ID: 1085250607

View in Genome Browser
Species Human (GRCh38)
Location 11:75141170-75141192
Sequence GTGAACAGGAGGAAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085250603_1085250607 12 Left 1085250603 11:75141135-75141157 CCATTTGCATTGGAGCATTGGAG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG 0: 1
1: 0
2: 3
3: 42
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085250607 Original CRISPR GTGAACAGGAGGAAGGCTGC AGG Intronic
900548554 1:3242058-3242080 GGGAACAGGAGGGAGCCTCCCGG + Intronic
900827725 1:4940070-4940092 GTGAAGAGGAGAAAGGCAGCTGG + Intergenic
900914592 1:5627153-5627175 ATGACCAGGAGGAAGTTTGCAGG + Intergenic
900990221 1:6095263-6095285 GTGAGCAGGCGGGAGGCTGCCGG - Intronic
901868921 1:12126153-12126175 GACACCAGGAGGAAGGCTGGGGG - Intronic
902247286 1:15129265-15129287 ATGAAGAGGAGGCAGGCGGCTGG - Intergenic
902815137 1:18912111-18912133 CTGAACAGAAGGCAGGCTCCAGG + Intronic
903063511 1:20685739-20685761 GTGCAAAGGACGAGGGCTGCAGG - Intronic
903372953 1:22848638-22848660 GTCAACAGGAGGAAGGTGACGGG + Intronic
904604192 1:31689975-31689997 GTGGACAGCAGGAATGCCGCTGG + Intronic
904855070 1:33491571-33491593 ATGAGCAGGAGGAAGGGGGCTGG + Exonic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
905755248 1:40503783-40503805 TGGAAGAGGAGGGAGGCTGCCGG + Intergenic
906030715 1:42718003-42718025 GTGGAGATGCGGAAGGCTGCGGG - Intergenic
906551604 1:46670365-46670387 ATGAAGAGGAGGAAGGCTGTAGG + Intronic
907460018 1:54599932-54599954 GGGATCAGGAGCCAGGCTGCCGG + Intronic
908069573 1:60443530-60443552 GTGAACAGATGCAAGGCTGTTGG - Intergenic
909478328 1:76107674-76107696 TTGAACAGGAGGTGGGCTGGCGG - Intronic
910259822 1:85284125-85284147 GAGCACAGGAGGGAGGCTGAGGG + Intergenic
910283106 1:85523344-85523366 GAGAAGGGGAGGAGGGCTGCAGG - Intronic
910468961 1:87530260-87530282 GTGAACAGGAGGAAGCTCACAGG + Intergenic
910713801 1:90208663-90208685 GTGGGCAGGAGGGAGGATGCTGG + Intergenic
911054609 1:93699360-93699382 ATGAACAGGAAGAAGACTGTAGG - Intronic
912932862 1:113980297-113980319 GGGATCAGGAGGGAGGCTGCAGG - Intronic
912933352 1:113983040-113983062 GAGAGGAGGAGGAAGGCTCCAGG + Intergenic
914206909 1:145539645-145539667 GAGAAGGGGAGGAGGGCTGCAGG + Intergenic
914889683 1:151612029-151612051 GTGAAGAGGAGGCAGGGGGCGGG - Intergenic
916429246 1:164711755-164711777 GTGTACATGTGGAAGGCTGAAGG + Intronic
917534825 1:175866803-175866825 GTGAGCAGGAGAAAGGCAGGTGG + Intergenic
918083752 1:181227796-181227818 GAGAAGAGAAGGAAGGATGCTGG - Intergenic
918608548 1:186459202-186459224 CTGAAAAGGAGGAAGGGTCCTGG - Intronic
919972129 1:202587870-202587892 GACACCAGGAGGCAGGCTGCGGG + Exonic
920180838 1:204130920-204130942 GTGCACAGGAGGATGTGTGCAGG + Intergenic
922318816 1:224466275-224466297 GAGAACAGAAGAATGGCTGCTGG - Intronic
