGAAAAGGAATGGGGAGGCAGG - Intergenic
1092219240 12:6701304-6701326 GAGGAAAGGACTGGGGAGGAAGG + Intergenic
1092758268 12:11785104-11785126 GAGGATAGGAAGAGGGAGAGTGG + Intronic
1093964446 12:25310216-25310238 ATGGATAGGAATAGAGACAAAGG - Intergenic
1094227469 12:28062098-28062120 TTGGATAGGAAGAGCCAGGATGG - Intergenic
1094583981 12:31759976-31759998 GTGGATAGGTATATGGAGTGGGG + Intergenic
1096558596 12:52419494-52419516 GAGGAGAGGAACAGGGAGAAAGG + Intergenic
1096848293 12:54419512-54419534 CTGGAAAGGAATGGGGAGGAAGG - Intergenic
1098027067 12:66214921-66214943 TTGGATAGGAGTGGGGAAGAAGG + Intronic
1098199396 12:68038910-68038932 GTGGGTGGGAGTAGGGAGGGGGG - Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1100275499 12:93068280-93068302 GTGGAGGGGAAAAGGGATGAGGG - Intergenic
1101061603 12:100978243-100978265 GAGGATTGGAGTAGGGAGAAAGG + Intronic
1101598423 12:106188286-106188308 GTGGAGAGGAGTGTGGAGGAGGG - Intergenic
1102812714 12:115838132-115838154 GTGGACAGGTAGAGGGCGGAAGG + Intergenic
1102983709 12:117262384-117262406 GGGGATGGGATTAGGGTGGAAGG + Intronic
1103242840 12:119429291-119429313 GAGGAAAGGAATAGGGAGTGAGG - Intronic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103940085 12:124496640-124496662 GTGGAGGGGCATTGGGAGGAAGG + Intronic
1103948174 12:124538468-124538490 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1104189090 12:126460534-126460556 GTGTATAGGTATAGGTAGGGAGG + Intergenic
1104628453 12:130379385-130379407 TTGGATGGGAATTGGGATGAGGG - Intergenic
1104628533 12:130379825-130379847 TTGGATGGGAATTGGGATGAGGG - Intergenic
1104628581 12:130380089-130380111 TTGGATGGGAATTGGGATGAGGG - Intergenic
1104628606 12:130380221-130380243 TTGGATGGGAATTGGGATGAGGG - Intergenic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1105836491 13:24216663-24216685 GGGGCTAGGAAGAGGAAGGACGG + Intronic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106026533 13:25960599-25960621 CTGGCTAGGAATTGGGAGGCTGG - Intronic
1106330952 13:28739149-28739171 GTGGAAAGTAAAAGGGAGAAGGG + Intergenic
1106409491 13:29501348-29501370 GTGGCCAGGAATAGGCAAGATGG - Intronic
1106583228 13:31035496-31035518 GTGTATCGGAATATGGATGAAGG - Intergenic
1106603535 13:31207808-31207830 GTGGAGAGAAGTAGTGAGGAAGG - Intronic
1107197631 13:37672519-37672541 GTGGATAGGAATCATAAGGAGGG - Intronic
1107499477 13:40958368-40958390 GTTCACAGGAATACGGAGGAAGG + Intronic
1107763009 13:43701997-43702019 GGGGATAGGGATAGGATGGAGGG - Intronic
1107819613 13:44274357-44274379 GAGAATAGGCATAGGGAGGCAGG - Intergenic
1108379510 13:49842653-49842675 GTGGATAGGATTTGCGAGCATGG + Intergenic
1108587109 13:51879838-51879860 GTGGTTAGGAATGTGGAGAAAGG + Intergenic
1108722358 13:53145347-53145369 GAGGAGAGGAGAAGGGAGGAGGG - Intergenic
1111596164 13:90414256-90414278 TTGCATAGAAATAGGGAGGGAGG - Intergenic
1112203973 13:97305898-97305920 GAGGAGCGGAACAGGGAGGAAGG + Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1112467760 13:99658624-99658646 GTGGACAGGAACAAGGAGGTGGG + Intronic
1112775490 13:102839342-102839364 GTAGAGAGGCATGGGGAGGAAGG + Intronic
1113100009 13:106707080-106707102 GTGGGAAGGAGTAGGGAGGTTGG + Intergenic
1113508833 13:110835297-110835319 GTGGATGGGAATGGGGTGAAAGG + Intergenic
1114812942 14:25921693-25921715 GTGGTTACAAATGGGGAGGATGG + Intergenic
1116294905 14:43094582-43094604 GTGGGTAGGGGTTGGGAGGAGGG + Intergenic
1118203323 14:63697987-63698009 GTCAATAGGGATAGCGAGGAGGG + Intronic
1118371888 14:65144436-65144458 GTGGAGAGGCATCGGGTGGAGGG + Intergenic
1120161416 14:81149306-81149328 GTGCATGGGAGTGGGGAGGAGGG - Intergenic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1121578397 14:95007417-95007439 TGGGATGGGAATAGGGAGGCAGG + Intergenic
1121598842 14:95187485-95187507 GGGGATTGGAATAGGAGGGATGG + Exonic
1122499661 14:102188368-102188390 GTGGACAGAAATGTGGAGGAAGG - Intronic
1122748442 14:103915096-103915118 TTGGATAGGAATGGGGCTGATGG - Exonic
1124091642 15:26609574-26609596 GTAGACATGAATAGGGAAGATGG - Intronic
