ID: 1085250551

View in Genome Browser
Species Human (GRCh38)
Location 11:75140791-75140813
Sequence AAGGACACACAGGTGGTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 973
Summary {0: 1, 1: 0, 2: 9, 3: 136, 4: 827}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085250551_1085250557 22 Left 1085250551 11:75140791-75140813 CCACGTACCACCTGTGTGTCCTT 0: 1
1: 0
2: 9
3: 136
4: 827
Right 1085250557 11:75140836-75140858 CTCTGCCTCTGTTTCCTCTTTGG 0: 1
1: 1
2: 22
3: 158
4: 957
1085250551_1085250562 30 Left 1085250551 11:75140791-75140813 CCACGTACCACCTGTGTGTCCTT 0: 1
1: 0
2: 9
3: 136
4: 827
Right 1085250562 11:75140844-75140866 CTGTTTCCTCTTTGGGAATGGGG 0: 1
1: 0
2: 4
3: 43
4: 422
1085250551_1085250558 23 Left 1085250551 11:75140791-75140813 CCACGTACCACCTGTGTGTCCTT 0: 1
1: 0
2: 9
3: 136
4: 827
Right 1085250558 11:75140837-75140859 TCTGCCTCTGTTTCCTCTTTGGG 0: 1
1: 0
2: 15
3: 130
4: 828
1085250551_1085250560 28 Left 1085250551 11:75140791-75140813 CCACGTACCACCTGTGTGTCCTT 0: 1
1: 0
2: 9
3: 136
4: 827
Right 1085250560 11:75140842-75140864 CTCTGTTTCCTCTTTGGGAATGG 0: 1
1: 0
2: 5
3: 35
4: 420
1085250551_1085250561 29 Left 1085250551 11:75140791-75140813 CCACGTACCACCTGTGTGTCCTT 0: 1
1: 0
2: 9
3: 136
4: 827
Right 1085250561 11:75140843-75140865 TCTGTTTCCTCTTTGGGAATGGG 0: 1
1: 0
2: 2
3: 51
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085250551 Original CRISPR AAGGACACACAGGTGGTACG TGG (reversed) Intronic
900941671 1:5802449-5802471 AAGGTCACACAGCTGGTAAGTGG - Intergenic
901121724 1:6900226-6900248 CAGGACACAGAGGTGGTGTGTGG + Intronic
901144531 1:7056133-7056155 AAGGACACAGAGCTGGTCCCCGG + Intronic
901527042 1:9830141-9830163 AAGGTCACACAGGTAGAAAGAGG - Intergenic
901761719 1:11476290-11476312 AAGGTCACGCAGCTGGTAAGGGG + Intergenic
901775457 1:11557460-11557482 AAGGACACACAGCTGGCAGGTGG - Intergenic
902065384 1:13681455-13681477 AAGGTCACACAGCTAGTAAGTGG + Intergenic
902077802 1:13801535-13801557 AAGAACACACAGCTGGCAGGCGG - Intronic
902189871 1:14754828-14754850 AAGGTCACACAGCTGGCAGGTGG - Intronic
902207075 1:14876591-14876613 AAGGTCACAGAGCTGGTAAGGGG - Intronic
902244829 1:15113968-15113990 AAGGTCACACAGCTGGGAAGTGG + Intronic
902258367 1:15205631-15205653 AAGGTCACACAGTGAGTACGAGG - Intronic
902570788 1:17345939-17345961 AGGGACACACAGGTGGCTCAGGG - Intronic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902761625 1:18584598-18584620 AAGGTCACACAGCTGGTAAGTGG + Intergenic
902875231 1:19337026-19337048 AAGGGCACACAGGTGGGCCTAGG - Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
902936897 1:19770970-19770992 AAGGTCACACAGCTGATAAGTGG - Intronic
903187356 1:21636240-21636262 AAGGTCACACAGCTGTTATGTGG - Intronic
903272674 1:22201024-22201046 AAGGTCACACAGCTGATAAGTGG - Intergenic
903298699 1:22362781-22362803 AAGGCCACACAGCTCGTATGTGG - Intergenic
903347371 1:22695265-22695287 AAGGGCACACAGCTGGGAGGTGG - Intergenic
903414910 1:23175932-23175954 AAGGTCACACAGCTGGTAAGTGG + Intronic
903460272 1:23516089-23516111 AAGGTCACATAGCTGGTAAGTGG + Intronic
903556018 1:24193928-24193950 AAGGTCACACAGGTGGAAATGGG + Intergenic
903574949 1:24333665-24333687 AAGGTCACACAGCTAGTATGTGG + Intronic
904259625 1:29280957-29280979 AAGGCCACACAGCTAGTAAGTGG + Intronic
904282994 1:29434353-29434375 AAGGTCACACAGCTGGTCCATGG + Intergenic
904291640 1:29489856-29489878 AAGGACACACAGCCAGTAAGTGG - Intergenic
904320463 1:29694845-29694867 AAGGTCACACAGCTGGTGAGAGG - Intergenic
904368570 1:30034228-30034250 AAGGACACACAGCTAGGAAGGGG - Intergenic
904379312 1:30100606-30100628 AAGGTCACATAGGTGGTGAGAGG + Intergenic
904437267 1:30506927-30506949 AAGGTCACACAGCTGGTGAGAGG + Intergenic
904453139 1:30629495-30629517 AAGGCCACACAGCTGGTGAGGGG - Intergenic
904493600 1:30874789-30874811 AAGGACACACAGCTAGTAAGTGG + Intronic
904772516 1:32888219-32888241 AAGGTCACATAGCTGGTAAGAGG + Intronic
904798404 1:33074932-33074954 AAGATCACACAGCTGGTAAGTGG - Intronic
904974579 1:34445996-34446018 AAGGTCACACAGCTAGTAAGAGG - Intergenic
905270047 1:36781808-36781830 AAGGTCACCCAGCTGGTAGGAGG - Intergenic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
905365839 1:37451057-37451079 AAGAACACACAGGTGGTGAGTGG - Intergenic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905586621 1:39124309-39124331 AAAGTCACACAGGTAGTAAGTGG - Intronic
905751553 1:40469163-40469185 AAGGACACCCAGGTAGTAAATGG + Intergenic
905812461 1:40922756-40922778 AAGGACACACGGCTGGGAGGAGG - Intergenic
905843278 1:41204137-41204159 AAGGTTACACAGTTGGTACATGG + Intronic
906059236 1:42937578-42937600 AAGGACACACAGCTAGTAAGTGG - Intronic
906771139 1:48485416-48485438 AAGGTCACACAGATAGTACCTGG + Intergenic
906928387 1:50143614-50143636 AAGGTCACACAGCTAGTAAGTGG + Intronic
906947168 1:50304813-50304835 AAGGCCATACAGCTGGTAAGTGG + Intergenic
907107080 1:51893114-51893136 AAGGACACACAGCTAGCAAGTGG + Intergenic
907321958 1:53608577-53608599 AAGGTCACACAGTTAGTAAGTGG - Intronic
907354796 1:53863314-53863336 AAGGTCCCACAGCTGGTACCCGG - Intronic
907473941 1:54692919-54692941 CAGGTCACACAGGTGGCAAGTGG - Intronic
907560725 1:55385181-55385203 AAGGTCACACAGCTGGTAAGTGG - Intergenic
907573707 1:55506921-55506943 ATGGACACCCAGCTGGTAGGTGG - Intergenic
907699115 1:56766048-56766070 AAGGACATATAGTTGGAACGTGG + Intronic
907706473 1:56836823-56836845 AAAGTCACACAGCTGATACGTGG - Intergenic
907733707 1:57091666-57091688 AAGGTCACATAGCTGGTAAGTGG - Intronic
907873499 1:58464552-58464574 AAGGCCACACAGCTAGTACAAGG - Intronic
908089257 1:60669330-60669352 AAGGTCAAACAGGTGGCAAGAGG - Intergenic
908112997 1:60915681-60915703 CAGTTCACACAGGTGGTAGGAGG - Intronic
908122066 1:60995243-60995265 AAGGACACACAGCAAGTAAGTGG - Intronic
908329770 1:63059709-63059731 AAGGCCATACAGCTGGTATGTGG + Intergenic
908767192 1:67564798-67564820 AAGGTCACACAGCTAGTAAGTGG + Intergenic
909590531 1:77343593-77343615 AAAGTCACACAGGTGGTAGGTGG - Intronic
909971533 1:81996820-81996842 AAGGTCTCACAGCTGGTAAGTGG + Intergenic
910145437 1:84075428-84075450 AAGGTCACTCAAGTGGTAAGAGG - Intergenic
910440068 1:87242646-87242668 AAGGTCACACAGTTGGTAAATGG + Intergenic
910440403 1:87246085-87246107 AAGGTCACCCAGCTGGTAAGTGG - Intergenic
910489572 1:87754097-87754119 AAGGACACACATCTGGTAAGTGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911452360 1:98079761-98079783 AATGCCACACAGGTAGTAAGCGG + Intergenic
912411431 1:109483389-109483411 AAGGACACAGGGGTGGTGTGGGG - Intergenic
913187600 1:116383539-116383561 AAGGATACACTGCTGGTAAGTGG + Intronic
913229146 1:116727042-116727064 AAGGTCACACAGCTTGTAAGAGG + Intergenic
913255401 1:116948820-116948842 AAGGTCACACAGCTGATAGGTGG - Intronic
914978703 1:152392606-152392628 AAAGCCACACAGATGGTAGGTGG + Intergenic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
915276044 1:154788912-154788934 AAGGTCACACAGCTGGTAAGTGG + Intronic
915300886 1:154951032-154951054 AAGGTCACACTGCTGGTAAGGGG - Intronic
915523289 1:156461041-156461063 AAGACCACACAGCTGGTAAGGGG + Intergenic
915593858 1:156885392-156885414 AATGTCACACAGCTGGTAAGTGG - Intergenic
916762475 1:167829823-167829845 AAAGACACACAGCTGGAATGTGG + Intronic
917084104 1:171288411-171288433 AAGGTCACACAGCTAGTAAGTGG - Intergenic
917519624 1:175737117-175737139 AAGGCCACACAGCTAGTAGGTGG - Intronic
918048992 1:180958100-180958122 AAGGTCACACAGGTGGTGAGAGG - Intergenic
918529075 1:185497400-185497422 AAGGTCACACAGTTAGTAAGTGG + Intergenic
919807264 1:201387563-201387585 AAGGTCACACAGCTGATTCGTGG + Intronic
919982069 1:202648004-202648026 AAGGTCACACAGCTGCTAAGTGG - Intronic
920032823 1:203047800-203047822 AAGGTCACACAGGTGGTAAGAGG + Intronic
920254280 1:204643888-204643910 AAGGTCACACTGGTGGGAAGAGG - Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920705884 1:208250231-208250253 AAGGTCACACAGGTAGTGTGTGG + Intergenic
921338806 1:214113889-214113911 AAAGACAAACAGCTGGTAAGTGG + Intergenic
921562146 1:216671624-216671646 AAGGTCTCACAGCTGGTAAGTGG + Intronic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922724467 1:227915943-227915965 CAGGACACACAGGTGGCCAGAGG - Intergenic
922899335 1:229123925-229123947 AAGGACACACAGGTGGACCAAGG + Intergenic
923210308 1:231797865-231797887 AAGGATACACAGGTTTTCCGGGG + Intronic
923406030 1:233661551-233661573 AAGGAGGCACAGATGGTAAGAGG - Intronic
923711473 1:236390912-236390934 AAGAGCACACAGGTGGTAAGTGG - Intronic
924132772 1:240929127-240929149 AAAGTCACACAGTTGGTATGTGG + Intronic
924176027 1:241391820-241391842 AAAGACATACAGCTGGTAAGTGG + Intergenic
924197665 1:241624858-241624880 AAGATCACACAGCTGGTAAGTGG - Intronic
924651220 1:245929100-245929122 AAGGACATACAGCTAGTAAGTGG + Intronic
