ID: 1085237339

View in Genome Browser
Species Human (GRCh38)
Location 11:75025290-75025312
Sequence GTTGATTTTCCAGAAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085237336_1085237339 20 Left 1085237336 11:75025247-75025269 CCATTCCACAGCAAGGCAGGATG No data
Right 1085237339 11:75025290-75025312 GTTGATTTTCCAGAAAAGATGGG No data
1085237337_1085237339 15 Left 1085237337 11:75025252-75025274 CCACAGCAAGGCAGGATGAGAGC No data
Right 1085237339 11:75025290-75025312 GTTGATTTTCCAGAAAAGATGGG No data
1085237334_1085237339 26 Left 1085237334 11:75025241-75025263 CCACAGCCATTCCACAGCAAGGC No data
Right 1085237339 11:75025290-75025312 GTTGATTTTCCAGAAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085237339 Original CRISPR GTTGATTTTCCAGAAAAGAT GGG Intergenic
No off target data available for this crispr