1124411600 15:29442013-29442035 CTGGAGAGGAATTGGGAGGGAGG - Intronic
1124462544 15:29906073-29906095 GTGGATATTAATAGTGAGGGAGG + Intronic
1125591072 15:40854737-40854759 CTGGATGGAAATAGTGAGGATGG - Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1126869868 15:52976392-52976414 GTGGATGGGAAGAGGGCAGAGGG + Intergenic
1126897496 15:53274919-53274941 GGGGATATTAAAAGGGAGGAGGG - Intergenic
1128393302 15:67197946-67197968 ATGGATAGAAATAGAGAAGAGGG - Intergenic
1128850044 15:70945100-70945122 GTGAAGAGGAATGGAGAGGAGGG - Intronic
1129062078 15:72868198-72868220 GTGGCTTGGAAGATGGAGGAAGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130061368 15:80572492-80572514 GTGGGTAGGAAGAGAGGGGAGGG - Intronic
1130229049 15:82082498-82082520 GTGGACAGGAGCAGGCAGGAGGG + Intergenic
1130642593 15:85692570-85692592 GTGGTTAAGAATACGGACGATGG - Intronic
1130717380 15:86348477-86348499 GGTGGTAAGAATAGGGAGGAGGG + Intronic
1131837824 15:96408600-96408622 GTGGGTAGGAATAAGGAGGCAGG - Intergenic
1131880881 15:96860671-96860693 GTGGGTAGGGATTGGAAGGAAGG - Intergenic
1132758810 16:1499111-1499133 GTGGCTAGGAATTGGCAGGCCGG + Intronic
1132868280 16:2104364-2104386 GAGGATGGGAATTGGGGGGAGGG + Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134523455 16:14928655-14928677 GAGGATGGGAATTGGGGGGAGGG - Intronic
1134711049 16:16327139-16327161 GAGGATGGGAATTGGGGGGAGGG - Intergenic
1134948534 16:18341470-18341492 GAGGATGGGAATTGGGGGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1135892935 16:26373855-26373877 GTGGATAGGTATATGGGTGATGG + Intergenic
1136040226 16:27572707-27572729 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1136081301 16:27854198-27854220 GGGGAGAGGAAGGGGGAGGATGG + Intronic
1136356331 16:29746666-29746688 GTGGATAAGACAAGGCAGGATGG - Intergenic
1137328637 16:47468173-47468195 GTGGCTTGGACTAGGGAGGTAGG - Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1138223029 16:55269239-55269261 GTGGATAGGTAGGTGGAGGATGG - Intergenic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1139762890 16:69201441-69201463 ATGGAAAGGATTAGGGAGGCGGG + Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140938420 16:79697647-79697669 GTGGAAAGAAAGTGGGAGGAAGG - Intergenic
1141323060 16:83030125-83030147 GTGGGAAGGAATAGGGAAGATGG - Intronic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1141854858 16:86673975-86673997 GTGGATAGGAGAATGGATGAAGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142665372 17:1460217-1460239 TGAGATAGGAATTGGGAGGAAGG + Intronic
1143249890 17:5515302-5515324 GTGGATAGGACAAGGGGGTATGG + Intronic
1143823502 17:9585069-9585091 GTGCACAGGCATAGGGAGAATGG - Intronic
1143874316 17:9980346-9980368 CTGGATCGGAAGAGGGAGGTGGG - Intronic
1144093637 17:11880645-11880667 GTGGAGAGGAAAAGAGAGGAAGG + Intronic
1144141618 17:12355051-12355073 GTGCACTGGAGTAGGGAGGAGGG - Intergenic
1144782911 17:17816830-17816852 GTGGCTAGGCACAGGGAGGACGG + Intronic
1145067789 17:19773864-19773886 GTGAATAGGAGCCGGGAGGAGGG - Intronic
1146274305 17:31506532-31506554 GAGGGTAGGAGAAGGGAGGACGG - Intronic
1146490694 17:33279467-33279489 GAGGATGGGAAGAGGGAGGTCGG + Intronic
1147011907 17:37456470-37456492 GGGAATAGGATTAGGGATGAAGG + Intronic
1147165327 17:38590134-38590156 GTGGATTGGAGAAGGGAGGGTGG - Intronic
1147833996 17:43317131-43317153 GAGGCTGGGAATAGGGAGGATGG - Intergenic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1149628008 17:58093680-58093702 GTAGAGAGGAGTAAGGAGGAGGG - Exonic
1149962547 17:61127799-61127821 GGGGAGTGGAATAGGGAGGAAGG + Intronic
1150943955 17:69724132-69724154 AGGGAAGGGAATAGGGAGGAAGG + Intergenic
1151080507 17:71324002-71324024 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1151719640 17:75847808-75847830 GTGGATAGGGGTAGCCAGGAGGG + Exonic
1151841378 17:76620505-76620527 CTAAATAGGAATAGGGCGGAAGG - Intergenic
1151996440 17:77612243-77612265 GGGGGTAGGAATATGGAGAATGG - Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1155341843 18:24821067-24821089 GAGGCTAGGAAGAGGCAGGAGGG - Intergenic