922377373 1:224981945-224981967 TTGAACAGGCTGAAGGCAGCCGG + Intronic
923059361 1:230456181-230456203 GGGAAGAAGAGGCAGGCTGCTGG + Intergenic
923163361 1:231337227-231337249 TTGAGAAGGTGGAAGGCTGCAGG - Exonic
923163727 1:231339505-231339527 TTGAGAAGGTGGAAGGCTGCAGG - Intronic
923215576 1:231845380-231845402 GTGAATGGGAGGAAGGCCGGCGG + Intronic
923445832 1:234070281-234070303 GTGAATATGATGAAGCCTGCAGG + Intronic
924270117 1:242323611-242323633 GGGAACTGGAGAAAGGCTGCAGG - Intronic
1062815123 10:493709-493731 GTGGACAGGAGAAAGGATGGAGG + Intronic
1062951454 10:1506921-1506943 GTGAGCAGGTGGCTGGCTGCAGG + Intronic
1062999370 10:1900156-1900178 GGGAACAGGAGCCAGGCTGGGGG + Intergenic
1063047008 10:2402089-2402111 GTGAACAGGAGCAAGGGGGATGG - Intergenic
1063342160 10:5276451-5276473 GTGTATATGAGGAAGGCTTCAGG + Intergenic
1063389627 10:5640776-5640798 GTGAACTTGAGGAAGGCCACTGG - Exonic
1064698196 10:17989043-17989065 GTCAACAGGAGGCAGCCTCCTGG - Intronic
1064768466 10:18698755-18698777 GTGACCAGGAGGAGGGGTGGGGG - Intergenic
1066566983 10:36731081-36731103 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1066714792 10:38275145-38275167 GGGAACTGGAGAAAGGCTGCAGG + Intergenic
1066783281 10:38975560-38975582 GGGAACTGGAGAAAGGCTGCAGG - Intergenic
1067694886 10:48527566-48527588 GTGAACAGAAGGAAGGATGATGG + Intronic
1070602254 10:77873972-77873994 GTGAGCTGGAGGAGGGCGGCAGG - Intronic
1070668181 10:78359984-78360006 GTGAGCAGGAGGGAGCCTGGGGG + Intergenic
1070959484 10:80488554-80488576 GGGAGCAGGGGGATGGCTGCTGG + Intronic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072756936 10:98027838-98027860 GTGAAGAGGAAGCAGGCCGCTGG + Intronic
1073339750 10:102735711-102735733 GGGAACAGGAGGAGGGTTGGAGG + Intronic
1073984002 10:109187232-109187254 GTGAGGAGTAGGGAGGCTGCTGG + Intergenic
1075798471 10:125137197-125137219 GACAACAGGAAGAAGGATGCAGG + Intronic
1076929262 10:133518792-133518814 TTGAACAGGCTGAAGGCAGCGGG - Intergenic
1077319868 11:1936365-1936387 GGGGGCAGGAGGAAGGCTCCAGG - Intronic
1077363735 11:2152948-2152970 ATGAACAGGAGGGAGGCTCCAGG + Intronic
1077756219 11:5030669-5030691 TTGAACAGGCTGAAGGCAGCCGG + Intergenic
1078362705 11:10681496-10681518 GTGACAAGGAGGAGGACTGCAGG - Intronic
1080711073 11:34748562-34748584 GAGGGCAGGAGGAAGGCTGGAGG + Intergenic
1081630309 11:44685050-44685072 GGGAACAAGAGGCTGGCTGCAGG + Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081781599 11:45716819-45716841 GTGAGCCTGAGGAAGGCTTCAGG - Intergenic
1082877700 11:58004719-58004741 GTGTACAGGGTGAAGGTTGCTGG + Intergenic
1083434110 11:62630906-62630928 GTGAACTAGAGGCAGGCTGAGGG + Intronic
1084615644 11:70234116-70234138 GTCAGCAGGAGGCAGGCTCCTGG - Intergenic
