ID: 1085235427

View in Genome Browser
Species Human (GRCh38)
Location 11:75010753-75010775
Sequence CTAGTTTTCCAGGCCTCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085235422_1085235427 8 Left 1085235422 11:75010722-75010744 CCTCTGTCCCTAATTGGGTTTTC 0: 1
1: 0
2: 3
3: 12
4: 158
Right 1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 149
1085235421_1085235427 9 Left 1085235421 11:75010721-75010743 CCCTCTGTCCCTAATTGGGTTTT 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 149
1085235423_1085235427 1 Left 1085235423 11:75010729-75010751 CCCTAATTGGGTTTTCTATAGTT 0: 1
1: 0
2: 0
3: 19
4: 217
Right 1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 149
1085235424_1085235427 0 Left 1085235424 11:75010730-75010752 CCTAATTGGGTTTTCTATAGTTA 0: 1
1: 0
2: 1
3: 21
4: 172
Right 1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085235427 Original CRISPR CTAGTTTTCCAGGCCTCCAA GGG Exonic
900495042 1:2972429-2972451 CTTAATTTCCAGGCTTCCAAAGG - Intergenic
905954979 1:41985123-41985145 CTAGTTTTCCATTCTTCCCATGG - Intronic
910001168 1:82344134-82344156 TTAGCTTTCCAGGCCTCCTCAGG + Intergenic
914863490 1:151405991-151406013 CGACGTTTCCAGGCCTCCCAGGG - Exonic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
917041160 1:170807810-170807832 CTAGATATCCTGGGCTCCAAGGG + Intergenic
917489962 1:175489580-175489602 CTAGTGTTTCAGGTCTCCCAGGG - Intronic
919782663 1:201230901-201230923 CCACTGTCCCAGGCCTCCAAGGG - Intergenic
920795284 1:209131047-209131069 CTAGTTTTCCAGGTTTCCTTGGG - Intergenic
923172690 1:231431397-231431419 CTAGGTCTCCAGGCCTGTAATGG + Intergenic
923233032 1:232006835-232006857 CTAGGTCTCCAGGCCTGTAATGG - Intronic
923414096 1:233737939-233737961 ATAGCTTTCCAGGCCTCCTCAGG + Intergenic
1063618684 10:7624950-7624972 CTAGTATTTGAGGTCTCCAATGG - Intronic
1063931201 10:11029965-11029987 CTCGTTTTTCAGGTCTCCTAAGG + Intronic
1066579844 10:36868301-36868323 CTAGTTTTCCAGGAATAGAAGGG - Intergenic
1068805817 10:61192788-61192810 CTAGTCTTCCAGGCCTGTGATGG + Intergenic
1072160348 10:92760467-92760489 CTTCTTTTCCAGGCAGCCAAAGG + Intergenic
1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG + Exonic
1085875706 11:80404420-80404442 CTAGGCTTCCAGGTCTGCAAAGG - Intergenic
1086503621 11:87479344-87479366 CTAGGCTTCCAGGCCTGCAATGG - Intergenic
1087385328 11:97462519-97462541 CTATTCTCACAGGCCTCCAAAGG - Intergenic
1087773820 11:102239692-102239714 CTAGTTTGACAGACCTTCAAAGG - Intergenic
1088038817 11:105351195-105351217 CTAGGCCTCCAGGCCTGCAATGG + Intergenic
1091300345 11:134503350-134503372 CTGGTTTTTCAGACCTCCCAGGG + Intergenic
1091959946 12:4685287-4685309 CTTGTTATCCAGGGCTCAAATGG - Exonic
1092900553 12:13055770-13055792 CTTCTGTTCCAGGCCCCCAAGGG - Exonic
1093418917 12:18951871-18951893 TTAGTTTTCCACCCCTCCCAAGG - Intergenic
1094304825 12:29006870-29006892 CCTGATTTCCAGGCCTCCAAGGG + Intergenic
1095799907 12:46261029-46261051 CTAATTTTCCATTCCTGCAATGG + Intronic
1096220784 12:49827409-49827431 CTGGTTTTCCAGGCATCCCAGGG - Intronic
1097758012 12:63427844-63427866 CTTGGTTTCCAGGCCTGCAGTGG + Intergenic