1155517861 18:26640977-26640999 GTGGATAGGAACAGGAAAGGGGG + Intronic
1156490386 18:37492433-37492455 GTGGATCGCAAGAGGGAGGGAGG + Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1157323951 18:46655948-46655970 GAGGACAGGAAGAGGGAGAAAGG + Intronic
1157363319 18:47039412-47039434 GAGGAGAGGACTGGGGAGGATGG - Intronic
1157618747 18:49003264-49003286 GTGGAAGGGAAAATGGAGGAGGG - Intergenic
1158233071 18:55280269-55280291 GTGCATAGGAAGCGGGAGGAGGG + Intronic
1158346850 18:56524598-56524620 GTGGATAGGAATGAGCAGGTGGG - Intergenic
1158678042 18:59540476-59540498 GTGTGTGGTAATAGGGAGGAGGG + Intronic
1160705099 19:525889-525911 GGGGATAGGAAGAGAGGGGAGGG + Intergenic
1160965764 19:1746282-1746304 GTGGGGAGGAAGGGGGAGGATGG + Intergenic
1161066751 19:2242407-2242429 GTGGCTGTGAATGGGGAGGAAGG - Intronic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161340583 19:3739793-3739815 GTGGCTATGAAGGGGGAGGAAGG - Intronic
1161485000 19:4530608-4530630 ATGGATAGGGACAGAGAGGAGGG + Intronic
1161535636 19:4817224-4817246 GAGGAAGGGAACAGGGAGGAGGG + Exonic
1162062741 19:8106829-8106851 GTGGATGGGAAATGGGTGGATGG + Intronic
1162513185 19:11132087-11132109 GTGGGTAGGGGTCGGGAGGATGG - Exonic
1162777246 19:12987354-12987376 GAGGAGAGGAAAAGGGGGGAGGG + Intergenic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163776992 19:19224674-19224696 GGGGATAGGGACAGGGAGGCAGG - Intronic
1164409667 19:27990403-27990425 GTGGATAGAAATAGGGTTGATGG - Intergenic
1165389589 19:35530632-35530654 GTGGAGAGGGATAGAGAAGATGG - Intergenic
1166181381 19:41111634-41111656 AAGGATAGGAATAGGGCGGGGGG + Intergenic
1166917479 19:46205359-46205381 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1167355765 19:49003159-49003181 GTGGGTGGGAGTAGGGAGCAGGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1168541420 19:57214271-57214293 TTGAATAGGAATAGTGAGAAAGG + Exonic
1168586262 19:57595734-57595756 GTGCACAGGAATATGGAGAAAGG - Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925171111 2:1750752-1750774 GTGGATGGGGATGGGGAGAAGGG - Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
926209784 2:10861442-10861464 TTGGGAAGGAATAGGGTGGAGGG - Intergenic
926266852 2:11330921-11330943 GAGGAGAGGAGGAGGGAGGAAGG + Intronic
926941193 2:18138696-18138718 GGGGATAGGAAAAGGAAGAAAGG - Intronic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928756043 2:34526816-34526838 GTGAAGAGGGGTAGGGAGGAAGG + Intergenic
928863349 2:35887228-35887250 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
929255453 2:39806382-39806404 TTGGATAGGAATGGTGAGAATGG + Intergenic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
930081128 2:47449639-47449661 GAGGATAGAAATTGGTAGGAAGG - Intronic
930185800 2:48411034-48411056 GAGGATAGGGATGGGGGGGATGG - Intergenic
931112723 2:59129803-59129825 TTTGAAAGGAATAGGGAGAATGG + Intergenic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
931847340 2:66218298-66218320 GTGAATAGGGATATAGAGGAGGG + Intergenic
932964786 2:76459551-76459573 GCAAATAGGAGTAGGGAGGAAGG + Intergenic
934061196 2:88295822-88295844 GTGAATAGGATTATGGAGGTAGG + Intergenic
934851885 2:97706999-97707021 CGGGATAGGAGAAGGGAGGAGGG + Intergenic
935375914 2:102397365-102397387 GTGCATAGGATGTGGGAGGAGGG + Exonic
937242219 2:120469563-120469585 GTGGGAAGGAAAAGGGAAGAAGG + Intergenic
937538116 2:122915964-122915986 GAGGGTAGGAAGTGGGAGGAGGG + Intergenic
938579770 2:132635521-132635543 TGTGAGAGGAATAGGGAGGAAGG + Intronic
938872416 2:135494088-135494110 ATGGATAGAAATAGAAAGGAGGG + Intronic
940356900 2:152753263-152753285 ATTCTTAGGAATAGGGAGGAAGG + Intronic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
942405932 2:175655030-175655052 TTGAATAGGAATAGTGAGAAAGG - Intergenic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
943522867 2:188975820-188975842 GTGGAGAGAGATAAGGAGGAGGG - Intronic
943665325 2:190602874-190602896 GTGGGAAGGAAGAGGGAGCAAGG + Intergenic
944474776 2:200092484-200092506 GTGGGTGGGGATAGGGAGGATGG + Intergenic
945365365 2:208946261-208946283 GAGGAGTGGAGTAGGGAGGAGGG + Intergenic