924721713 1:246629181-246629203 AGGGCCACACAGCTGGTAAGTGG + Intronic
1064938565 10:20707413-20707435 AAGGACACAGAGCTGGTGCAGGG + Intergenic
1064938661 10:20708565-20708587 AAAGTCACACAGGTAGTAAGAGG - Intergenic
1065567583 10:27029903-27029925 AAGGTCACACAGCTGGTAACTGG - Intronic
1066038322 10:31517932-31517954 AAGGTCACTCAGGTAGTACATGG + Intronic
1067160773 10:43823026-43823048 AAGGTCACACAGTTGCTAAGTGG - Intergenic
1067791562 10:49292305-49292327 AAGGTCACACAGCTGGTGTGAGG + Intergenic
1068111131 10:52681900-52681922 AAGGACATACATGTAGTAAGTGG - Intergenic
1069058386 10:63868017-63868039 AAAGACACACAGGAAGTAAGTGG + Intergenic
1069065745 10:63940046-63940068 TAGGACACACAGCTGCTAAGTGG - Intergenic
1069828538 10:71268918-71268940 AAGGACGCAGAGCTGGCACGGGG - Intronic
1069899453 10:71698895-71698917 AAGGTCACACAGCTGGTAAGTGG - Intronic
1070156420 10:73838357-73838379 AAGGTCACACAGCTGGCAAGTGG - Intronic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070651479 10:78240104-78240126 AAGGAAGCACAGCTGGTACCAGG + Intergenic
1070805355 10:79267597-79267619 AAGATCACACAGCTGCTACGTGG + Intronic
1071003115 10:80853703-80853725 AAGGTCACACAGCTAGTTCGTGG + Intergenic
1071568409 10:86683394-86683416 AAGGTCACACAGCTAGTAAGTGG + Intronic
1071732369 10:88261252-88261274 GAGGTCACCCAGGTGGTAGGTGG - Intergenic
1072138077 10:92565937-92565959 AAGGATACACAGCTAGTAAGTGG - Intronic
1072417347 10:95260252-95260274 AAGGTCACACAGCTAGTAAGAGG + Intronic
1072555361 10:96510648-96510670 AAGGATACACAGCTTGTAAGTGG + Intronic
1072755867 10:98020464-98020486 AAGGTCACACAGCTAGTACCTGG + Intronic
1073442513 10:103560792-103560814 AAGGTCACATAGCTGGTAAGTGG - Intronic
1074189471 10:111123488-111123510 AGGGTCACACAGTTGGTACGTGG + Intergenic
1074191112 10:111138537-111138559 AAGAACACACAGCTGGTAAATGG + Intergenic
1074232289 10:111549499-111549521 CAGGACACAGAGGTGGTCAGAGG - Intergenic
1074297465 10:112203824-112203846 AAGGTCACACAGGGAGTAGGTGG + Intronic
1074390529 10:113053885-113053907 AAGGTCACACAGCTGGGAGGCGG + Intronic
1074419138 10:113293777-113293799 AAGATCACACAGCTGGTAAGCGG - Intergenic
1074720434 10:116259789-116259811 AAGGCCACACAGCTGATACCTGG - Intronic
1075394431 10:122116472-122116494 AAGGTCACACAGCTGGTAAGGGG - Intronic
1075430490 10:122375457-122375479 AAGGTCACGCAGGTGGCACCGGG + Intronic
1075576762 10:123583353-123583375 AAGTTCACACAGTTGGTAAGAGG + Intergenic
1075777320 10:124997253-124997275 AAGGCCACAGAGCTGGTAAGCGG + Intronic
1076059227 10:127400543-127400565 AAGGACACACAGCAGATAAGCGG - Intronic
1077397118 11:2330207-2330229 AAGGGCACACAGGGGGATCGAGG + Intergenic
1077497490 11:2893189-2893211 AAGGACACACAGCTAGTAAGAGG - Intronic
1077634567 11:3833576-3833598 AGGGTCACACAGCTGGTAAGAGG - Intronic
1078409095 11:11096848-11096870 AAGGTCAAACAGCTGGTAAGTGG - Intergenic
1078725672 11:13928779-13928801 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1078795926 11:14591658-14591680 ATGGACACACAGGTTCTCCGAGG - Intronic
1079091337 11:17482361-17482383 AAGGTCACACAGCTGGTCAGGGG - Intergenic
1079152098 11:17909142-17909164 AAGGTCACAGAGGTAGTAAGTGG - Intronic
1079370874 11:19851192-19851214 AAGGTCACACAGCTAGTAAGTGG + Intronic
1079409111 11:20170400-20170422 AAGGTCACACAGTTAGTAAGTGG - Intergenic
1080104120 11:28494034-28494056 AAGGACACACAGCTAGTAAGTGG - Intergenic
1080328183 11:31102920-31102942 AAAGTCACACAGCTGGTACATGG - Intronic
1080426720 11:32161657-32161679 AAAGACAAACAGGAGGTAAGTGG - Intergenic
1080443437 11:32315775-32315797 AAGGTCACACAGCTGGTAACTGG - Intergenic
1080545933 11:33318457-33318479 AAGGTCACACAGCTAGTAAGAGG - Intronic
1080590214 11:33716818-33716840 AAGGACACGTAGGAGGTAAGAGG - Intronic
1080663838 11:34318543-34318565 AAGGACACTCAGTTGGCTCGTGG + Intronic
1081184745 11:40028597-40028619 AAGGACACAAAGCTGATAAGTGG + Intergenic
1081333635 11:41835761-41835783 AAGGAAACACAGTTTGTAAGTGG - Intergenic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1081659906 11:44881719-44881741 AAGGGCACACAGGTAGGAGGTGG + Intronic
1081660208 11:44883529-44883551 AAGGCCACACAGGTAGTAAGTGG + Intronic
1081677065 11:44976312-44976334 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1081779649 11:45701167-45701189 AAGGACACACCGGTTATATGAGG + Intergenic
1081862729 11:46342758-46342780 AAGGTCACCCAGCTGGTAAGTGG - Intronic
1081944039 11:46972970-46972992 AAGGTCACACAGTTGTTAAGTGG - Intronic
1082078266 11:47991738-47991760 AAGGTCACACAGGTAGGAGGTGG - Intronic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1083146446 11:60763351-60763373 AAGGACACACAGCTAGTGCAAGG - Intronic
1083257149 11:61503546-61503568 AAGGTCACACAGCCGGTAAGGGG - Intergenic
1083640095 11:64140775-64140797 AAGGTCACAAAGCTGGTACACGG + Intronic
1084028841 11:66468890-66468912 AAGGGCACACAGCTGGTAAGTGG + Exonic
1084173736 11:67412767-67412789 AAGGTCACACAGCTGGTGAGAGG - Intronic
1084458301 11:69281762-69281784 AAGGAGACAGAAGTGGTACCCGG - Intergenic
1084491876 11:69483337-69483359 AAAGACACACAGCTGATAAGTGG - Intergenic
1084572448 11:69967848-69967870 AAGGCCACACAGGTAGAACAGGG - Intergenic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085029765 11:73264009-73264031 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1085072055 11:73555756-73555778 GAGGACACACAGTTGATACCTGG + Intronic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1085250795 11:75142378-75142400 AAGGTCACACAGTTGGTAAGAGG - Intronic
1085466146 11:76724562-76724584 AAGGGCACAGAGCTGGTAAGCGG + Intergenic
1086280401 11:85179956-85179978 AAGGACACACAGCTAGTAGGTGG + Intronic
1086336269 11:85803764-85803786 AAGGTCACAGAGGTGGTAAATGG - Intronic
1086369143 11:86139436-86139458 AAAAACACACAGCTGATACGTGG - Intergenic
1086823529 11:91467067-91467089 AAGGACACTCAGGTAATAAGTGG - Intergenic
1087157408 11:94918947-94918969 TAGGACACACAGCTGGTATTGGG - Intergenic
1087828511 11:102793676-102793698 AAGGCCACCCAGCTGGTAAGAGG + Intronic
1087954716 11:104271383-104271405 TAGGAGACACAGGTGGTAACTGG - Intergenic
1088046278 11:105456299-105456321 AAGCTCACACAGGTAGTAAGTGG - Intergenic
1088777075 11:113095820-113095842 AAGGTCACACAGTCGGTAGGAGG - Intronic
1088831813 11:113543305-113543327 GAGGTCACACAGCTGGTAAGTGG + Intergenic
1088846778 11:113674926-113674948 AAGGTCACACAGCTGGTGAGGGG - Intergenic
1089299613 11:117490694-117490716 AAGGTCACACAGCTGGTGAGTGG + Intronic
1089308687 11:117543622-117543644 AAAGCCACACAGCTGGTAGGTGG - Intronic
1089319712 11:117617163-117617185 AAAGTCACACAGCTGGTAAGGGG + Intronic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1089983442 11:122791283-122791305 AAGGCCACACAGCTGGTAAGTGG - Intronic
1090915020 11:131155600-131155622 AAGAACACGCAGCTGGTAAGTGG + Intergenic
1091258008 11:134208080-134208102 AAGGACCCACAGCTAGTAAGTGG + Intronic
1091815330 12:3433528-3433550 AAGATCACACAGCTGGTAAGTGG + Intronic
1092086195 12:5764229-5764251 AAAGTCACACAGCTAGTACGTGG + Intronic
1092125198 12:6070489-6070511 AAAGTCACACAGCTGCTACGAGG - Intronic
1092262208 12:6958793-6958815 AAGACCACACAGCTGGTAAGCGG - Intronic
1093506345 12:19871275-19871297 AAGGCCACACAGCTGGTAAATGG - Intergenic
1094066332 12:26364470-26364492 AAGGTCACAGAGCTGGTAAGTGG + Intronic
1094352370 12:29541362-29541384 AAGGAAACACAGCTAGTAAGTGG - Intronic
1094440604 12:30471670-30471692 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1095301671 12:40591362-40591384 AAGGCCACACAGTTGGTTAGTGG + Intergenic
1095956638 12:47810314-47810336 GAGGTCACACAGATGGTATGTGG + Intronic
1096240565 12:49957755-49957777 AAGGACACTCAGGTGCCAGGAGG - Exonic
1097287243 12:57887820-57887842 AAGGTCACACAGGTATTAAGTGG + Intergenic
1098157232 12:67612328-67612350 AAGGGCACACAGCTAGTATGTGG + Intergenic
1099591650 12:84599127-84599149 AAGGTCACAGAGATGGTACATGG - Intergenic
1100300313 12:93300999-93301021 AAGGTCACACAGCTGGTCAGTGG + Intergenic
1100401703 12:94236316-94236338 CAGCACACACAGGTGCTACACGG - Intronic
1100708054 12:97223092-97223114 AAGGACACACAGCTTGTAAGTGG + Intergenic
1101013142 12:100471967-100471989 AAGGTCACACAGCTTGTAAGTGG + Intergenic
1101092888 12:101305703-101305725 AAGGACACACAGCTGGTTGCAGG - Intronic
1101398494 12:104368415-104368437 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1101528714 12:105555628-105555650 AAGGACACACAGCTAGGAAGTGG + Intergenic
1101631184 12:106496484-106496506 AAGGCCACACAGCTGGTAAGAGG - Intronic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101671814 12:106882594-106882616 AAGATCACACAGCTGGTAAGTGG + Intronic
1101819347 12:108171759-108171781 AAGGTCACACAGCTGGTTAGAGG - Intronic
1101840486 12:108324340-108324362 AAGGTCACACAGCTGGTAAGCGG - Intronic
