ID: 1085239012

View in Genome Browser
Species Human (GRCh38)
Location 11:75036437-75036459
Sequence CCACATGTATGGTCTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085239012_1085239021 6 Left 1085239012 11:75036437-75036459 CCCAGCACAGACCATACATGTGG No data
Right 1085239021 11:75036466-75036488 CCTGAGGCCTCTCTTTCCTTGGG No data
1085239012_1085239019 5 Left 1085239012 11:75036437-75036459 CCCAGCACAGACCATACATGTGG No data
Right 1085239019 11:75036465-75036487 TCCTGAGGCCTCTCTTTCCTTGG No data
1085239012_1085239022 7 Left 1085239012 11:75036437-75036459 CCCAGCACAGACCATACATGTGG No data
Right 1085239022 11:75036467-75036489 CTGAGGCCTCTCTTTCCTTGGGG No data
1085239012_1085239016 -10 Left 1085239012 11:75036437-75036459 CCCAGCACAGACCATACATGTGG No data
Right 1085239016 11:75036450-75036472 ATACATGTGGCCCTCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085239012 Original CRISPR CCACATGTATGGTCTGTGCT GGG (reversed) Intergenic
No off target data available for this crispr