ID: 1085245571

View in Genome Browser
Species Human (GRCh38)
Location 11:75098237-75098259
Sequence TCCAGCTGGCCTGCAAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085245571_1085245578 -5 Left 1085245571 11:75098237-75098259 CCTGCGCTTGCAGGCCAGCTGGA No data
Right 1085245578 11:75098255-75098277 CTGGAGTTCTGGGTGGGCGTGGG 0: 66
1: 510
2: 387
3: 430
4: 629
1085245571_1085245577 -6 Left 1085245571 11:75098237-75098259 CCTGCGCTTGCAGGCCAGCTGGA No data
Right 1085245577 11:75098254-75098276 GCTGGAGTTCTGGGTGGGCGTGG 0: 66
1: 524
2: 410
3: 477
4: 897
1085245571_1085245585 29 Left 1085245571 11:75098237-75098259 CCTGCGCTTGCAGGCCAGCTGGA No data
Right 1085245585 11:75098289-75098311 CCACACTCAGAGCAGCCGGCCGG 0: 8
1: 63
2: 259
3: 388
4: 533
1085245571_1085245580 3 Left 1085245571 11:75098237-75098259 CCTGCGCTTGCAGGCCAGCTGGA No data
Right 1085245580 11:75098263-75098285 CTGGGTGGGCGTGGGCTTGGCGG 0: 74
1: 531
2: 507
3: 379
4: 869
1085245571_1085245579 0 Left 1085245571 11:75098237-75098259 CCTGCGCTTGCAGGCCAGCTGGA No data
Right 1085245579 11:75098260-75098282 GTTCTGGGTGGGCGTGGGCTTGG 0: 114
1: 730
2: 592
3: 341
4: 442
1085245571_1085245581 25 Left 1085245571 11:75098237-75098259 CCTGCGCTTGCAGGCCAGCTGGA No data
Right 1085245581 11:75098285-75098307 GACCCCACACTCAGAGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085245571 Original CRISPR TCCAGCTGGCCTGCAAGCGC AGG (reversed) Intergenic
No off target data available for this crispr