1101881196 12:108627231-108627253 AAAGACACACAGCTGGTGAGAGG + Intronic
1102019662 12:109673366-109673388 AAGATCACACAGCTGGTAAGTGG - Intergenic
1102152422 12:110698006-110698028 AAGGCCACACAGCTGGTAAGAGG + Intronic
1102198688 12:111042515-111042537 AAGGTCACACAGCTGGTAAGTGG - Intronic
1102338907 12:112106585-112106607 GAGGTCACACAGATGGTAAGTGG - Intronic
1102429858 12:112874825-112874847 AACGTCACACAGGTGGAAGGAGG + Intronic
1102498316 12:113334567-113334589 AAGGCCACACAGATAGTAAGTGG - Exonic
1102548934 12:113676885-113676907 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102782906 12:115580903-115580925 AAAGACACACAGTTGGTGGGAGG + Intergenic
1102783026 12:115581926-115581948 AAGGTCACACTGCTGGTAAGTGG + Intergenic
1102894632 12:116588789-116588811 AAGGTCACACAGCTGGTTAGAGG - Intergenic
1103038944 12:117678820-117678842 AAGACCACACAGCTGGTACAAGG - Intronic
1103152463 12:118652768-118652790 AAGGTCACACAGGTAGTAAATGG + Intergenic
1103176474 12:118867905-118867927 AAGGGCACACAGCTGGTTGGTGG - Intergenic
1103208947 12:119153301-119153323 AAGGTCACACAGCTAGTAAGTGG + Intronic
1103231717 12:119336604-119336626 AAAGTCACACAGCTGGTGCGTGG - Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103618543 12:122171259-122171281 AAGGCCACACAGCTGTTAAGGGG - Intronic
1103917427 12:124383257-124383279 AAGGCCACACAGCTAGTAGGTGG + Intronic
1104071807 12:125352465-125352487 AAGGGCACACAGCTGGTATATGG - Intronic
1104072285 12:125356285-125356307 AAAGTCACACAGCTGGTATGTGG - Intronic
1104412228 12:128568615-128568637 AAGGTCACACAGCTGGCAAGTGG + Intronic
1104484382 12:129137453-129137475 AAGGTCACACTGGTGGTAAGCGG + Intronic
1106816141 13:33409363-33409385 AAGGTCACCCAGGTGGCATGTGG + Intergenic
1106859578 13:33890791-33890813 AAGGTCACACAGCTTGTAGGTGG + Intronic
1107332165 13:39312709-39312731 AAGTCAACACAGGTGGTAGGTGG + Intergenic
1107645890 13:42493946-42493968 AAGGACACACAGCTAGTAAGTGG - Intergenic
1107646351 13:42497876-42497898 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1107790733 13:43999626-43999648 AAGGTCACACAGCTGGTAGTAGG + Intergenic
1109881306 13:68480975-68480997 TAGGTCACACAGTTGGTATGTGG - Intergenic
1110686749 13:78384522-78384544 AAGGTTACACAGCTGGTAGGTGG + Intergenic
1110884847 13:80619819-80619841 AAGGACACACAGGTGGATGAAGG - Intergenic
1111184094 13:84708116-84708138 AAGGTCACACATGTAGTAAGAGG + Intergenic
1112375700 13:98838197-98838219 AAGGCCACACAGCTGGTGAGTGG - Intronic
1112383958 13:98920480-98920502 AAGGTTACACAGTTGGTAAGTGG + Intronic
1112834673 13:103499830-103499852 AAAGACACACAGGTGAGACAAGG + Intergenic
1113505910 13:110815736-110815758 AAGGACACAGAAGGGTTACGAGG - Intergenic
1114169687 14:20259860-20259882 AAGGTCATACAGCTGGTAAGTGG - Intronic
1114494527 14:23123517-23123539 AAGGACACACAGCTGTTGAGTGG + Intergenic
1115312550 14:31994035-31994057 AAGGTCACACAGGTCGGAAGGGG + Intergenic
1116875168 14:50104063-50104085 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1116951792 14:50885095-50885117 AAGGTCACACAGCAGGTAAGTGG + Intronic
1117475397 14:56089385-56089407 AAGGTCACACAGCTAGTAGGTGG - Intergenic
1117972250 14:61263504-61263526 AAGGACACACAGCTAGGAAGGGG + Intronic
1118138761 14:63056764-63056786 AAGGTCACACAGCTGATAAGTGG + Intronic
1118595010 14:67428543-67428565 CAAGTCACACAGCTGGTACGTGG + Intergenic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1120188539 14:81419310-81419332 AAGGTCACACAAGTAGTAAGTGG + Intronic
1121051286 14:90820483-90820505 AAGGAGACACTGGTGGGAGGAGG + Intergenic
1121421678 14:93820226-93820248 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1121425446 14:93847427-93847449 AAGGACACACAGCTGCTACGTGG + Intergenic
1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG + Intronic
1121534076 14:94679221-94679243 AATTACACACAGGTGACACGCGG + Intergenic
1121643596 14:95502404-95502426 CAGGACACACAGGCTGTAGGCGG - Intergenic
1122250870 14:100438860-100438882 AGGGTCACACAGCTGGTAAGAGG + Intronic
1122498703 14:102178962-102178984 AAGGCTACACAGCTGGTAAGTGG + Intronic
1122557732 14:102590839-102590861 AAGGGCACAAAGGTGATACTGGG - Intergenic
1122900661 14:104780991-104781013 AATGACCCACGGGTGGGACGCGG - Intronic
1122952233 14:105051348-105051370 GAGGAGAACCAGGTGGTACGGGG + Exonic
1124028580 15:25989394-25989416 AAGGACGCCCAGGTGCCACGTGG - Intergenic
1124054101 15:26225703-26225725 AAGGACACTCAGCTAGTATGTGG + Intergenic
1124182178 15:27486628-27486650 AAGGTCACATAGGAGGTAAGTGG - Intronic
1124643320 15:31413959-31413981 AACGTCACAAAGGTGGTAAGTGG + Intronic
1124800431 15:32827558-32827580 AAGGACATACAGGCCGGACGCGG + Intronic
1124873363 15:33566062-33566084 AAGGTCACACGGCTGGTAAGTGG + Intronic
1125287237 15:38106585-38106607 AAGGACACACAGTTTATAAGAGG + Intergenic
1125607142 15:40946308-40946330 AGGGTCACTCAGCTGGTACGTGG + Intergenic
1125729885 15:41887117-41887139 AAGGCCACACAGCTAGTACGTGG + Intronic
1125758070 15:42079124-42079146 AAGGACACACAGCTAGTAAGAGG + Intronic
1125887869 15:43242181-43242203 AAGGTCACACAGCTAGTAAGAGG + Intronic
1126581798 15:50248817-50248839 AAGGTCACACAGCTAGTAAGTGG - Intronic
1126670472 15:51111073-51111095 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1126955067 15:53924301-53924323 AAGGTCACACAGCTGGTAAATGG - Intergenic
1127426590 15:58864746-58864768 AAGGACACAGAGCTGGTGGGAGG + Intergenic
1128220726 15:65966685-65966707 CAGGACACAAAGGTGGTCCCAGG - Intronic
1128271510 15:66314349-66314371 AAGGTCACACACCTGGTAAGTGG + Intronic
1128336056 15:66786422-66786444 AAGGTCACACAGCTGCTAAGTGG - Intergenic
1128620354 15:69143942-69143964 AAGGTCATACAGCTGGTAAGTGG + Intergenic
1128690709 15:69722845-69722867 GAGGACACACAGCTGGAAAGGGG - Intergenic
1128730906 15:70020437-70020459 AAGGTCACACAGCTTGTATGTGG + Intergenic
1128771484 15:70285948-70285970 AAGGCCACCCAGCTGGTAAGTGG - Intergenic
1129693540 15:77727834-77727856 AAGGTCACACAGCTGGCAGGTGG + Intronic
1129741264 15:77990780-77990802 AAGGCCACACAGCTGGTGAGGGG - Intronic
1129844399 15:78761618-78761640 AAGGCCACACAGCTGGTGAGGGG + Intronic
1129880059 15:79000411-79000433 AAGGTCACACAGCTAGTAGGGGG - Intronic
1129909190 15:79212215-79212237 AAGGACACATGGCTGGTAAGTGG + Intergenic
1130225068 15:82050514-82050536 AGGGTCACACAGCTGGTATGTGG + Intergenic
1130257399 15:82332161-82332183 AAGGCCACACAGCTGGTGAGGGG - Intergenic
1130355402 15:83125406-83125428 AAGGCCACACAGCTAGTAAGTGG - Intronic
1130518322 15:84643357-84643379 AAGGCCACACAGCTGGTAACAGG + Exonic
1130597546 15:85257804-85257826 AAGGCCACACAGCTGGTGAGGGG + Intergenic
1130680244 15:85990201-85990223 AAGGACGCACAAGTGGTTAGTGG - Intergenic
1130910207 15:88265654-88265676 AAGGTCACCCAACTGGTACGTGG + Intergenic
1130992776 15:88886497-88886519 AAGGCCACACAGCTAGTAAGAGG + Intronic
1131196344 15:90358243-90358265 AAGGCCACACAGCTTGTAAGAGG + Intronic
1131382211 15:91973376-91973398 GAGGACACACAGCTAGTAAGGGG + Intronic
1131395563 15:92082883-92082905 AAGGTCACACAGCTTGTACATGG - Intronic
1131943282 15:97591272-97591294 AAGGTCACAGAGGTGGCAAGCGG - Intergenic
1132208406 15:100002487-100002509 CAGGACACACTGGGGGGACGAGG + Intronic
1132240339 15:100252958-100252980 AAGGCCACCCAGCTGGCACGTGG + Intronic
1132315589 15:100888030-100888052 ATAAACACACAGGTGGTACCAGG - Intronic
1133114624 16:3570066-3570088 AAGGATACACAGCTGGGAAGTGG + Intronic
1133218346 16:4307083-4307105 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1133332435 16:4982800-4982822 AAGGTCACACAGCTTGTAAGTGG + Intronic
1133428148 16:5711330-5711352 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1133478795 16:6149304-6149326 AAGGACACACATCTGGTAAAGGG - Intronic
1133590989 16:7243290-7243312 AAGGTCACACAGCTGTCACGTGG - Intronic
1133603058 16:7358744-7358766 AAGTAGTCACAGGTGGTAGGTGG + Intronic
1134026558 16:10958382-10958404 AAGGTCACATAGCTGGTAAGCGG + Intronic
1134060458 16:11196659-11196681 AAGGCCAAACAGCTGGTAAGTGG + Intergenic
1134097073 16:11424972-11424994 AAGGAGACACAGGTGTGCCGGGG + Intronic
1134104051 16:11472582-11472604 AAGGTCACACAGCTGGGAAGTGG - Intronic
1134769642 16:16796286-16796308 AAGGTCACACAGCTAGTAAGAGG + Intergenic
1134819536 16:17235465-17235487 AAGGTCACACAGCTGGAAAGAGG + Intronic
1135046538 16:19160579-19160601 AAGGTCACACAGCTAGTAAGTGG + Intronic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1135114328 16:19712553-19712575 AAGGCCACACAGCTGGCAAGAGG - Intronic
1135132356 16:19863430-19863452 AAGGTCACACAGCTGGTAAGGGG + Intronic
1135163007 16:20114225-20114247 AAGGACACACAGTTAGTATGTGG + Intergenic
1135173362 16:20206455-20206477 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1135195499 16:20390802-20390824 AAGGTCACACAACTGGTAAGTGG - Intronic
