ID: 1085249330

View in Genome Browser
Species Human (GRCh38)
Location 11:75131843-75131865
Sequence ATCTATCCGCTTATCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085249330_1085249334 -1 Left 1085249330 11:75131843-75131865 CCCACCAGGATAAGCGGATAGAT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1085249334 11:75131865-75131887 TTAAGAAGAAAATCAAGGCCAGG 0: 1
1: 3
2: 22
3: 258
4: 1633
1085249330_1085249336 7 Left 1085249330 11:75131843-75131865 CCCACCAGGATAAGCGGATAGAT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1085249336 11:75131873-75131895 AAAATCAAGGCCAGGCATGGTGG 0: 2
1: 105
2: 976
3: 5024
4: 18452
1085249330_1085249333 -6 Left 1085249330 11:75131843-75131865 CCCACCAGGATAAGCGGATAGAT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1085249333 11:75131860-75131882 ATAGATTAAGAAGAAAATCAAGG 0: 1
1: 0
2: 5
3: 97
4: 770
1085249330_1085249335 4 Left 1085249330 11:75131843-75131865 CCCACCAGGATAAGCGGATAGAT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1085249335 11:75131870-75131892 AAGAAAATCAAGGCCAGGCATGG 0: 1
1: 20
2: 192
3: 1493
4: 6613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085249330 Original CRISPR ATCTATCCGCTTATCCTGGT GGG (reversed) Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910021895 1:82601560-82601582 ATCTATCTGGTTATCCTGTTAGG - Intergenic
920425367 1:205870828-205870850 ATCTATCCTCTTGTCCTGAAGGG + Intergenic
923243962 1:232112882-232112904 ATCCCTCCGTTTTTCCTGGTTGG + Intergenic
1063417729 10:5888074-5888096 ATCTGACAGCTTCTCCTGGTTGG - Intronic
1064247174 10:13678235-13678257 CTGTATCCGCTAATGCTGGTTGG + Intronic
1074542677 10:114378411-114378433 GTGTATCAGCTTATCCTGGAAGG - Intronic
1076659156 10:132043943-132043965 ATCTTTCCTCTTATCCTGCTGGG + Intergenic
1080086015 11:28283131-28283153 ATCTATTCGTTTATCCTCCTAGG - Intronic
1080726747 11:34905710-34905732 ATCTAGCCTCTCATTCTGGTTGG + Intronic
1084184950 11:67466613-67466635 ATCTCTCCGCTTCTCCAGGAAGG - Intronic
1084260743 11:67977090-67977112 ATCTTTCCCCATATCCAGGTGGG + Intergenic
1085249330 11:75131843-75131865 ATCTATCCGCTTATCCTGGTGGG - Intronic
1113005375 13:105695925-105695947 ATGTCCTCGCTTATCCTGGTGGG - Intergenic
1116396682 14:44455237-44455259 ATCTCCGAGCTTATCCTGGTGGG - Intergenic
1122342943 14:101040212-101040234 ATCTTTCCACTTACCCTGGAGGG - Intergenic
1128585797 15:68849133-68849155 ATCTGTAGGATTATCCTGGTTGG - Intronic
1128585966 15:68850303-68850325 ATCTGTAGGATTATCCTGGTTGG - Intronic
1131577514 15:93606443-93606465 ATCTATCCAGGTATCCAGGTGGG + Intergenic
1139914432 16:70419319-70419341 ATCTATCCCCAGATCCTGTTAGG + Intronic
1141411443 16:83836346-83836368 ATCTATGCTCTTATTCTGATAGG + Intergenic
1150915209 17:69429792-69429814 ATCCATCAGATTATCCTGCTGGG + Intronic
1157055468 18:44223283-44223305 TTCTATTGGCTTCTCCTGGTAGG - Intergenic
1167620690 19:50558752-50558774 ATCTAACCACTGATCCTGCTTGG + Intronic
1168500562 19:56889442-56889464 ATCCATCAGCAAATCCTGGTTGG + Intergenic
927351566 2:22123298-22123320 ATCTCTCAGCTTACCCTGATAGG + Intergenic
930924733 2:56803197-56803219 ATCTGTGAGCTTCTCCTGGTGGG - Intergenic
931918672 2:66988344-66988366 ATCTAGCCTCTTAGCCTGATTGG - Intergenic
932850535 2:75180191-75180213 CTCTATCCTCTTACCCTTGTCGG + Intronic
934104167 2:88680842-88680864 ATCTCTCAGCTTACCCTGATGGG + Intergenic
937279000 2:120704658-120704680 ATATATCCGCATTTACTGGTGGG + Intergenic
939362543 2:141191543-141191565 TTCTTTCTGCTTATCCTTGTAGG - Intronic
940869887 2:158850717-158850739 ATCTTTCCCCATATCCAGGTGGG - Intronic
940872577 2:158871718-158871740 ATCTTTCCCCATATCCAGGTGGG - Intergenic
944170533 2:196772047-196772069 AACTATCTGCTTTTCCTTGTTGG - Intronic
948197264 2:236105173-236105195 ATCTAACTGCTTTTCCTTGTAGG - Intronic
949001848 2:241619276-241619298 ATCCATCCCCTTAACCTGGCTGG - Intronic
1184916671 22:47574245-47574267 ATCTGTCTGTTTTTCCTGGTTGG + Intergenic
951404186 3:22274095-22274117 ATCTAACCCCTTCTCCTGGAAGG + Intronic
965089264 3:164142405-164142427 ATCTCTCAGCTCATCCTGATGGG + Intergenic
969734608 4:8978556-8978578 ATCTTTCCCCATATCCAGGTGGG - Intergenic
972839151 4:42910464-42910486 ATCTATCCACTTATACTCCTGGG + Intronic
978120778 4:105076875-105076897 ATCTGTCCCCTTAAGCTGGTAGG - Intergenic
997209270 5:132068004-132068026 GTCTTTCCACTTGTCCTGGTGGG - Intergenic
1001010083 5:168089488-168089510 CCCCATCCCCTTATCCTGGTAGG + Intronic
1004857100 6:19762346-19762368 ATCTTTTCTCTTTTCCTGGTGGG - Intergenic
1014321237 6:119930509-119930531 ATCTATCCTCTGAGCGTGGTTGG + Intergenic
1031132556 7:117849508-117849530 ATTTATGTGCTTAGCCTGGTAGG - Intronic
1036690563 8:10942067-10942089 ATCTTTACTCTTATCCTGGGAGG + Intronic
1036705176 8:11041093-11041115 ATCTCTCCTCTGATCCTGATGGG - Intronic
1036772147 8:11586670-11586692 ATCCATCCGTCTCTCCTGGTGGG - Intergenic
1037298430 8:17425884-17425906 ATGTAACCCCATATCCTGGTAGG - Intergenic
1043617979 8:82151324-82151346 CTCTATGCACTTATCCTGGACGG - Intergenic
1060364752 9:122999637-122999659 TTCTTTCCGTTTATCCTGCTTGG + Intronic
1197881505 X:131171550-131171572 ATCTATCCACTTATCCTGGAAGG + Intergenic
1199440088 X:147857918-147857940 ATCTATCAGCTTTTGCTGGCTGG - Intergenic