1085212222 11:74791506-74791528 GAGGACAGGAGGAAGGCTGTGGG - Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1087171620 11:95054866-95054888 GGGAGCAGGAGGAAGGCCGGCGG - Intergenic
1087917266 11:103825402-103825424 GGGAACAGGAGGCAGACTGCTGG + Intergenic
1089396881 11:118141904-118141926 GTGGAGAGGAGGAAGACTGTGGG - Intronic
1090499004 11:127243460-127243482 GTGAAAAGGAAGAAAGCTGGAGG + Intergenic
1090982737 11:131737755-131737777 GTGAGCAGGAGGCAGGATGGGGG + Intronic
1091507888 12:1091454-1091476 GGAAACAGGAGGGAGGCTGGAGG + Intronic
1092829473 12:12429799-12429821 ATGAAGTGGAGGAAGGCTACAGG - Intronic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094363145 12:29651631-29651653 GTTCACAGGAGGAGGGCTGTGGG - Intronic
1098864414 12:75745715-75745737 GTGGAGAGGAGAAAGGCTGGTGG + Intergenic
1099993620 12:89753142-89753164 GTGAAGATGAGGAAGTCTGGGGG + Intergenic
1100415986 12:94375428-94375450 GTGAACAGGAGGAAAAATACAGG + Intronic
1102499354 12:113340774-113340796 GAGCCCAGGAGTAAGGCTGCAGG + Intronic
1103211363 12:119169239-119169261 GGGAGCAGGAGGAAGACTGGAGG - Intergenic
1103427151 12:120845663-120845685 GTGGACAGGTGGAAGGACGCTGG + Intronic
1104588616 12:130066987-130067009 CTGTAAAGGAGGGAGGCTGCAGG + Intergenic
1105707175 13:22975220-22975242 GGGAAAAGGAGTCAGGCTGCAGG + Intergenic
1107328579 13:39272177-39272199 GTGAAAAGATGGAAGGCTGCTGG + Intergenic
1107892375 13:44925376-44925398 GTGAAAAGCAGGAAAACTGCAGG - Intergenic
1109103777 13:58222317-58222339 GTTAGCAGGAGGAAGGATCCAGG + Intergenic
1109334220 13:60971780-60971802 GAGAACAGAAGGAAGGGTGGGGG - Intergenic
1110763818 13:79259702-79259724 GTGAAGAAGAGTAATGCTGCAGG + Intergenic
1111721176 13:91947018-91947040 GTGAACAGATGGAATGCTGCTGG - Intronic
1111955928 13:94758471-94758493 GTGGGGAGGACGAAGGCTGCTGG - Intergenic
1112455749 13:99561126-99561148 GTGAACAGGTGGAAGCATTCTGG + Intronic
1113091273 13:106619372-106619394 GAGACCAGGAGGAAGGCCACTGG - Intergenic
1113520130 13:110934642-110934664 GGGGACAGCAGGAAGGCTGGAGG + Intergenic
1114004968 14:18302418-18302440 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1114600442 14:23951944-23951966 GTACACAGGAGGACGGCTGCGGG - Intergenic
1114604624 14:23986779-23986801 GTACACAGGAGGACTGCTGCGGG - Intronic
1114610085 14:24034347-24034369 GTACACAGGAGGACGGCTGTGGG - Intergenic
1117322377 14:54636303-54636325 GTGATCAAGAGGAAGGGTGGTGG + Intronic
1118729687 14:68657675-68657697 GTGTACTGAAGGAAGCCTGCAGG + Intronic
1118845744 14:69546782-69546804 GTTGAGATGAGGAAGGCTGCCGG + Intergenic
1119635269 14:76268238-76268260 ATGAACAGAAGGACGGCTGTGGG - Intergenic
1119672463 14:76530042-76530064 GTGAAGAGGAGGAAGGACGGGGG - Intergenic
1120963960 14:90151007-90151029 GTGAACAGGAGGAAGAAGGGAGG - Intronic
1121331900 14:93054998-93055020 GGGGACAGGAGGCAGGCTGGCGG - Intronic