1135608340 16:23842202-23842224 AAGGTCACACAGGGAGTAAGCGG - Intronic
1135707444 16:24686960-24686982 AAGGACACAGAGCTAGTAAGTGG - Intergenic
1135792474 16:25409908-25409930 AAGGTCACACAGGTGGCAAATGG - Intergenic
1135928493 16:26716175-26716197 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1135941208 16:26823481-26823503 AAGGTCACACAGCTAGTAGGTGG + Intergenic
1136016609 16:27404755-27404777 AAGGTCACACAGGTACTAAGCGG - Intronic
1136062267 16:27734866-27734888 AAGGTCACACAGCTGGTATGTGG - Intronic
1136109910 16:28058212-28058234 AAGGTCACACAGCTAGTAAGTGG - Intronic
1136340891 16:29642523-29642545 ACGGTCACACAGCTGGTAAGGGG - Intergenic
1136685383 16:31991110-31991132 AAGGTCACACAGGTTGTAAATGG + Intergenic
1136785996 16:32934640-32934662 AAGGTCACACAGGTTGTAAATGG + Intergenic
1136883778 16:33919163-33919185 AAGGTCACACAGGTTGTAAATGG - Intergenic
1137315116 16:47310844-47310866 AAAGTCACACAGATGGTAAGTGG + Intronic
1137333121 16:47520440-47520462 AAGGTCGCACATGTAGTACGTGG + Intronic
1137345061 16:47649700-47649722 AAGAACACACAGCTGGCAAGTGG - Intronic
1137423881 16:48360144-48360166 AAGGTCACACAGCTGGTTAGTGG + Intronic
1137711554 16:50570514-50570536 AAGGTCACACAGCTAGTAAGTGG - Intronic
1137750969 16:50860839-50860861 AAGGACACACAGCTAGGAAGTGG + Intergenic
1137767004 16:50985399-50985421 AAGGCCACACAGCTAGTAAGTGG - Intergenic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138235914 16:55382434-55382456 AAGGCCACACAGCTAGTAAGTGG - Intergenic
1138335876 16:56252492-56252514 AAGGTCACTCAGGTGGTGAGTGG - Intronic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1138764506 16:59585675-59585697 AAGAAAATACAGGTGGGACGTGG + Intergenic
1139317148 16:66082608-66082630 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1139341114 16:66268554-66268576 AAAGACACACAGCTGGCAAGTGG + Intergenic
1139926452 16:70490322-70490344 AAGAAGACACTGGAGGTACGAGG - Exonic
1140599344 16:76456674-76456696 AAGGTCTCACTGGTGGTACCAGG + Intronic
1140962499 16:79930057-79930079 AAGCTCACACAGCTGGTACAAGG - Intergenic
1140998907 16:80289456-80289478 AAGGTCACACAGTTGATAAGTGG + Intergenic
1141437055 16:84005887-84005909 GAGGCCACACAGCTGGTAAGTGG + Intergenic
1141764529 16:86049743-86049765 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1203088232 16_KI270728v1_random:1196298-1196320 AAGGTCACACAGGTTGTAAATGG + Intergenic
1142618541 17:1151058-1151080 AAGGTCACACAGCTGGTAAGGGG - Intronic
1142783677 17:2202817-2202839 AAGGTCACACAGCTGGCAAGTGG + Intronic
1143365622 17:6406664-6406686 AAGGTCACACAGCAGGTCCGTGG - Intronic
1143684086 17:8499965-8499987 AGGGTCACACAGCTGGTTCGTGG - Intronic
1143720408 17:8805200-8805222 AAGGTCACACAGCTAGTAAGTGG - Intronic
1143792787 17:9311650-9311672 AAGGCCACACAGCTAGTAAGTGG - Intronic
1144077271 17:11730556-11730578 AAGGTCACACAGCTAGTAAGTGG - Intronic
1144429821 17:15181066-15181088 AAGGACACACAGGCCGGACGTGG - Intergenic
1144587589 17:16497067-16497089 AAGGTCACACAGGTAGTAAAGGG + Intergenic
1145258025 17:21338156-21338178 AAGGTTACACAGCTGGTAAGAGG - Intergenic
1145318614 17:21749850-21749872 AAGGTTACACAGCTGGTAAGAGG + Intergenic
1146061476 17:29609819-29609841 AAGGTCACACAGCTGTTAAGTGG + Intronic
1146488665 17:33263997-33264019 AAGGTCACACAGCTGGCAGGAGG - Intronic
1146505393 17:33400252-33400274 AAGGACACATAGGTGGAGCATGG - Intronic
1146633061 17:34484499-34484521 AAGGGCACACAGCTGGTGAGTGG - Intergenic
1146650774 17:34604937-34604959 AAGGTCACACAGCTGGAAAGAGG + Intronic
1146931185 17:36779132-36779154 AAGGTCACACAGCTGGTTTGAGG + Intergenic
1147237780 17:39070388-39070410 AAGGTCACACAGCTAGTAAGTGG - Intronic
1147509014 17:41049393-41049415 AAGGACACACAGCCAGTAAGTGG - Intergenic
1147671485 17:42179373-42179395 AAGGTCACACAGTTAGTAAGTGG - Intronic
1147904355 17:43813252-43813274 AATGTCACACAGTTGGTAAGTGG - Intronic
1148190786 17:45677285-45677307 ATGGTTACACAGGTGGTAAGTGG + Intergenic
1148209137 17:45797705-45797727 AAGGTCACACAGGTAGGAGGGGG + Intronic
1148228812 17:45918406-45918428 AAGGTCACACAGCTAGTAGGGGG - Intronic
1148231756 17:45940336-45940358 AAGGACACACAGCTTGTCAGTGG - Intronic
1148248895 17:46056430-46056452 AAGGCCACACAGCTAGTAAGTGG - Intronic
1148358607 17:46993902-46993924 AAGGTCACACAGCTGGTCCATGG + Intronic
1148431721 17:47649076-47649098 AAGGTCACACAGCTGGTTAGTGG - Intergenic
1148983462 17:51599602-51599624 CAGGACACACTGGTGGAAGGGGG - Intergenic
1149414326 17:56443173-56443195 AAGGCCACACAGATGATAAGAGG - Intronic
1149455965 17:56788877-56788899 AAGGACACACAGCTAGTCGGTGG + Intergenic
1149611500 17:57960645-57960667 AAGAACACACAGGTGAACCGTGG + Intergenic
1149986063 17:61348010-61348032 AAGGTCACCCAGGTGGCACTAGG + Intronic
1150439875 17:65182461-65182483 AAGGACACACAGCTGAGAAGTGG + Intronic
1150471529 17:65441578-65441600 AAAGACACACAGCTGGTAAGGGG + Intergenic
1150788004 17:68178232-68178254 AAGGTCACACAGCTGGTCCATGG - Intergenic
1150890526 17:69144053-69144075 AAGGTCACACAGCTAGTACATGG - Intergenic
1151201474 17:72470894-72470916 AAGGTCACACAGCTAGTAGGGGG + Intergenic
1151424587 17:74022648-74022670 AAGGTCACACAGCTGGGAAGAGG - Intergenic
1151567114 17:74904873-74904895 AAGGCCACACAGCTGGAAAGGGG + Intergenic
1151778728 17:76227569-76227591 AAGGTCACACAGATAGTAAGAGG + Intronic
1152376550 17:79921563-79921585 AAGGTCACGCAGCTGGGACGTGG - Intergenic
1152383308 17:79953540-79953562 AAGGTCACACAGCTGGCAAGTGG + Intronic
1152650253 17:81489261-81489283 CAGGGCAGACAGGTGGTATGAGG - Intergenic
1153189955 18:2527004-2527026 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1153331064 18:3875572-3875594 AAGGACACACAGCTAGTATGTGG - Intronic
1153848312 18:9069672-9069694 GAGGCCACACAGCTGGTAAGGGG + Intergenic
1154250243 18:12738253-12738275 AGGGACACACACGGGGCACGTGG - Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155247740 18:23925955-23925977 AAGGTCACACAGCTGGTAAGTGG - Intronic
1155342685 18:24828956-24828978 AAGGACACACAGGCGGTTAGTGG - Intergenic
1155652145 18:28155206-28155228 AAGGTCACACAGGTAGTAGATGG - Intronic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156565039 18:38177792-38177814 AAGAACACACAGCTAGTATGTGG - Intergenic
1156994122 18:43446452-43446474 AAGGTCACACAGCTGATAAGTGG - Intergenic
1157176581 18:45457771-45457793 AAGGACACACAGGTAGTAAGTGG - Intronic
1157301044 18:46479516-46479538 AAGGTCACACAGATGGTAGGTGG - Intronic
1157386961 18:47265543-47265565 AAGACCACACAGCTGGTAAGTGG + Intergenic
1157520737 18:48343591-48343613 AAGGTCACACAGCTGATAGGTGG - Intronic
1157673205 18:49548480-49548502 AAGGAGACAGAGGTGCTAGGAGG + Intergenic
1158149879 18:54356677-54356699 AAAGACACTTAGGTGGAACGTGG + Intronic
1160357646 18:78241880-78241902 AAGGACACACAGATGGGAGTGGG + Intergenic
1160501786 18:79405104-79405126 CACGACACACAGGTGGTTTGGGG - Intronic
1161108074 19:2454549-2454571 AAGGTCACACAGAGGGTAAGTGG + Intronic
1161255008 19:3303591-3303613 AAGGCCACACAGTTGGTATGTGG + Intergenic
1162001670 19:7748129-7748151 AAGGTCACACAGCTGGTAGATGG + Intergenic
1162003408 19:7762633-7762655 AAGGTCACACAGCTGGTAAATGG - Intergenic
1162915332 19:13871609-13871631 AAGGACACACAGGAGGTGTCTGG + Intronic
1162968602 19:14167313-14167335 AAAGACACAGGGGTGGTAGGGGG + Intronic
1163170195 19:15525733-15525755 AAGGTCACACAGGTGGGAGGAGG + Intronic
1163173847 19:15551064-15551086 CAGGACACACAGCTAGTAAGAGG + Intronic
1163306462 19:16482666-16482688 GAGGCCACACACCTGGTACGGGG + Exonic
1163451460 19:17379672-17379694 AAGGCCACAAAGCTGGTAGGTGG - Intergenic
1163789955 19:19300826-19300848 AAGGACACACAGGAGGGCCGGGG + Intronic
1164598571 19:29546398-29546420 AAGGTCACACAGTGGGTAGGTGG - Intronic
1164752612 19:30667951-30667973 AAGGTCACACAGCTGGTAATTGG + Intronic
1165781955 19:38440068-38440090 AAGGCCACACAGTTGGTAACAGG - Intronic
1165925462 19:39323406-39323428 AAGGTCACACAGATAGTATGTGG + Intergenic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166560336 19:43728649-43728671 AATGCCACACAGGTGGTAGATGG + Exonic
1167149411 19:47700148-47700170 AAGGTCACACAGTTAGTAAGTGG - Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1167353573 19:48990694-48990716 AAGGACACACAGGCAGCAAGTGG + Intronic
1168348791 19:55663959-55663981 GAGGACACACAGCTTGTACGTGG + Intronic
1168411392 19:56142327-56142349 AAGGACACAGAGCTGGTAGGAGG + Intronic
925422241 2:3722173-3722195 AAGGCCACACAGCTAGTAAGTGG + Intronic
925628604 2:5866545-5866567 AAGGTCAGAGAGGTGGTAAGAGG - Intergenic
926249518 2:11146283-11146305 AAGGTCACACAGCTGGCAAGTGG + Intronic
926315853 2:11709004-11709026 AAGACCACACAGATGGTAAGTGG + Intronic
926378099 2:12254607-12254629 AAGGCCACACAGCTGGCAGGTGG - Intergenic