946176062 2:217922568-217922590 GGGGATTGGAAAAGGGAGGGAGG + Intronic
947751653 2:232535712-232535734 GTAGGTAGGAAGAGGGAGGCTGG - Exonic
948053309 2:234994133-234994155 GTGGAGGGGAAGAGGGAGGGAGG - Intronic
948703073 2:239772851-239772873 GAGGAAAGGAGGAGGGAGGATGG - Intronic
1169320749 20:4631491-4631513 GTGGCCAGAAGTAGGGAGGAGGG + Intergenic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1169696747 20:8397506-8397528 GTGGGTAGGAATAGGGTGGAAGG - Intronic
1171105957 20:22432551-22432573 GTGGAGAGTGCTAGGGAGGAAGG + Intergenic
1171108929 20:22462676-22462698 GTGGATGGGAAACCGGAGGAGGG - Intergenic
1171272382 20:23826926-23826948 GAGGACAGGAGTGGGGAGGAGGG - Intergenic
1171342996 20:24445179-24445201 GTGGGTAGGAAGAGGGAAGGGGG - Intergenic
1172917212 20:38452083-38452105 TTGGGTAGGAATAAGGAGGGGGG - Intergenic
1173002065 20:39111697-39111719 GAGGATAGAAAACGGGAGGAGGG + Intergenic
1173014113 20:39209483-39209505 GGGGGTGGGAATAGTGAGGAGGG - Intergenic
1173427386 20:42954924-42954946 GAGGAGAGGAAGAGGGAGAAGGG + Intronic
1173484847 20:43433442-43433464 GGGGAAGGGAATAAGGAGGAAGG + Intergenic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1174326373 20:49782074-49782096 GGGTAAAGGAACAGGGAGGAAGG - Intergenic
1174512499 20:51064735-51064757 ATGGATAAGAATAGGGTGAAAGG - Intergenic
1174532048 20:51221951-51221973 GTGGTTGGGACCAGGGAGGAAGG + Intergenic
1175278589 20:57788040-57788062 GTGGAGAGGAATAGCGGGGTGGG + Intergenic
1175417590 20:58811950-58811972 GTGGACAGGGATGGGGAGGCTGG - Intergenic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1175972276 20:62692666-62692688 GTGTAGAGGAAGAGGGAGGGAGG + Intergenic
1176529050 21:7944034-7944056 GTGGAGAGGAATGGAAAGGAAGG - Intergenic
1178925776 21:36773703-36773725 GTGGCGAGGAAGAGGGAGAAGGG + Intronic
1179001955 21:37469719-37469741 GAGGATAGCACTAGGGGGGATGG + Intronic
1179482411 21:41686546-41686568 GTGAATGGAAAAAGGGAGGAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1182894866 22:33850735-33850757 GTGGAGGGGGATAGGGCGGAGGG + Intronic
1183242948 22:36671953-36671975 GAGGATAGGAACAGGTAAGACGG + Intronic
1183251293 22:36732166-36732188 GTGCGTAGCAAGAGGGAGGAGGG - Intergenic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183608594 22:38882391-38882413 GTGGAGAGGAACAGGGCGCATGG + Intergenic
1184173295 22:42772117-42772139 GGGGATAGGAATATTGAAGATGG - Intergenic
1184731112 22:46371671-46371693 GTGGATATGAATAGGATGGTTGG - Intronic
1203297176 22_KI270736v1_random:51518-51540 GTGAAAAGGAATGGGAAGGAGGG + Intergenic
1203300431 22_KI270736v1_random:73336-73358 GTGGAAAGGAATGGAGTGGAGGG + Intergenic
1203300487 22_KI270736v1_random:73666-73688 GTGGAGTGGAATGGTGAGGAGGG + Intergenic
1203302560 22_KI270736v1_random:87229-87251 GTGGAATGGAATAGAGTGGAGGG + Intergenic
1203306855 22_KI270736v1_random:115270-115292 GTGGAGAGGACTAGAGTGGAGGG + Intergenic
1203308922 22_KI270736v1_random:128906-128928 GTGGACTGGAATGGAGAGGAGGG + Intergenic
1203310379 22_KI270736v1_random:138556-138578 GTGGAGTGGAATAGAGTGGAGGG + Intergenic
950170285 3:10834381-10834403 TTTCATAGGAAAAGGGAGGAAGG + Intronic
950543187 3:13624499-13624521 ATGGCTGGGAATGGGGAGGAGGG - Intronic
950822865 3:15780028-15780050 GTGGATAGGAGTGGTGAGGGTGG - Intronic
953389963 3:42528213-42528235 GTGGGAGGGAAGAGGGAGGAGGG - Intronic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
954156709 3:48689032-48689054 GTGGATAGTAGTAGGGAGGAAGG - Intronic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955402099 3:58599566-58599588 GTGGATGGGAAGGGGCAGGAGGG + Intronic
956246666 3:67191149-67191171 GTGGTCAGGAATAGTGAGGTTGG + Intergenic
956659062 3:71581962-71581984 GGGGGGAGGAATAGGGAGAAGGG + Intronic
957259900 3:77887420-77887442 ATTGAAAGGAATAGGGAGAATGG - Intergenic
958264786 3:91425358-91425380 GTGGATAGGAGTTGGAAGAAGGG - Intergenic
959701385 3:109302158-109302180 GTGGATAAGAGTATGTAGGAAGG - Intronic
960639925 3:119814866-119814888 GGCGAGAGGAAGAGGGAGGATGG - Intronic