1099525881 12:83719129-83719151 CTAGGCCTCCAGGCCTGCAATGG - Intergenic
1109416813 13:62051480-62051502 CTAGGTTTCTAGGCCTATAATGG - Intergenic
1111005861 13:82247970-82247992 CTTTTTTTTGAGGCCTCCAAGGG + Intergenic
1117443643 14:55782102-55782124 ATACTTTTCCTGCCCTCCAAGGG - Intergenic
1125083754 15:35705721-35705743 CTAGTTTCCAAGGTCACCAAAGG + Intergenic
1125215600 15:37269845-37269867 TTAGGTTTCCAGGCCAGCAAGGG + Intergenic
1125246447 15:37646795-37646817 CTAGGCTTCTAGGCCTGCAATGG - Intergenic
1125424900 15:39538860-39538882 ATAGATCTCCAAGCCTCCAAGGG - Intergenic
1125888864 15:43250872-43250894 TTTGTTTTCCAGGCCACTAAAGG + Intronic
1128330021 15:66749655-66749677 CTAGTTTCCTAGACCTGCAAGGG - Intronic
1129876736 15:78980465-78980487 CTAGATTTCCTGGACCCCAATGG - Intronic
1130119986 15:81039524-81039546 CTGGCTTTCCAGGCCTGCAGTGG + Intronic
1131956619 15:97742813-97742835 AGAGTTTTCCAGGCTTCCTAAGG - Intergenic
1133500718 16:6364158-6364180 CTATTTTTCCTGGCTTGCAAAGG - Intronic
1135244695 16:20845437-20845459 TTAGTCTTCCAGATCTCCAAGGG + Intronic
1139679929 16:68553571-68553593 CTCTGTTTCAAGGCCTCCAATGG - Intronic
1146054312 17:29573633-29573655 CCAGGTTCCCAGGCCTCCAGAGG + Exonic
1148354621 17:46967681-46967703 CCAGTTTTCAAGACCTCCTAGGG - Intronic
1156640750 18:39094455-39094477 CCAGTTTTTCAGGCATCCTATGG + Intergenic
1156859195 18:41816738-41816760 CTGGCATTCAAGGCCTCCAATGG - Intergenic
1158819389 18:61141905-61141927 CTTTTTTTCCAAGCCTCAAAGGG + Intergenic
1159083393 18:63760586-63760608 CTGGGTCTCCAGGCCTGCAATGG - Intronic
1159580885 18:70233246-70233268 CTTGTTTTCCAGTACTCAAAAGG + Intergenic
1161984694 19:7646982-7647004 CTAGATTTCTAGGTCCCCAATGG + Intronic
1162787897 19:13047046-13047068 CTAGTTATCCAGGACTCTTAAGG + Intronic
1167297952 19:48662854-48662876 CTAGTGTTCTAGGCCTTCACAGG - Intronic
925516959 2:4693359-4693381 TTAGTTTTCCTCGACTCCAAGGG + Intergenic
926791271 2:16574508-16574530 CTAGGCTTCCAGGCCTGTAATGG - Intronic
927989842 2:27440294-27440316 CCACTGTGCCAGGCCTCCAAAGG + Intronic
930105367 2:47634965-47634987 CTAGTTTCCAAGGACTCCCAAGG - Intergenic
931187740 2:59969819-59969841 CCAGAGTTCCAGGCATCCAATGG - Intergenic
931706575 2:64951437-64951459 CTGGTTTTCAAGGCCAACAAGGG + Intergenic
932171004 2:69556363-69556385 CTAGGTTTCCAGGCCAAAAAAGG + Intronic
932298478 2:70646131-70646153 TTAGTTTTCTAGCCCTACAAGGG + Intronic
932573982 2:72952782-72952804 CAGGTTTTCTAAGCCTCCAAAGG - Intronic
933400884 2:81795370-81795392 CTAGGCTTCCAGGCCTCTTATGG - Intergenic
935059638 2:99596110-99596132 CTTGTTTTCATGGCCACCAACGG + Intronic
935127756 2:100239361-100239383 CTTGTTTTCCTCCCCTCCAAGGG + Intergenic
935410655 2:102758383-102758405 CTAGTTTTCCATGATTCCTAAGG - Intronic
936788827 2:116125802-116125824 CTAGGCCTCCAGGCCTGCAATGG + Intergenic
938247506 2:129790384-129790406 CTGGCTTTCCAGGGCTCCAGTGG + Intergenic
940656870 2:156497946-156497968 CTTCTTTCCCAGGCCTTCAAGGG - Intronic
943530202 2:189070253-189070275 TTAGTTTTCCAGGCCTCTTTAGG - Intronic
945351030 2:208780219-208780241 CAATTTTTCCAGTCATCCAATGG + Intronic
946060289 2:216935307-216935329 CTACTTTTCCAGGACTCCTCCGG + Intergenic