926795358 2:16614767-16614789 AAGGCCATACAGCTGCTACGTGG - Intronic
927136522 2:20100578-20100600 AAGGTCACACAGCTGGTTAGTGG - Intergenic
927228175 2:20791267-20791289 AAGCTCACACAGTTGGTAAGTGG - Intronic
927583344 2:24275459-24275481 AAGGTCACCCAGGTAGTAAGTGG + Intronic
927706238 2:25298159-25298181 AAGGTTACACAGGTGGTCAGTGG + Intronic
927710679 2:25323912-25323934 AAGGTCACACAGTGGGTAAGGGG + Intronic
928091332 2:28376920-28376942 GAGGACACACAGGTAGTAAGGGG + Intergenic
928214123 2:29347156-29347178 AAGGTCACATGGGTGGTAAGAGG + Intronic
928389095 2:30895385-30895407 AAGGACACAAGGGTGCTATGGGG + Intergenic
928403158 2:30993787-30993809 GAGGTCACACAGGTGGGAAGGGG + Intronic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
928891357 2:36206967-36206989 AAGGTCACACAGGTAGTAAACGG - Intergenic
929654596 2:43717720-43717742 AAGGTCACACAGGTGGTAAGTGG - Intronic
929667608 2:43845363-43845385 AAGGTCACACAGCTGGTAAGTGG - Intronic
929861525 2:45682360-45682382 AATAACACACTGGTGGTAAGGGG + Intronic
929950349 2:46405430-46405452 AAGGTCACACAGGTAGCACGTGG + Intergenic
930057444 2:47262960-47262982 AAGGTCACATAGCTAGTACGTGG - Intergenic
930085621 2:47495117-47495139 AAGGCCACACAGGTAGTGTGAGG + Intronic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
930901769 2:56515848-56515870 AAAGTCACACAGCTGGTATGTGG + Intergenic
931344695 2:61434930-61434952 AAGGAAACTCAGGAGGTACAAGG + Intronic
931668761 2:64628200-64628222 AAGGTCACACAGCTGGCAAGTGG - Intergenic
932113804 2:69026291-69026313 AAGGACATACAGCTAGTATGTGG - Intronic
932155228 2:69410484-69410506 AAGGTCACACAGGTAGTAAGTGG - Intronic
932303529 2:70685551-70685573 AAAGTCACACAGTTGGTAAGTGG - Intronic
933234579 2:79850662-79850684 AAGGTCAAACAGATGGTAAGTGG - Intronic
934084066 2:88494731-88494753 AAGGTCACACAGCTGGGAAGTGG - Intergenic
934086778 2:88516437-88516459 AAAGACACACAGTTTGTAAGTGG + Intergenic
934684780 2:96313006-96313028 AAGATCACACAGGTAGTAAGGGG - Intergenic
935188153 2:100753063-100753085 AAGGTTACCCAGGTGGTAAGTGG + Intergenic
935671901 2:105563064-105563086 AAGGTCACACAGATAGTAAGTGG + Intergenic
936508444 2:113126790-113126812 AAGGTCACACGGGTGGCACAAGG + Intronic
937250532 2:120521091-120521113 AAGGCCACTCAGGTAGTAAGTGG + Intergenic
937273566 2:120670543-120670565 AAGGTCACACAGCTGGTCAGCGG + Intergenic
937355526 2:121195981-121196003 AAGGTCACACAGCTTGTAAGTGG + Intergenic
938116012 2:128603419-128603441 AAGGGCCCACAGGTGGTTCCAGG - Intergenic
938624551 2:133094061-133094083 AAGGACACACAGGGGGTTTCAGG + Intronic
938800991 2:134763186-134763208 AAGGACACACAGCTAGGAAGTGG + Intergenic
939294013 2:140233845-140233867 AAGTACACACAGGTTGTTTGAGG - Intronic
940665124 2:156599724-156599746 AAGGTCACAAATGTGGTAAGTGG + Intronic
940958180 2:159752877-159752899 AAGGACACACAGCTGGTAAATGG - Intronic
941471151 2:165888937-165888959 AAGGTCACACAGCTAGTAAGTGG + Intronic
941617081 2:167733009-167733031 AAGGTTACACAGCTGGTAAGTGG + Intergenic
941746139 2:169088668-169088690 AAGGTCACCCAGCTGGTAAGTGG + Intronic
942033831 2:171991212-171991234 AAGGTCACACAGCTAGTAAGTGG + Intronic
942128840 2:172857226-172857248 AAGGTCATACAGCTGGTAAGTGG + Intronic
942235740 2:173903352-173903374 AAGGTCACATAGGTGGTAAGCGG + Intergenic
942386136 2:175445110-175445132 AAGGTCACACAGCTGGTAAGTGG - Intergenic
942743333 2:179204014-179204036 TAGGACACCCAGGTGGTATCTGG + Intronic
942881388 2:180865383-180865405 AAGGTCACACAGCTAGTAAGTGG - Intergenic
943082476 2:183271783-183271805 AAGGACACTCAGGTAGGAAGTGG + Intergenic
944540951 2:200753015-200753037 AAGGTCACACAGCTAGTAAGTGG - Intergenic
944692127 2:202167979-202168001 AAGGTCACACAGCTAGTAAGTGG - Intronic
944836454 2:203584919-203584941 AAGGTCACACAGCTAGTAAGTGG - Intergenic
944895679 2:204161475-204161497 AAGGTCACAGAGCTGGTAAGTGG + Intergenic
945265937 2:207891449-207891471 AAGGTCACACAGCAGGTAAGGGG + Intronic
945498626 2:210540702-210540724 AAGGTCACACAAATGGTAAGTGG + Intronic
946175901 2:217921913-217921935 AAGGTCACACAGCTGATAAGTGG + Intronic
946441005 2:219695936-219695958 AAGGTCACACAGCTAGTAAGTGG + Intergenic
947063023 2:226188171-226188193 AAGGGCACACAGCTGTTAAGAGG - Intergenic
948055475 2:235006913-235006935 AAGGACACACAGATGCGGCGTGG - Intronic
948178384 2:235961453-235961475 AAGGACACACCAGTGGTTGGTGG + Intronic
948305431 2:236943884-236943906 CAGGACACACAGCTGGTTTGAGG + Intergenic
948752084 2:240138701-240138723 AAGGTCACACAGCTGGTTAGGGG - Intergenic
1169248438 20:4042178-4042200 AAGGTCACACAGCTGGCAAGCGG - Intergenic
1169612556 20:7398647-7398669 AAAGCCACACAGCTGGTAAGTGG - Intergenic
1169851579 20:10057565-10057587 ACGGACACACAGATAGTTCGGGG - Exonic
1170603077 20:17856389-17856411 AAGGTCACACAGCTGGTTAGAGG + Intergenic
1171055422 20:21901966-21901988 AAGGTCACACAAGTAGTAAGTGG - Intergenic
1171070189 20:22061144-22061166 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1172009946 20:31840960-31840982 AAGGTCACACAGTTAGGACGTGG + Intergenic
1172037480 20:32019865-32019887 AAGGTCACACAGGAAGCACGTGG + Intronic
1172038045 20:32024090-32024112 AAGGTCACACAGCTGGTAAGTGG + Intronic
1172121219 20:32599924-32599946 AAGGTCACACAGCTGGTGAGTGG - Intronic
1172161535 20:32872233-32872255 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172248451 20:33462281-33462303 AAGGCCACACAGCTGGTAGTTGG - Intergenic
1172328632 20:34057907-34057929 AAGGTCACACAGCTAGTAAGTGG + Intronic
1172357951 20:34292698-34292720 AAGGTCACACAGCTGGCAAGTGG - Intronic
1172610028 20:36243829-36243851 AAGGTCACACAGCTGCTAAGTGG + Intronic
1172828794 20:37814097-37814119 AAGGTCACACAGCTAGTACCTGG + Intronic
1172838668 20:37888894-37888916 AAGGTCACACAGGCTGGACGAGG + Intergenic
1172899418 20:38323585-38323607 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172980783 20:38939965-38939987 AGGGTCACACAGCTGGTAGGTGG + Intronic
1173260176 20:41427508-41427530 AAGGTCACACAGCTGGCAAGTGG + Intronic
1173327910 20:42050406-42050428 AAGGTCACACAGCTTGTAAGGGG + Intergenic
1173532403 20:43780465-43780487 AAGGACACACAGCTGGAAAGTGG + Intergenic
1173609643 20:44357219-44357241 AAGGTCACACAGCTGGTGTGTGG - Intronic
1173610345 20:44362801-44362823 AAGGTCACACAGCTAGTAGGTGG - Intronic
1174058456 20:47815833-47815855 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174281627 20:49444077-49444099 AAGGCCACACAGCTAGTAGGTGG + Intronic
1174305821 20:49613640-49613662 AAGGACACACAGCTAGTACAGGG - Intergenic
1174344012 20:49916108-49916130 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1174345256 20:49924347-49924369 AAGGTCACACAGATGGAAAGCGG - Intergenic
1174360123 20:50023587-50023609 AACGACACACAGGTGGGGAGAGG - Intergenic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174399315 20:50267492-50267514 AAGGTCACACAGCTGGGATGTGG + Intergenic
1174426663 20:50436468-50436490 AAGGCCACACAGCTAGTACTTGG + Intergenic
1174857134 20:54056983-54057005 AAGGTCACACAGCTAGTACGTGG + Intronic
1175052064 20:56165000-56165022 AAAGACACACAGCTGCTACATGG - Intergenic
1175126152 20:56753175-56753197 AAGGTCACACAGACGGTAAGTGG - Intergenic
1175194350 20:57232151-57232173 AAGGTCACACAGCTGGTAAGTGG - Intronic
1175538434 20:59732282-59732304 AAGGTCACACAGCTGGTAAATGG - Intronic
1175681710 20:60994152-60994174 AAGGGCACACAGGTGGTAAGTGG - Intergenic
1176073341 20:63237836-63237858 AAGGACACACCGGGGGCCCGGGG + Intronic
1176422423 21:6526918-6526940 AAGAACAGACACGTGGTACAGGG - Intergenic
1177456176 21:21342908-21342930 AAGGTCACACAGGGAGTAAGTGG + Intronic
1178381357 21:32112299-32112321 AAGGACACACAGCTGGGCAGTGG - Intergenic
1178494522 21:33075690-33075712 AAAGCCACACAGGTGGTCAGAGG + Intergenic
1179697914 21:43135234-43135256 AAGAACAGACACGTGGTACAGGG - Intergenic
1180620344 22:17157847-17157869 AAGGGCACACAGCTGGTAAGTGG - Intronic
1180627749 22:17205544-17205566 AAGGACACACAGCTGGTAAATGG - Intronic
1181453287 22:23038129-23038151 AGGGAAACACAAGGGGTACGAGG + Intergenic
1181747017 22:24962509-24962531 AAGGCCACACAGCTGGTAAGCGG - Intronic
1181988687 22:26820349-26820371 AGGGCCACACAGCTGGTAAGAGG + Intergenic
1181996126 22:26884131-26884153 AAGGGCACACAGATAGTAGGTGG - Intergenic
1182086166 22:27562735-27562757 CAGGTCACACAGCTGATACGTGG + Intergenic
1182399079 22:30060585-30060607 AAGGACACGCAACTGGTAAGTGG - Intergenic
1183061571 22:35339387-35339409 AAGGACACATAGCTGGTAACTGG - Intronic
1183083542 22:35472700-35472722 AAGGACACCCAGTCGGTATGTGG - Intergenic
1183457321 22:37929944-37929966 AAGGACACACAGCAGGTGGGAGG - Intronic
1183542348 22:38436824-38436846 AAGGTCACACAGTTTGTAAGTGG + Intronic
1183806075 22:40212262-40212284 AAGGTCACAGATGTGGTAGGTGG - Intronic
1184403896 22:44289230-44289252 AAGGCCACACAGCTGGTGAGTGG + Intronic