960751823 3:120963313-120963335 TTGAATAGGAATAGTGAGAAAGG + Intronic
961701542 3:128748522-128748544 GTGTATAGGAAACTGGAGGAAGG - Intronic
962018804 3:131474400-131474422 GGGGATGGGAATGAGGAGGATGG + Intronic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962526276 3:136240609-136240631 AGGGATAGGAAAAGCGAGGATGG + Intergenic
963467408 3:145701064-145701086 GTTAAAAGGAATAGGGAGGGTGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963541798 3:146600377-146600399 CTGGATTGGAAGAGGCAGGAAGG + Exonic
963937482 3:151069031-151069053 GTGGATAGGAATAGAATGAAAGG + Intergenic
965635201 3:170773625-170773647 GAGGATAAGAATTGGGAGGAAGG + Intronic
966081746 3:176012913-176012935 GTGGATAGAATGTGGGAGGAGGG + Intergenic
966126283 3:176580485-176580507 GTGGAAGGGAATGGTGAGGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967869335 3:194217136-194217158 GGGGATAGGAATGGGTGGGAAGG + Intergenic
967892208 3:194371494-194371516 GGTGCTAGGATTAGGGAGGATGG - Intergenic
968471185 4:783152-783174 GTGGATGGGAAATGGGAGGCTGG + Intergenic
969367391 4:6705165-6705187 GTGGCTTGGAGTAGGAAGGAAGG + Intergenic
969501176 4:7554175-7554197 GAGGACAGGACCAGGGAGGACGG + Intronic
970495075 4:16616994-16617016 GGGGAGAGGAAAGGGGAGGAGGG - Intronic
970795215 4:19904325-19904347 GTGAATTGGACTAGGGAAGAAGG - Intergenic
971961703 4:33496477-33496499 GAGGATGGGAATATGCAGGATGG - Intergenic
972022114 4:34327822-34327844 GTGGGTGGGAAGTGGGAGGAGGG + Intergenic
972337411 4:38119746-38119768 GAGGATGGAAATGGGGAGGAGGG + Intronic
972813157 4:42613036-42613058 GTGTATAGGAGTGGGGAGGGAGG - Intronic
974787502 4:66638701-66638723 TTGAATAGAAATAGGAAGGAAGG + Intergenic
976164759 4:82242391-82242413 GTTCATAGGAATGGGAAGGAAGG + Intergenic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
977783943 4:101010873-101010895 GGAGATAGGAGTAGAGAGGAAGG + Intergenic
978346755 4:107777998-107778020 GAGGAGAGGAAAAGAGAGGAGGG + Intergenic
978501989 4:109419608-109419630 GTAGATGGGGGTAGGGAGGAAGG + Intergenic
978578155 4:110206541-110206563 GTGGACATGAATTTGGAGGAAGG + Intergenic
978686311 4:111448491-111448513 ATTTAAAGGAATAGGGAGGATGG + Intergenic
979535334 4:121813190-121813212 GTGGGAAGGAAGGGGGAGGAAGG - Intronic
981289603 4:143058925-143058947 GAGGATAGAGATTGGGAGGAGGG - Intergenic
981731827 4:147907630-147907652 GTGTATAGGAAAAGAGAGCAAGG + Intronic
983761914 4:171420165-171420187 GCAGATAGGAATAGGGAGATAGG - Intergenic
983928888 4:173432198-173432220 GTAGATAGAAAGAGGGAGGGAGG - Intergenic
984044027 4:174775248-174775270 GTGGATAGGAATAGTAAAAATGG + Intronic
984703717 4:182833812-182833834 GGGGAGAGGAGAAGGGAGGAGGG - Intergenic
984703945 4:182834458-182834480 GGGGAGAGGAGAAGGGAGGAGGG - Intergenic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
987441707 5:17964955-17964977 GTGGAGAGAAATAGAGAGAAAGG - Intergenic
988000935 5:25347473-25347495 TTGGCAAGGAATAGTGAGGATGG - Intergenic
988138273 5:27202459-27202481 TTGGATAGGAATAGTGAGAGAGG - Intergenic
988302673 5:29451117-29451139 GTTGCTAGAAATAAGGAGGATGG - Intergenic
988922202 5:35953935-35953957 GTGTCTAGGAAAAGGGAGAAAGG + Exonic
989023287 5:37036044-37036066 TTTGATTGGAATAGGGAGAAAGG + Intronic
989122746 5:38020648-38020670 ATGGATGGGAGTAGGGAGGCAGG - Intergenic
989595050 5:43148893-43148915 GAAGATAGGAATAGGGAGAGAGG - Intronic
990050795 5:51497387-51497409 GTGGAGAGGGATGGGCAGGAAGG - Intergenic
990169611 5:53033285-53033307 GGGGATAGGAAGAGGTAGGGAGG - Intronic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990471624 5:56121145-56121167 GTGTATAGGAATAGAGATGGAGG - Intronic
990982414 5:61614114-61614136 GTGGCCAGGAATAGGGGTGAGGG + Intergenic
991396738 5:66211713-66211735 GTAGATAAGAATTGGGAGCAGGG - Intergenic
991670554 5:69043215-69043237 TTGGATAGGAATAAGACGGAAGG - Intergenic
992111785 5:73501243-73501265 ATGAATAGGAATAGGGATGGAGG + Intronic
994016802 5:94976076-94976098 GTGGATAAGAGTAGGGAATAAGG - Intronic
994309222 5:98247897-98247919 GTGGATAGGTATAGGAGGGAGGG + Intergenic