1171262298 20:23745655-23745677 CCCGCTTCCCAGGCCTCCAATGG + Intergenic
1171271406 20:23821374-23821396 CCTGCTTCCCAGGCCTCCAATGG + Intergenic
1171387461 20:24779915-24779937 CTAGCTCTCCAGTCCTCCCAGGG - Intergenic
1175575832 20:60060243-60060265 CCAGTTTTCCAGTCCTCCAGAGG - Intronic
1178580204 21:33831854-33831876 GTGGATTTCCAGGCCTCCAGAGG - Intronic
1183136868 22:35897450-35897472 CTTGTTGTCCAGGACTCAAATGG + Intronic
1184160909 22:42696827-42696849 CCTGTTTTTCAGGCCTCAAACGG + Intronic
1184385819 22:44174023-44174045 CGAGTTTTCAAGGCCAGCAATGG + Intronic
949226940 3:1705803-1705825 CTGGTTTTCCAGGCCTCACTGGG - Intergenic
953271702 3:41451787-41451809 CTACTTTTGTAGGCCTCAAATGG + Intronic
954039619 3:47875051-47875073 CCAGTTTTCCAGGTCACCCACGG - Intronic
957675442 3:83357903-83357925 CTACTCCTCCAGGCCTCTAATGG + Intergenic
958682975 3:97354138-97354160 GTAGTTTTCCAGGTATTCAAAGG - Intronic
959149425 3:102591046-102591068 CTAGATCTCCAGGCCTGCAATGG - Intergenic
960224887 3:115157700-115157722 CTAGGTTTCCAGGCCTGTCATGG - Intergenic
961073121 3:123955255-123955277 CTTGTTTTCTAGGCCTCCAAGGG + Intronic
961514878 3:127426298-127426320 CTTGTTCTCCAGGCCTCCTGTGG - Intergenic
962506237 3:136048914-136048936 CTAGTATTCCAAGCACCCAATGG - Intronic
965327964 3:167331246-167331268 CTAGCTTTCCAAGCCAACAAAGG - Intronic
974005817 4:56556168-56556190 CTGGTTTTCCATGCCATCAAAGG - Intronic
976106844 4:81628011-81628033 CTATGTGTCCATGCCTCCAAAGG - Intronic
978946922 4:114510737-114510759 CTTCTTTTCCAGGCAGCCAAAGG + Intergenic
982906456 4:161080741-161080763 TTACTTTTCCAGGCCTCTAAAGG - Intergenic
982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG + Intronic
986090980 5:4506134-4506156 CAATTTTTCCTGGCCTCAAAAGG + Intergenic
987435207 5:17885514-17885536 CTAGGTCTCCAGGCCTCTCATGG - Intergenic
987845368 5:23276917-23276939 CTAGGTTTCCAGGCCTGTAATGG - Intergenic
987862002 5:23500684-23500706 CTAGGCCTCCAGGCCTCTAATGG + Intergenic
992802332 5:80304734-80304756 ATAGTTTTTCAGGCCTCCTTTGG + Intergenic
995281295 5:110338669-110338691 CTAATTTGCCAGTCCTACAAAGG + Intronic
998148494 5:139744094-139744116 CCAGTGTCCCAGGCCTCCAATGG - Intergenic
998320960 5:141230727-141230749 CAAGTTTTCCAGGATTCCCAAGG - Intergenic
998883722 5:146672232-146672254 CTTGTTTTCGAGTCCTCAAAAGG + Intronic
1000796797 5:165674098-165674120 CTTGTTTTCCAGTCTGCCAATGG - Intergenic
1002123139 5:177021532-177021554 CCAGTTATCCAGGCCTCCTGGGG - Intronic
1006045474 6:31292287-31292309 TTAGTTTTCATGGCCTCCTAAGG + Intronic
1006270253 6:32959831-32959853 CTACTGGTCCAGGCCTTCAATGG + Intronic
1006298059 6:33178822-33178844 CTAGTTCTCCAGGCTTCCCCAGG - Intronic
1008265211 6:49416739-49416761 CTGGTTTTTCAGGCCTCCATAGG + Intergenic
1008817921 6:55591582-55591604 CGAGTATGCCAGGCCACCAAGGG - Intergenic
1009637543 6:66285177-66285199 CTAGTTCTCCAGGCCTATGAGGG - Intergenic
1012691597 6:102319841-102319863 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1017079304 6:150652294-150652316 CTATTTGTCAAGGCCTGCAATGG + Intronic
1017203030 6:151776173-151776195 TATGTTCTCCAGGCCTCCAATGG - Intronic