1184611142 22:45604238-45604260 AAGGACACACAGCTAGTAAGTGG - Intergenic
1184628968 22:45760755-45760777 AAGGCCACACAGCTGTTAAGTGG + Intronic
949986865 3:9548154-9548176 AAGGTCATACAGTTGGTAAGTGG - Intronic
950124448 3:10502904-10502926 AAGGTCACACAGCTGGCATGTGG - Intronic
950143454 3:10631448-10631470 AAGGTCACACAGTTGGCAAGTGG + Intronic
950143729 3:10633126-10633148 AAGGTCACACAGCTGGGAGGTGG - Intronic
950236271 3:11323378-11323400 AAGGGTACACAGCTGGTAGGAGG - Intronic
950458596 3:13107519-13107541 AAGGCCACAGAGCTGGTAAGTGG + Intergenic
950529959 3:13547752-13547774 AAGGTCACACAGCTGGTGTGTGG + Intergenic
950713927 3:14834282-14834304 AAGGACACACAGCTAGTAAGTGG - Intronic
951109075 3:18779899-18779921 AAGGTCACACAGCTAGTACTTGG - Intergenic
951114331 3:18842160-18842182 AAGGTCACATAGCTTGTACGTGG + Intergenic
951542305 3:23793565-23793587 AAGGTCAAACAGCTGGTAAGAGG - Intergenic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
951871252 3:27364984-27365006 AAGGTCCCACAGCTGGTAAGTGG + Intronic
952011899 3:28909137-28909159 AGGGACACACAGGTAGTAAGTGG + Intergenic
952234535 3:31465051-31465073 AAGGTCACACAGCTGATAAGTGG - Intergenic
952916597 3:38250379-38250401 AAGGTCACACAGCTGGAAAGAGG + Intronic
953271873 3:41453652-41453674 AAAGTCACACAGCTGGTAAGTGG + Intronic
953414305 3:42706902-42706924 AAGGCCACACAGCTGGTAAGTGG + Intronic
953419770 3:42745401-42745423 AAGGTCACACAGCTGGTGAGTGG + Intronic
953861741 3:46550168-46550190 AAGTTCACACAGATGGTAAGTGG - Intronic
953881105 3:46691901-46691923 AAGGACAAACAGGTGGAAGGGGG + Intronic
953908572 3:46881104-46881126 CAGGACACACAACTGGTAAGCGG + Intronic
954812867 3:53258576-53258598 CAGGACACACAGGTCTTGCGGGG + Intergenic
954948335 3:54446394-54446416 AAGGACCCACAGGTGGTGAAGGG + Intronic
955106954 3:55907697-55907719 AAGGTCACACAGCTGGTAAGTGG - Intronic
955640399 3:61076745-61076767 AAGACCACACAGGTGTTAAGAGG + Intronic
955654946 3:61235255-61235277 AAGGACACCCAGTTGGCAAGTGG - Intronic
955755888 3:62224509-62224531 AAGGACACAGATGAGGTAGGGGG + Intronic
955777193 3:62446494-62446516 AAGGTCACACAGCTTGTAAGTGG - Intronic
955959950 3:64330277-64330299 AAACACACACAGCTGGTAAGTGG - Intronic
956100476 3:65762809-65762831 AAGGTCACACAGCTAGTAAGTGG + Intronic
956271195 3:67448736-67448758 AAGGACATATAGCTGGTACTAGG + Intronic
956798061 3:72733685-72733707 AAGGTCACAGAGCTGGTAGGCGG + Intergenic
957620738 3:82590539-82590561 AAGGCCACACAAATGGTAAGTGG + Intergenic
958832638 3:99108194-99108216 AAGGAGACACAGGGGGAACAAGG - Intergenic
959606981 3:108251554-108251576 AAGGTCACACAGCTGGTATGTGG + Intergenic
960166995 3:114413824-114413846 AAGGTCACACAGCTGGTAAATGG + Intronic
960959448 3:123059311-123059333 AAGGCCACACAGCTAGTAAGTGG + Intergenic
961098771 3:124180546-124180568 AAGGTCACACAGCTGATAAGTGG - Intronic
961376137 3:126467292-126467314 AAGGCCACACTGCTGGTAAGAGG - Intronic
962368355 3:134800904-134800926 AAGGTCACACAGCTAGTAAGTGG + Intronic
962631389 3:137279731-137279753 AAGGTCACACAGGTGGCAAGTGG + Intergenic
962708297 3:138065501-138065523 AAGGACAAGCAGGTAGTAAGTGG + Intronic
962829183 3:139124546-139124568 AAGGTCCCACAGCTGGTAAGTGG - Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
962991844 3:140584675-140584697 AAGGTCATACAGGTGGTGAGAGG + Intergenic
963004083 3:140709948-140709970 AAGGTCACACAGCTTGTAAGTGG + Intergenic
963054918 3:141178487-141178509 AAGGTCACACAGCTAGTAAGTGG + Intergenic
964159607 3:153630999-153631021 AAGGTCACACAGCTGGTAAGTGG - Intergenic
964473090 3:157074762-157074784 AAGGACACACAACTTGTAGGTGG + Intergenic
964846960 3:161054659-161054681 AAGGTCACACAGCTAGTAAGGGG - Intronic
965188892 3:165503929-165503951 AAGTACACACAGGTGTTTAGTGG + Intergenic
965727988 3:171739779-171739801 AAGGTCACACAGCTGGTAAGTGG + Intronic
966138670 3:176730212-176730234 AAGGTCACACAGCTTGTAAGTGG + Intergenic
966238745 3:177731128-177731150 AAGGCCACACAGATGGTGAGTGG + Intergenic
966886967 3:184382194-184382216 AAGGTCACACAGCTAGTAAGTGG + Intronic
967493885 3:190121700-190121722 AAGGTCACACAGCTGGTAAACGG - Intronic
968279612 3:197466393-197466415 AAGCTCACACAGCTGGTAAGAGG - Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969200814 4:5604012-5604034 AAGGTCACAAAGCTGGTACATGG - Intronic
969235180 4:5860502-5860524 AAGGAGACACAGCTGGGAAGTGG - Intronic
969587079 4:8100340-8100362 AAGGTCACACAGCTGGGAAGTGG - Intronic
969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG + Intronic
969855487 4:9995831-9995853 AAGGGCACACAGCTAGTAAGTGG + Intronic
970239331 4:13991969-13991991 AAGGCCACAAAGGTGATAAGAGG + Intergenic
970383875 4:15536686-15536708 AAGAACACACAGCTGGTGAGTGG - Intronic
970889704 4:21029248-21029270 AAGGACACACAGCTGATCAGGGG + Intronic
971155181 4:24074213-24074235 AAGCTCACACAGGTAGTAGGAGG - Intergenic
971194821 4:24462528-24462550 AAGGTCACACAGCTAGTAAGTGG - Intergenic
971735184 4:30439899-30439921 AAGGCCACACATCTGGCACGAGG + Intergenic
972162180 4:36240503-36240525 AAGGCCACACAGGTAGCACATGG - Intronic
972180920 4:36464375-36464397 AAGGCCACATAGCTGGTAAGTGG + Intergenic
972353771 4:38261312-38261334 AAGGGCACACAGGTAGTGCATGG + Intergenic
972629031 4:40827643-40827665 AAGGTCACACAGCTAGTAAGTGG - Intronic
972886111 4:43490987-43491009 AAGGACACACAGCTGCTAAGTGG - Intergenic
972901021 4:43683303-43683325 ATTGACACAGAGGTGGTAAGAGG - Intergenic
972985444 4:44757993-44758015 AAGACCACAAAGGTGGTATGTGG - Intergenic
973661707 4:53114047-53114069 AAGGTCACACAGCTAGTAAGTGG - Intronic
973699017 4:53518674-53518696 AAAGTCACACAGCTGGTAAGTGG + Intronic
974400845 4:61403817-61403839 TAGGACACACAGCTGGTACCTGG + Intronic
974886410 4:67823443-67823465 AAGGTCACATAGCTGGTAAGTGG - Intronic
974905617 4:68052684-68052706 AAGGACACACAGCTCCTATGAGG + Intergenic
975299017 4:72767505-72767527 AAGGTCACACAGATGGAAAGTGG - Intergenic
975645531 4:76542302-76542324 AAGGTCACACAGCTAGTAAGTGG + Intronic
975870525 4:78775369-78775391 AAGGTCACACAGCTGGCTCGTGG - Intergenic
976113408 4:81701066-81701088 AAGGACACACAGTTAGTAAGTGG - Intronic
976428211 4:84930494-84930516 AAGGTCACAAAGCTAGTACGTGG + Intronic
977761272 4:100739781-100739803 AAGGTCACACAGGTTGTAGGTGG - Intronic
978022031 4:103826224-103826246 AAGGTCACACATCTGGTAAGTGG - Intergenic
979695691 4:123610688-123610710 AAGGTCACACAGGTAGTAAGTGG + Intergenic
980047941 4:128010023-128010045 AAGGTCACAAAAGTGGTAAGTGG - Intronic
981073197 4:140566954-140566976 AAGGTCACACAGCTGGGAGGGGG - Intronic
981582733 4:146266799-146266821 AAGGTCACACAGGTGGTAAATGG - Intronic
981853115 4:149255310-149255332 AAGGTCACACAGTTGATAAGCGG + Intergenic
983540747 4:168907046-168907068 AAGGTCACACAGGTAGTGAGTGG - Intronic
983735874 4:171059240-171059262 ATGGAAACACAGGTAGTTCGAGG + Intergenic
983764451 4:171460321-171460343 AAGGTCACACAATTGGTAAGAGG - Intergenic
984205671 4:176784896-176784918 AAGGTCACACAGGTACTAAGAGG + Intronic
984662369 4:182387307-182387329 AAGGACACACAGGTTCTCCAAGG - Intronic
985044961 4:185931374-185931396 AAGGACACACAGATTTTATGAGG + Intronic
986056223 5:4139526-4139548 AAGGACACACAGGAAGAAAGTGG + Intergenic
986792158 5:11172641-11172663 AAGCAAACACATGTGGTATGTGG + Intronic
987135522 5:14896371-14896393 AAGGTCACACAGCTGGTAAGAGG - Intergenic
987785792 5:22496979-22497001 AAGATCACACAGCTGGTAAGTGG - Intronic
988508033 5:31841303-31841325 AAGGTCACACATTTGGTAAGTGG - Intronic
988730786 5:33970612-33970634 AAGGTCACACAGCTGGTTAGTGG - Intronic
988997272 5:36726278-36726300 AAAGTCACACAGGTAGTACATGG + Intergenic
989108300 5:37883971-37883993 AAGGTCACACAGTTTGTACAGGG - Intergenic
989140056 5:38193096-38193118 AAGGTCACACAGCTAATACGTGG + Intergenic
989164357 5:38420099-38420121 AAGGTCACACAGCTAGTAAGTGG + Intronic
990294608 5:54387933-54387955 AAGGTCACACAGCTAGTAAGTGG - Intergenic
991617664 5:68513837-68513859 AAGGTCACACAGCTGGTAAGTGG - Intergenic
992175400 5:74144669-74144691 AAGGACACACAGCTGGGAATTGG - Intergenic
992462690 5:76976537-76976559 AAGGACATACAGCTGGTTAGTGG - Intronic
992673020 5:79078520-79078542 AAGGTCACACAGCTGGTCAGTGG - Intronic
992768420 5:80024535-80024557 AAGGCCACACAGCTAGTAAGTGG + Intronic
993027006 5:82658885-82658907 AAGGTCACACAGGTAGAAAGTGG - Intergenic
994252672 5:97555351-97555373 AAGGTCACACAGGAGGGAAGTGG + Intergenic
994966245 5:106675716-106675738 AAGGTCACACAGGTAGTACATGG + Intergenic
995336309 5:111003786-111003808 AAGTTCACACAGCTGGTATGAGG + Intergenic
996366100 5:122703019-122703041 AAGGACACACAGCTGGCAAAGGG - Intergenic
996395130 5:123006093-123006115 AAGGTCACACAGGTATTAAGTGG + Intronic
997304334 5:132826816-132826838 AGGGCCACACAGCTGGGACGTGG + Intronic
997473976 5:134132151-134132173 AAGGTCACACAGCTAGTAAGTGG - Intronic