994691671 5:103027304-103027326 GTGGAAAGAAATAGGCAAGAAGG - Intronic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
995993536 5:118271782-118271804 GTGGATAGGAGTAGGTAGAACGG + Intergenic
996618553 5:125471646-125471668 GGGGAAAGGAATAGGCAGGAAGG - Intergenic
997266121 5:132496357-132496379 GTGGGGAGGAATAGGTAGGGAGG - Intergenic
997410508 5:133687273-133687295 GTGGACTGGACTGGGGAGGAGGG + Intergenic
998300127 5:141010008-141010030 GTAGATAGGAAAAAGGAGCAGGG - Exonic
998734474 5:145120067-145120089 TGGGAGAGGGATAGGGAGGATGG + Intergenic
998952663 5:147407341-147407363 GGAGACAGGAATAAGGAGGAGGG + Intronic
999073588 5:148773670-148773692 GTGGATAAGAGAAGGGTGGAGGG + Intergenic
999149012 5:149414587-149414609 GTGGAAAGGAAGTGGGAGGTAGG - Intergenic
1000193552 5:158936903-158936925 GTGGCTAGTCATAGGAAGGAGGG + Intronic
1000353800 5:160373870-160373892 GTGGATAGAAAGAGGAAAGAAGG - Intergenic
1000503135 5:162077922-162077944 GAGGAAAGGAGGAGGGAGGAAGG + Intronic
1000510676 5:162178135-162178157 GTGGATAGGAAAACTGATGAAGG - Intergenic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1001002198 5:168018195-168018217 GAGAAGAGGAATAGGGAGAAAGG - Intronic
1001116493 5:168945006-168945028 GAGGAAAGGAAGAGGAAGGAGGG + Intronic
1002109393 5:176898103-176898125 GTGTGTGGGAATGGGGAGGAGGG - Intronic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1003025281 6:2549672-2549694 GTGGGTAGGAAAAGGGATGAAGG + Intergenic
1003360982 6:5424994-5425016 GTGGAAAGAAAAAGGAAGGAGGG - Intronic
1003382737 6:5639633-5639655 GTGGATAGAAGAAGAGAGGAAGG - Intronic
1005105745 6:22222727-22222749 GGGGAAAGGAGGAGGGAGGAAGG - Intergenic
1005363430 6:25054031-25054053 GTTGATAGGAACAGGAAGCAGGG - Intergenic
1005774373 6:29114734-29114756 GTGGAGAGAAATAGGGAAAATGG - Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006188310 6:32192545-32192567 GTGGCTGGGATTTGGGAGGAGGG + Exonic
1006239289 6:32663761-32663783 GTGGATAGTGATGGGGGGGAGGG + Intronic
1007741022 6:44009574-44009596 GAGGAAGGGAAGAGGGAGGAAGG + Intergenic
1008124009 6:47648644-47648666 GAGGAGGGGAAAAGGGAGGAAGG - Intergenic
1008443475 6:51559815-51559837 GTGGAAAGGAGTAGGGTGGCAGG + Intergenic
1008477670 6:51949679-51949701 GTGGATAGGATTATGGAGCGTGG - Intronic
1008888184 6:56454316-56454338 GAGGAAAGGATTTGGGAGGAAGG - Intergenic
1008990600 6:57597302-57597324 GTGGATAGGAGTTGGAAGAAGGG + Intronic
1009179175 6:60495848-60495870 GTGGATAGGAGTTGGAAGAAGGG + Intergenic
1009482903 6:64182837-64182859 GTAGACAGGAGTAGGGTGGAAGG - Intronic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1012375749 6:98559857-98559879 TTAGAAAGGAAGAGGGAGGAAGG - Intergenic
1013033155 6:106355957-106355979 TGGGATAGGAATGGAGAGGAGGG - Intergenic
1013198203 6:107864443-107864465 GTGGAGGGGATTAGGGAGGAGGG + Intergenic
1013857946 6:114597369-114597391 GTGAATAGGAACAGGGAGTGTGG - Intergenic
1015097183 6:129429731-129429753 AGGGCTGGGAATAGGGAGGAAGG + Intronic
1016170920 6:141015559-141015581 ATGGAGAGGAATAGGAAGGATGG + Intergenic
1016371735 6:143381874-143381896 GTGGTTAGGGAAAGGAAGGAAGG + Intergenic
1016388477 6:143551575-143551597 GATGATAGGAACAGGAAGGAAGG + Intronic
1017974516 6:159344681-159344703 GTGGGTGGGAGTGGGGAGGAAGG + Intergenic
1018292244 6:162303894-162303916 GAGGATAGGAATGAGGAGGGAGG + Intronic
1018510365 6:164518336-164518358 GGGGACAGGAATAGTGAGGAGGG + Intergenic
1018634753 6:165851015-165851037 GTGTATAGGAAGAGAAAGGAAGG + Intronic
1019160781 6:170066067-170066089 AGGGATAGGGATAGGGTGGATGG - Intergenic
1019986003 7:4656421-4656443 CTGGATAGGAAAAGGGGGAAGGG - Intergenic
1021135017 7:16954975-16954997 GTGGATGGGAAGAGGGTGGATGG - Intergenic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021420005 7:20435920-20435942 GAGGACAGGAAAAGAGAGGAAGG + Intergenic
1021830110 7:24597973-24597995 GGGGATAAGAATAGGAAGGAAGG + Intronic
1022304856 7:29137499-29137521 TTGGAAAGGAAAAGGGAAGACGG + Intronic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1023770944 7:43556215-43556237 GAGGCAAGGAATAGGGAGAAGGG + Intronic
1023771452 7:43560444-43560466 GGGGAAAGGGACAGGGAGGAGGG + Intronic