1018497895 6:164368976-164368998 CTGATTTTCCAGTCCTCCTAGGG + Intergenic
1018721532 6:166576884-166576906 CTAGGCCTCCAGGCCTGCAATGG - Intronic
1020613437 7:10429055-10429077 CTATTTTTCCTGGCCCCCAGTGG + Intergenic
1022417087 7:30187727-30187749 CTAAGATTCCAGGCCTCTAATGG + Intergenic
1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG + Intergenic
1028784194 7:94773696-94773718 CTAGTCTTCCAGGTCTGTAATGG - Intergenic
1030140552 7:106299780-106299802 CTAGTTTCCCAGACTTACAAGGG - Intergenic
1031417000 7:121507079-121507101 GTACTTTTTCAGGTCTCCAAGGG + Intergenic
1031831781 7:126636310-126636332 CTTGGTTTCTAGGCCTCCCATGG + Intronic
1035075090 7:156172287-156172309 CTAGTTTTTCAGGTCTCCTGAGG + Intergenic
1038753323 8:30316841-30316863 CCAGTTTTCAAGACCTCCAAAGG - Intergenic
1042028521 8:64449152-64449174 CCATTTTTCCCTGCCTCCAAGGG - Intergenic
1043429016 8:80176536-80176558 CTAGTTTTCCAGAATGCCAATGG + Intronic
1044055900 8:87569543-87569565 CTAGTTCTCTAGGCCTATAAGGG - Intronic
1045105501 8:98888613-98888635 CTTGATTTCCAGGCCTCCTGAGG + Intronic
1047378221 8:124325657-124325679 CTATTTTTCCAGGCCTGAGATGG - Intronic
1047710137 8:127543489-127543511 CTACCTTTCCATGACTCCAAGGG + Intergenic
1047772982 8:128045337-128045359 CATGTTTTCCAGGTCTTCAATGG - Intergenic
1053571905 9:39318612-39318634 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1053882701 9:42611734-42611756 CTAGGTTTCCAGGCCTATGATGG + Intergenic
1053889968 9:42682568-42682590 CTAGGTTTCCAGGCCTATGATGG - Intergenic
1054093459 9:60877323-60877345 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1054114942 9:61153243-61153265 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1054125240 9:61300399-61300421 CTAGGTTTCCAGGCCTGTGATGG + Intergenic
1054221728 9:62419202-62419224 CTAGGTTTCCAGGCCTATGATGG + Intergenic
1054228986 9:62489971-62489993 CTAGGTTTCCAGGCCTATGATGG - Intergenic
1054592814 9:67029291-67029313 CTAGGTTTCCAGGCCTGTGATGG + Intergenic
1057733212 9:97630092-97630114 TAAGTTTTTCAGGCCTTCAAAGG - Intronic
1059710111 9:116859932-116859954 CTAGTTTTTCCAGCCTCCAGAGG - Intronic
1061089048 9:128416414-128416436 CTACTTTGCCAGTCCTGCAAAGG + Intronic
1061493067 9:130956885-130956907 TCCGGTTTCCAGGCCTCCAAGGG - Intergenic
1062459858 9:136658511-136658533 CAAGTTTGCCAGGCCACCAACGG + Intergenic
1186148747 X:6651808-6651830 CTAGCTTTCCTGGCCTATAATGG - Intergenic
1189429277 X:40932699-40932721 CTGTTTTTCAAGGGCTCCAAAGG - Intergenic
1189901301 X:45709614-45709636 CTAGCTCTCCAGGCCACAAATGG - Intergenic
1190799585 X:53775153-53775175 CTGGTTCTCCAGGCCTCTCATGG + Intergenic
1192362639 X:70449247-70449269 CTAGTTCTCCAGGCCTCAGAAGG - Intronic
1195792061 X:108598745-108598767 CAGGTTTACCAGGCCTCCCAGGG + Exonic
1196070321 X:111513786-111513808 CTAGTTTTCCAAACTTTCAAAGG + Intergenic
1196763229 X:119219029-119219051 CTTGTTTTCCAGGCTCACAATGG + Intergenic
1197054927 X:122106390-122106412 CTAGTTTACAAGCCCACCAATGG - Intergenic
1197536137 X:127691230-127691252 CTAGGTCTCCAGGCCTGTAATGG - Intergenic
1201328509 Y:12793020-12793042 CTAATTTTGCAGACCACCAATGG + Exonic