997736810 5:136218935-136218957 AAGGTCACACAGCTGGAAAGTGG + Intronic
997758997 5:136426719-136426741 AAAGCCACACAGGTAGTAAGTGG + Intergenic
998460465 5:142306181-142306203 AAGGCCACACAGCTGATAAGTGG - Intergenic
998467003 5:142354586-142354608 AAGGGCACACAGGTATTAAGTGG - Intergenic
998475929 5:142421825-142421847 AAGGCCACACAGCTGGTGAGTGG - Intergenic
998543976 5:143010298-143010320 AAGGACACAGAGCTGGTCAGTGG - Intronic
998602305 5:143597505-143597527 AAGGTCACACAGCTGGTGTGGGG + Intergenic
998740109 5:145190860-145190882 AAGGCCACACAGTTGATAAGGGG + Intergenic
998783233 5:145681487-145681509 AAGATCACACAGGTAGTAAGTGG - Intronic
998827699 5:146120906-146120928 AAGGTCACACAGCTAGTAAGTGG + Intronic
998878296 5:146621860-146621882 AAGGAGAGACAGGTTGTACTTGG + Intronic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999255462 5:150207676-150207698 AAGGTCACACAGGTGGGAAGTGG - Intronic
999318540 5:150599538-150599560 TAGGCCACACTGGTGGTAAGGGG - Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999368288 5:151037203-151037225 AAGGTCACACAGCTAGTAAGTGG + Intronic
999585342 5:153083627-153083649 AAGGTCATACAGGTAGTAAGTGG - Intergenic
999686727 5:154109839-154109861 AAGGCCACACAGCTAGTAAGTGG + Intronic
999702739 5:154243043-154243065 AAGGTCACACAGCTAGTAAGTGG - Intronic
1000221659 5:159220209-159220231 AAGGTCACACAGCTGGTAAGAGG - Intergenic
1000473198 5:161671940-161671962 AAGGACTCACAGCTAGTAAGTGG + Intronic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1001042911 5:168349581-168349603 AAGGGCACACAGTCGGTAAGTGG + Intronic
1001175619 5:169466015-169466037 AAGGTCACACAATTGGTAAGTGG + Intergenic
1001303849 5:170557109-170557131 AAGGCCACACAGTTAGTAAGTGG - Intronic
1001309528 5:170600989-170601011 AAGGTCACACAGCTGGTAAGTGG - Intronic
1001523356 5:172411557-172411579 AAAGACACACAGCTGGCATGAGG - Intronic
1001528751 5:172447620-172447642 GAGGTCACACAGTTGGTAGGTGG + Intronic
1001561459 5:172671935-172671957 AAGGCCACACAGCTGGCAAGTGG - Intronic
1001685881 5:173594772-173594794 AAGAACACACAGCTGGTAGGGGG + Intergenic
1001705105 5:173735857-173735879 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1002968954 6:1994763-1994785 AAGGGCACACAGGGGATACATGG + Intronic
1003520002 6:6850366-6850388 AAGGACACAAAAGTGGGAGGGGG + Intergenic
1003728423 6:8792468-8792490 AAGGTCACACAGCTGGTAAACGG + Intergenic
1003978239 6:11364531-11364553 AAGGCCACACAGCAGGTACATGG + Intronic
1004060653 6:12194508-12194530 AAGGACAAACAGGCCGGACGCGG + Intergenic
1004170852 6:13294537-13294559 AAAGTCACACAGATGGTAAGTGG + Intronic
1004189754 6:13453791-13453813 AAAGACACACAGCTAGTAAGTGG + Intronic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004993578 6:21165961-21165983 AAGGTCACACAGGTAGTCAGTGG - Intronic
1006421480 6:33936700-33936722 AAGGTCACACAGGCAGTAAGCGG + Intergenic
1006454926 6:34126207-34126229 AAGGTCACACAGCTAGTAAGTGG - Intronic
1006593515 6:35175895-35175917 TAGGTCACACAGCTGGTAAGGGG - Intergenic
1006609492 6:35285571-35285593 AAGGTCACACAGCTGTTAAGAGG + Intronic
1006807437 6:36797817-36797839 AAGGACACACAGCTAGGAAGAGG - Intronic
1007509721 6:42365664-42365686 AAGGGCACACAGGTAGCAAGTGG + Intronic
1007930302 6:45684985-45685007 AAGACCACACAGTTGGTAGGTGG + Intergenic
1008421661 6:51307913-51307935 AAGGACACACAGGTAGGAAGAGG - Intergenic
1008424210 6:51337926-51337948 AAGGTCACACTGGTGGTAAATGG - Intergenic
1008746671 6:54678800-54678822 AAGGTCACACAGGTAGTAGGTGG - Intergenic
1010041280 6:71387867-71387889 AAGGTCACACAAGTAGTAAGTGG - Intergenic
1010311837 6:74396152-74396174 TAGGACACACAGCTGTTTCGTGG - Intergenic
1011226105 6:85108998-85109020 AAGGTCACACAGCTGGTTAGTGG - Intergenic
1012313993 6:97762395-97762417 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1013039414 6:106418764-106418786 ATGGACACACATGTGGAATGAGG + Intergenic
1013279834 6:108625729-108625751 AAGGCCACACAGCTGGCAGGTGG - Intronic
1015571244 6:134623506-134623528 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015816160 6:137212853-137212875 CAAGACAGACAGGTGGTAGGAGG + Intronic
1017440636 6:154461531-154461553 AAGGTCACACAGCTGGGAAGTGG - Intronic
1017516193 6:155157681-155157703 AATGTCACACAGCTGGTAAGTGG + Intronic
1017749597 6:157479152-157479174 AAGGTCACACAGCTGGTTAGTGG - Intronic
1018002615 6:159593091-159593113 AAGGACACATGGCTGGTAAGAGG - Intergenic
1018321153 6:162610247-162610269 AAGGTCACACAGTTGGTTAGTGG + Intronic
1018928503 6:168223427-168223449 AAGGACACAGAGGAGGTTCTGGG - Intergenic
1020583721 7:10037825-10037847 GAGGACATACAGGTAGTAGGTGG + Intergenic
1022120310 7:27301970-27301992 AAGGCCACACAGCTAGTAAGTGG + Intergenic
1022219372 7:28297344-28297366 AAGGACACACAGACAGTAAGTGG + Intergenic
1022253419 7:28631355-28631377 AAGGCCACACAGCTGGTATTTGG - Intronic
1022257287 7:28671747-28671769 AAGGTCACACAGCTGGCACGTGG - Intronic
1022291703 7:29010933-29010955 AAGGTCATACAGCTGGTACATGG + Intronic
1023552646 7:41386492-41386514 AAGGTCACACAGCTGGTTAGAGG - Intergenic
1024583508 7:50820896-50820918 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1025238074 7:57248244-57248266 AGTAACACACAGTTGGTACGTGG + Intergenic
1026283294 7:68941018-68941040 AAGGCCACATAGCTGGTAAGTGG + Intergenic
1026738009 7:72961037-72961059 AAGCAGACACAGGTGGCACAGGG + Intronic
1026789046 7:73319832-73319854 AAGCAGACACAGGTGGCACAGGG + Intronic
1027105725 7:75404031-75404053 AAGCAGACACAGGTGGCACAGGG - Intronic
1028005057 7:85554950-85554972 AAGGACACAAAGCTGATAAGTGG + Intergenic
1028185274 7:87777325-87777347 AAGGACACATAGCTGATAAGTGG + Intronic
1029600908 7:101562993-101563015 AAGGTCACACAGGCGGTTGGCGG + Intergenic
1029672158 7:102040786-102040808 AAGGTCACAGAGGTGGTGGGCGG - Intronic
1029844178 7:103396097-103396119 AAGATCACACAGCTAGTACGTGG + Intronic
1030112951 7:106042028-106042050 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1030273631 7:107696289-107696311 AAGATCACACAGCTAGTACGTGG + Intronic
1030616377 7:111742421-111742443 AAGGACACATAACTGTTACGAGG - Intronic
1030676399 7:112390324-112390346 AAGGCCACACAGCTAGTAAGCGG - Intergenic
1031083536 7:117280651-117280673 AAGGCCACACAGTTGATACATGG - Intronic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1032012841 7:128358157-128358179 ACGGACAAGCTGGTGGTACGAGG - Intronic
1034137528 7:148785036-148785058 AAGGTCACATAGTTGGTACATGG - Intronic
1036377037 8:8209603-8209625 AAGGACACACAGGTAGCAGGAGG + Intergenic
1036590348 8:10162818-10162840 AAGGCCACACAGGTCATAGGTGG + Intronic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1037561440 8:20078386-20078408 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1037645772 8:20791494-20791516 AAGGTCACACAGCTGGTAGTTGG - Intergenic
1038012743 8:23487707-23487729 AAGGCCACCCAGCTGGTAAGTGG + Intergenic
1038016493 8:23520235-23520257 AAGGACACAAAAGTGGTTGGTGG - Intergenic
1038061225 8:23915416-23915438 AAGGTCACACAGCTGGCAAGTGG - Intergenic
1038226546 8:25663398-25663420 AAAGACACACAGGTGGTTAGGGG - Intergenic
1038402979 8:27299538-27299560 AAGGGCACACAGCTAGTATGTGG + Intronic
1038651860 8:29411262-29411284 AAGGTCACACAGGTAATAAGTGG - Intergenic
1039936928 8:42052782-42052804 AAGGTCACACAGCTAGTATGTGG + Intergenic
1041552401 8:59117993-59118015 TAGGACAGTCAGGGGGTACGAGG - Intronic
1041858911 8:62488879-62488901 AAGGATACACAGGTGCTAAGTGG - Intronic
1041947655 8:63464298-63464320 ATGGACACACAGTTGTTAAGGGG + Intergenic
1042239080 8:66644755-66644777 AAGGTCACACATGGGGTACAAGG + Intronic
1042816927 8:72887970-72887992 CAAGACACACAGGTGGTATAAGG - Intronic
1042999964 8:74745996-74746018 AAGGTCACACAGGTAGTTAGAGG + Intronic
1044032485 8:87255734-87255756 AAGGCCACACAGATGGTAACTGG - Intronic
1044384228 8:91568131-91568153 AAGGTCACATAGATGGTAAGTGG + Intergenic
1044804235 8:95988496-95988518 AAAGACACACAGCTGGTAGGTGG + Intergenic
1044865416 8:96565985-96566007 AAGATCACACAGCTGGTACGTGG - Intronic
1044950355 8:97429994-97430016 AAGGTCACACAGCTGGTTGGTGG - Intergenic
1046110495 8:109717526-109717548 AAGGACTCACAGCTAGTAAGTGG - Intergenic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1046550587 8:115710850-115710872 AAGGTCACTCAGTTGGTAAGTGG + Intronic
1046884118 8:119343916-119343938 AAGGACAGAGAGATGGTAGGGGG - Intergenic
1047206667 8:122807824-122807846 AAGGCCACCCAGGTGGTAAGTGG + Intronic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1047961527 8:130015458-130015480 AAGGTCACACAGCTAGTAAGCGG + Intronic
1047963233 8:130026061-130026083 AAGGTCACACAGCTAGTAAGGGG + Intergenic
1048122499 8:131597673-131597695 TGGGACACACAGGTGGGAAGAGG - Intergenic
1048278166 8:133083472-133083494 AAGAACACACAGCTGGTTAGAGG + Intronic