1024136436 7:46413353-46413375 ATGGCTATGAATAGGGAGGGAGG + Intergenic
1024154232 7:46603821-46603843 GTGGAAAGGGTGAGGGAGGATGG - Intergenic
1025837918 7:65113029-65113051 GAGAATGGGAAAAGGGAGGAAGG + Intergenic
1025879351 7:65520050-65520072 GAGAATGGGAAAAGGGAGGAAGG - Intergenic
1025885150 7:65582951-65582973 GAGAATGGGAAAAGGGAGGAAGG - Intergenic
1026638660 7:72105827-72105849 GGGGATAGGGATGGGGATGAGGG + Intronic
1026877984 7:73890625-73890647 GTGGAGAGGAGACGGGAGGAAGG - Intergenic
1027191104 7:75995872-75995894 GTGGATAGGGAGATGGGGGAGGG + Intergenic
1028075345 7:86505847-86505869 GAGGGTGGGAGTAGGGAGGAAGG + Intergenic
1028365973 7:90032726-90032748 GTGTATAGGAACATGAAGGAGGG - Intergenic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1028639496 7:93027229-93027251 GTGGGTAGGTAAAGGGAGGGGGG + Intergenic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1031168454 7:118260651-118260673 GAGGGGAGGAAAAGGGAGGAAGG - Intergenic
1032283845 7:130526716-130526738 GTGGACAGCAATGGGCAGGAAGG + Intronic
1032284572 7:130530948-130530970 GTGGACAGCAATAGACAGGAAGG + Intronic
1032285397 7:130535526-130535548 GTGGACAGCAATGGGCAGGAAGG + Intronic
1032286182 7:130539925-130539947 GTGGACAGCAATGGGCAGGAAGG + Intronic
1032491377 7:132326907-132326929 GGGGAAAGGAAGAGGGAGGGAGG + Intronic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033630536 7:143153325-143153347 GAGGAGAGGAATGGGGAGAAGGG - Intergenic
1034308216 7:150063882-150063904 GCGTATAGGAAGAGGGAGGGGGG - Intergenic
1034917496 7:155052944-155052966 GTGGACAGGAATAGGCATCATGG - Intergenic
1035003876 7:155640840-155640862 GTGGATTGGCAAAGTGAGGAGGG - Intronic
1035603870 8:916145-916167 GTGGATAGGAAAAGAGAGTGCGG - Intergenic
1036130395 8:6104253-6104275 GGGGATGGGAATGGAGAGGAGGG + Intergenic
1036559048 8:9885960-9885982 GTTGATAGGAGAGGGGAGGATGG - Intergenic
1036621013 8:10424585-10424607 GTGGAGAGGGACAGGGAGAAGGG + Intronic
1036956472 8:13193059-13193081 TTGGATAGGAACAGAGAGGAGGG - Intronic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1037852574 8:22344421-22344443 GGGGATAGGAGGTGGGAGGAGGG + Intronic
1037894131 8:22640693-22640715 GGGGATTGCAAAAGGGAGGAAGG - Intronic
1041122098 8:54596879-54596901 GAGAATAGGAATAGAAAGGAAGG - Intergenic
1041125663 8:54635967-54635989 GAGGAGAGGAAGAGGGAGAAAGG - Intergenic
1041167190 8:55102054-55102076 GAGGAGAGGAAGCGGGAGGAGGG + Intergenic
1041601075 8:59717902-59717924 TTGGCAAGGAATAGGGAAGATGG - Intergenic
1041981602 8:63867858-63867880 GTGGGTAGGGATTGGGAGGAAGG - Intergenic
1042421025 8:68589661-68589683 GAGGAAAGGAGAAGGGAGGAAGG + Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045400445 8:101811315-101811337 TTGGCTAGGAAGATGGAGGAAGG + Intronic
1045478040 8:102569672-102569694 GAGGAGAGGAAAAGAGAGGAGGG - Intergenic
1045704151 8:104900618-104900640 GTCTATAGGAATGGGGAGGACGG - Intronic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1048240649 8:132738454-132738476 GTGGCAGGAAATAGGGAGGAAGG - Intronic
1048329101 8:133460256-133460278 GAGGGAAGGAATAGGAAGGAGGG + Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1050263328 9:3863888-3863910 GTGGAAAGAAAAAGGGAGGAGGG + Intronic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1050790550 9:9463367-9463389 GTGGGTTGGAAGAGGGAGGGAGG + Intronic
1051368508 9:16338607-16338629 GTGATTAGGAAAAGGGAGCAGGG - Intergenic
1051400778 9:16679726-16679748 ATGGAGAGGAAAAGGCAGGAAGG + Intronic
1051435478 9:17026546-17026568 GTGGACAGACATAGGAAGGATGG + Intergenic
1052634127 9:31078886-31078908 GTGGATAAGAATATGGATAATGG + Intergenic
1052790876 9:32874551-32874573 GTGGGTAGGGATAGGGATGGTGG - Intergenic
1052997520 9:34559116-34559138 GTGGACAGGAAATGGGAGGGGGG + Intronic
1053439566 9:38105157-38105179 GTGGATAGGAATCAGGAAAATGG - Intergenic
1053440758 9:38114555-38114577 GTTGATAGAAATGGGTAGGAGGG + Intergenic
1057551250 9:96052530-96052552 GTGGATAGTAAGATGGAAGAGGG - Intergenic
1057557562 9:96100010-96100032 GTGGAGAGGAAGAGGGAGTGAGG + Intergenic