1048282099 8:133113238-133113260 AAGGACACACAGCTAGAAGGAGG + Intronic
1048283420 8:133122555-133122577 AAGGCCACACAGATAGTAAGTGG - Intronic
1048809180 8:138269686-138269708 AAGGCCACACAGCTGGAAAGTGG - Intronic
1048819567 8:138368351-138368373 AAGGTCACACAGCTGGAAAGCGG - Intronic
1048866744 8:138767043-138767065 AAGGTCACACAGCTGGAGCGTGG - Intronic
1049231181 8:141483015-141483037 AAGGGCACACAGGTGAAACAAGG - Intergenic
1049245290 8:141559180-141559202 GAGGTCACACAGCTGGTCCGTGG - Intergenic
1049264661 8:141661018-141661040 AAGGACACAGAGCTGGGAAGTGG - Intergenic
1049718151 8:144103457-144103479 AAGGGCACCCAGGTGGCAAGCGG + Intronic
1051540940 9:18216893-18216915 TAGGCCACACAGCTGGTAAGGGG - Intergenic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1052170973 9:25396121-25396143 CAGGACACAGAGGTGGTAAGTGG - Intergenic
1053135568 9:35648506-35648528 AAGAACACACAGCTGGTAAGTGG + Intergenic
1053256576 9:36621527-36621549 AAGGTCACACAGCTAGTAAGAGG + Intronic
1053274231 9:36771155-36771177 AAGGTCACACAGGGGGCACATGG - Intergenic
1053293078 9:36894915-36894937 AAGGTCACACGGCTGGTAAGTGG - Intronic
1053294657 9:36904001-36904023 AAGGTCACACAGCTTGTAAGTGG - Intronic
1053422495 9:37988262-37988284 AAGGTCACACAGCTGGTGAGCGG - Intronic
1053679631 9:40475836-40475858 AAATACACACAGGAGGTATGTGG - Intergenic
1053929625 9:43104165-43104187 AAATACACACAGGAGGTATGTGG - Intergenic
1054284090 9:63149109-63149131 AAATACACACAGGAGGTATGTGG + Intergenic
1054292712 9:63311372-63311394 AAATACACACAGGAGGTATGTGG - Intergenic
1054390730 9:64615847-64615869 AAATACACACAGGAGGTATGTGG - Intergenic
1054504991 9:65900462-65900484 AAATACACACAGGAGGTATGTGG + Intergenic
1054728079 9:68672791-68672813 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1054764017 9:69027572-69027594 AAGGACACACAGGTAGTTGAGGG + Intergenic
1054850531 9:69842679-69842701 AAGGCCACACAGCTGGGACCTGG + Intronic
1055097597 9:72429808-72429830 AAAGTCACACAGGTAGTAAGAGG - Intergenic
1055316278 9:75037541-75037563 TAGGCCACACAGGAGGTAAGTGG + Intergenic
1056193794 9:84209818-84209840 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1056285270 9:85081277-85081299 AAGGCCACACAGCTGTTAAGTGG - Intergenic
1056316633 9:85396646-85396668 AAGCTCACACAGGTGCTAAGTGG + Intergenic
1056411040 9:86327484-86327506 AAGGACACACAGCTGGGAAGTGG + Intronic
1057197243 9:93121893-93121915 AAGGACACACAGCAGGTCCGTGG - Exonic
1057745085 9:97745096-97745118 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1058739630 9:107930236-107930258 AAGGACACACAGTTGTTTGGGGG + Intergenic
1058800531 9:108540826-108540848 AAGGACATAGAGCTGGTAAGTGG + Intergenic
1059206328 9:112469745-112469767 AAGGTCACACAGCTTGTATGAGG - Intronic
1059376756 9:113888094-113888116 AAGGCTACACAGCTGGTAAGTGG + Intronic
1059685146 9:116627956-116627978 AAGGTCACAGAGCTGGTAAGTGG + Intronic
1059695637 9:116727749-116727771 AAGGTCACACAGCTAGTAAGTGG - Intronic
1059761889 9:117345530-117345552 AAGGTCACACAGCTGATAGGTGG + Intronic
1059974626 9:119702250-119702272 AAGGAAACACAGCTAGTAAGTGG - Intergenic
1059990007 9:119856005-119856027 AAGGTCACACAGCTGGTAAATGG + Intergenic
1060000681 9:119955798-119955820 AAGGAGACACAGCTAGTAAGTGG + Intergenic
1060019263 9:120115114-120115136 AAAGACACACAGCTGGGAAGTGG + Intergenic
1060039482 9:120287399-120287421 AAAGCCACACAGCTGGCACGTGG - Intergenic
1060238435 9:121883197-121883219 AAGGCCACACAATTGGTAAGGGG - Intronic
1060276535 9:122186972-122186994 AAGGTCACACAGCTGGTGAGTGG - Intronic
1060287627 9:122267924-122267946 AAGGTCACACAGCTAGTAAGTGG + Intronic
1060386810 9:123237970-123237992 AAGGTTACACAGGTGGCAAGTGG - Intronic
1060400330 9:123344858-123344880 AAGGTCACACAGCTGGTAGAAGG - Intergenic
1060443784 9:123668550-123668572 AAGGTCACACAGCTAGTACGTGG + Intronic
1060506686 9:124203025-124203047 AAGGTCACACAGCTGATAAGTGG - Intergenic
1060578176 9:124717775-124717797 AAGGTCACACAGCTGGTAAGTGG - Intronic
1060674362 9:125499103-125499125 AAGGTCACACAGCTAGTAAGTGG + Intronic
1060720348 9:125972392-125972414 AAGGACACACAGCTGACAGGAGG - Intergenic
1060736327 9:126068716-126068738 AAGGACACACAGCTAGTGAGAGG + Intergenic
1060741912 9:126104355-126104377 TAGGTCACACAGCTGGTAAGTGG - Intergenic
1060877067 9:127091245-127091267 AAGGACACATGGCTGGTAGGAGG + Intronic
1061067735 9:128289200-128289222 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1061183550 9:129038655-129038677 AAAGTCACACAGCTGGTACTTGG - Intronic
1061218557 9:129235841-129235863 AAGGACACACAGTGGGTGCAGGG + Intergenic
1061254703 9:129447894-129447916 AAGGCCACTCAGGTAGTAAGTGG + Intergenic
1061404093 9:130384144-130384166 AAGGCCACACAGCTGGTCAGTGG - Intronic
1061857113 9:133448458-133448480 GAGGTCACACAGCTGGTAAGTGG + Intronic
1062732289 9:138116941-138116963 AAGGACACACTGGTGGTTGCTGG - Intronic
1186517848 X:10179901-10179923 AAGGTCACACGGGTGGTAAGTGG + Intronic
1186712728 X:12217009-12217031 AAGGGGACACAGGTGGCACCTGG + Intronic
1186780761 X:12909766-12909788 AAGGTCACTCAGATGGTAGGTGG - Intronic
1187227870 X:17391304-17391326 AAGGTCACACAGCTGGTAAGTGG - Intronic
1187241285 X:17515812-17515834 AAGGACACGCAGCTAGTAGGTGG + Intronic
1187338527 X:18401533-18401555 AAGGTCACACAGCTGGGAAGCGG + Intergenic
1187353579 X:18544546-18544568 AAGGCCACTCAGGTAGTAGGTGG + Intronic
1187406058 X:19005066-19005088 AAGGACACACAGATAGAAAGTGG + Intronic
1187678354 X:21740761-21740783 AAGGCCACACAGCTGGGAAGTGG + Intronic
1188712895 X:33423571-33423593 ATGCACACACAGATCGTACGTGG - Intergenic
1189217431 X:39338213-39338235 AAGGGCACACAATTGGTAAGTGG + Intergenic
1189217787 X:39342069-39342091 GAAGACATACAGGTGGTAAGAGG - Intergenic
1189226929 X:39420745-39420767 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1189346674 X:40247212-40247234 AAGGTCACACAGGTAGTAAGTGG + Intergenic
1189795230 X:44639611-44639633 AAGAGCACACAGATGGTAAGTGG + Intergenic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1192291624 X:69802629-69802651 AAGGACATACAGTTGGTTAGTGG - Intronic
1192591358 X:72362484-72362506 AAGGTCACACAGCTAGTAGGTGG - Intronic
1192627449 X:72745056-72745078 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1192654259 X:72975757-72975779 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1194694064 X:97023525-97023547 AAGGTCACACAGCTAGTAAGTGG + Intronic
1194773074 X:97928554-97928576 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1195688928 X:107608308-107608330 AAGGTCACACAGCTGGTAAATGG + Intergenic
1195733897 X:107993460-107993482 AAGGCCATACAGGTAGTAAGTGG + Intergenic
1196185247 X:112738555-112738577 AAGGTCACACAGTTGGTTAGTGG + Intergenic
1196186073 X:112746440-112746462 AAGGCCACACAGCTAGTAAGTGG + Intergenic
1196187390 X:112759076-112759098 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1196647530 X:118133795-118133817 AAGAACACACAGCTGGAATGTGG - Intergenic
1196774697 X:119327621-119327643 AAGGCCACACAGCTGGTAAGTGG - Intergenic
1196934358 X:120714884-120714906 AAGATCACACAGGTGGTAAGTGG - Intergenic
1197117213 X:122847954-122847976 AAGACCACACAGGTAGTAAGTGG + Intergenic
1197172904 X:123454258-123454280 AATGCCACACAGCTGGTATGTGG - Intronic
1197610133 X:128628981-128629003 AAGGACACACAGCTAGCAAGTGG + Intergenic
1197681051 X:129385806-129385828 AAGGTCACACATCTGGTAAGTGG - Intergenic
1197822312 X:130553754-130553776 AAGGTCACACAGCTGGTCAGTGG - Intergenic
1197829697 X:130628277-130628299 AAGGTCACACAGCTGGTAAGTGG + Intronic
1197890319 X:131263917-131263939 AAGGACATGCAGTTGGTAAGTGG + Intergenic
1197899962 X:131360088-131360110 AAGGTCACACAGATGATAAGTGG + Intronic
1198227594 X:134659866-134659888 AAGGTCACACAGGTACTAAGTGG + Intronic
1198651326 X:138866585-138866607 AAGGTCACACTGGTGGTAAGTGG - Intronic
1198659768 X:138955538-138955560 AAGGTTACACAGGTAGTAAGTGG + Intronic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1198720509 X:139613627-139613649 AAGGACACACAGCCAGTACATGG + Intronic
1198732079 X:139742349-139742371 AAGGACACACAGCTAGTAAGTGG + Intronic
1199586112 X:149417964-149417986 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1199697587 X:150353794-150353816 AAGGTCACAGAGCTGGTAAGAGG + Intergenic
1199903799 X:152204487-152204509 AGGGTCACACAGTTGGTAAGTGG - Intronic
1201857446 Y:18560535-18560557 AAGCAAAAACAGGTGGTAGGAGG + Intronic
1201875875 Y:18759845-18759867 AAGCAAAAACAGGTGGTAGGAGG - Intronic
1202273367 Y:23091643-23091665 AAAGTCACACAGCTGGTAAGTGG - Intergenic
1202292659 Y:23329039-23329061 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1202426364 Y:24725387-24725409 AAAGTCACACAGCTGGTAAGTGG - Intergenic
1202444425 Y:24944699-24944721 AAAGTCACACAGCTGGTAAGTGG + Intergenic