1057951849 9:99375554-99375576 GTGGCGGGGAATAGGGAGCATGG - Intergenic
1057983616 9:99687232-99687254 GGGGATAGAAAGTGGGAGGAGGG + Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058057563 9:100464481-100464503 GTGGCTCGGACTAGGGAAGATGG - Intronic
1058058962 9:100474840-100474862 GTGGATAACACTGGGGAGGAGGG + Intronic
1058971699 9:110089134-110089156 GTGCAGAGCAATAGGGAGAAAGG + Intronic
1059772303 9:117438842-117438864 GTAGAAAGAAATAAGGAGGAAGG - Intergenic
1060185277 9:121560356-121560378 GGGGAGAGGAAGAGGGAGAAAGG + Intergenic
1060213936 9:121726991-121727013 GTGGAGAGGAGTAGGGATGTGGG + Intronic
1060436344 9:123596170-123596192 GGGGATAGGAGTAGTCAGGAGGG - Intronic
1061048963 9:128182975-128182997 TTGGACAGGAATGGGGAGGGTGG - Intronic
1061311145 9:129763526-129763548 GTGGAGAGGAAAAGGGAGAGAGG - Intergenic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1061964066 9:134003373-134003395 GTGGATGGGTAGAGGGTGGATGG - Intergenic
1062111359 9:134783744-134783766 GTGGGAAGGAAGGGGGAGGAAGG + Intronic
1062513909 9:136922684-136922706 GAGGACAGGGATGGGGAGGATGG + Intronic
1062536812 9:137024651-137024673 GTGGGGAGGAAGTGGGAGGAAGG - Intronic
1203387948 Un_KI270438v1:71988-72010 ATGGAGAGGAATAGAGTGGAAGG + Intergenic
1203389659 Un_KI270438v1:86015-86037 GTGGAAAGGAATCGAAAGGAAGG + Intergenic
1203345888 Un_KI270442v1:33913-33935 GTGGAGTGGAATGGAGAGGAGGG + Intergenic
1203349937 Un_KI270442v1:71336-71358 GTGGATTGGAATGGAGTGGAGGG + Intergenic
1203351038 Un_KI270442v1:81633-81655 GTGGAATGGAATGGGGTGGAAGG + Intergenic
1186350431 X:8733428-8733450 GTGTATAAGAATAGGGAAAAGGG - Intergenic
1186574058 X:10746572-10746594 GTGGCTAGGAAAATGGTGGAAGG - Intronic
1186969059 X:14820117-14820139 GAGGATAGGACTAGGGAAGAGGG - Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1188171522 X:26933423-26933445 GGAGATGGGAATTGGGAGGAAGG - Intergenic
1188508826 X:30911946-30911968 GTTGATAGCAATAGGGATGATGG + Intronic
1188931279 X:36114308-36114330 ATGGATAGGAATAAGGATCATGG - Intronic
1189023261 X:37364704-37364726 GTGGATAGGTCCAGGGAGGGAGG - Intronic
1189201024 X:39195693-39195715 GAGGATGGGAGTAGGGAGGATGG - Intergenic
1189473678 X:41333383-41333405 GGGGAAAGGAGGAGGGAGGAGGG - Exonic
1189889637 X:45586902-45586924 GATGATGGGAAAAGGGAGGATGG - Intergenic
1190433827 X:50403992-50404014 GTGGGTAGATATAGGGATGAAGG - Intronic
1190618808 X:52264927-52264949 TTGGAAAGGAGTAGGGAGGTGGG + Intergenic
1190625808 X:52337454-52337476 TTGGAAAGGAGTAGGGAGGTGGG - Intergenic
1191842842 X:65525183-65525205 GTGGGTAGGAGTGGGGAGGAAGG + Intronic
1192433808 X:71129971-71129993 GGGGTTAGGAATATGGGGGATGG - Intronic
1193075925 X:77355551-77355573 GTGGTTTTGAATAGGGAAGAGGG + Intergenic
1193149468 X:78109704-78109726 GTGGTTAGTCATGGGGAGGATGG - Intronic
1195086890 X:101421429-101421451 ATGGATTGGAATTGGGAGGGAGG + Intronic
1196910935 X:120483580-120483602 GTGGGGAGGAATAAGTAGGAAGG + Intergenic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1197807714 X:130413568-130413590 GTTGCTAGGGACAGGGAGGAGGG - Intergenic
1197841397 X:130751200-130751222 GTGGCTAGGGGAAGGGAGGAAGG - Intronic
1198169918 X:134095511-134095533 GTGGACAGGAATGGAGAAGAAGG - Intergenic
1198233594 X:134716109-134716131 CTGGAAAGGAAAGGGGAGGAGGG - Intronic
1198276117 X:135097654-135097676 GTCGGTGGGCATAGGGAGGACGG - Intergenic
1198310396 X:135423086-135423108 GTCGGTGGGCATAGGGAGGACGG + Intergenic
1198333602 X:135644868-135644890 GTGGTTAGGAATATGAAGCAGGG - Intergenic
1198934788 X:141894940-141894962 GTGGGTAGGAAAAGGTGGGAGGG + Intronic
1198963777 X:142207491-142207513 GTGGAATGGAGTAGGGAGGTGGG - Intergenic
1199895134 X:152119986-152120008 GGGGATGGGAATAGGGAAGAGGG + Intergenic
1201114249 Y:10823424-10823446 GTGGAGTGGAATAGAGTGGAGGG - Intergenic
1201115142 Y:10829652-10829674 GTGGAAAGGAATGGAGTGGAAGG - Intergenic
1201117560 Y:10846291-10846313 GTGGAAAGGAGTGGGGTGGAAGG - Intergenic
1201123745 Y:10894176-10894198 GTGGAATGGAATGGGGTGGAGGG - Intergenic
1201135839 Y:10989489-10989511 GTGGAAAGGAATGGAGCGGAGGG - Intergenic