1121527203 14:94627462-94627484 GGGAACAGGTGGAGGGCTGGAGG + Intergenic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122809564 14:104281336-104281358 GTGAGCAGGGGGAGGGCGGCAGG - Intergenic
1122851107 14:104531705-104531727 GGGAAAAGGAGTCAGGCTGCAGG + Intronic
1123010629 14:105348003-105348025 ATGAACAGAAGGAAGGTTGGGGG + Intronic
1123389426 15:19854652-19854674 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1123699454 15:22903628-22903650 GTGACATGGAGGAAGCCTGCGGG + Intronic
1123977034 15:25563484-25563506 GTGACCAGGGGGCAGGCTGCTGG - Intergenic
1124205233 15:27712907-27712929 GGGAAGAGGAGGCAGCCTGCTGG + Intergenic
1125377202 15:39042899-39042921 GTTACCAGGAGGAAGAATGCAGG + Intergenic
1125743152 15:41981496-41981518 GTGGAGAGGAGGAAGCCTGAAGG + Intergenic
1125935668 15:43633431-43633453 GTGAGCAGGGGGAAGAGTGCTGG - Intronic
1125948439 15:43729895-43729917 GTGAGCAGGGGGAAGAGTGCTGG - Intergenic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128145704 15:65331411-65331433 CTGCACATCAGGAAGGCTGCTGG - Exonic
1128504151 15:68254633-68254655 GTGCCCAGGAGAAAGGCTGAAGG + Intronic
1128756977 15:70189838-70189860 TGGTACAGGAGGAAGACTGCAGG - Intergenic
1129122496 15:73409340-73409362 GTGAAGAGGAGGGAGGCTAGAGG - Intergenic
1131372867 15:91897838-91897860 GTGAGCATGAGGATGGGTGCGGG + Intronic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1132105658 15:99060660-99060682 GTGTACAGGAGGATGTGTGCAGG + Intergenic
1132203633 15:99971928-99971950 ATGAACAGAAGGTAGGCTGGTGG + Exonic
1132316384 15:100893388-100893410 GGGAACAGCAGGAAAGCTGGTGG + Intronic
1132595678 16:748229-748251 GGGAACATGGGAAAGGCTGCCGG + Intronic
1132926691 16:2433461-2433483 GTGAACAGGGGCCAGGGTGCGGG - Intronic
1133436427 16:5784123-5784145 GTGAAGAGGAAGCAGGCAGCCGG + Intergenic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1134459531 16:14419414-14419436 TTAAACAGGAAAAAGGCTGCAGG - Intergenic
1135138576 16:19902899-19902921 GTGAACAAGAGGGAGGGTGTTGG + Intergenic
1135468918 16:22712095-22712117 AGGTGCAGGAGGAAGGCTGCAGG + Intergenic
1135990507 16:27216079-27216101 GTGAGTAGGAGGGAGGCAGCAGG + Intronic
1136394001 16:29983047-29983069 GCGAACAGGGCGTAGGCTGCTGG - Intronic
1137244109 16:46688962-46688984 GACAGCAGGAGGAAGGCCGCGGG - Intronic
1137726731 16:50661792-50661814 CTAAACAGGACGAAGGCTGTTGG - Intergenic
1137762592 16:50952631-50952653 GTGGACAAAACGAAGGCTGCTGG + Intergenic
1138536557 16:57663445-57663467 ATGAAGATGAGGAAGCCTGCGGG - Exonic
1139926844 16:70493153-70493175 GTGAGCTGGAGAGAGGCTGCTGG - Intronic
1141627072 16:85266949-85266971 GGGGACAGGAGGGAGCCTGCAGG + Intergenic
1142414335 16:89933368-89933390 GTGAGCAGGAGGATGGCAGGCGG + Intronic
1142522135 17:512496-512518 GTGAACAGGAGGGAAGATGCCGG - Exonic
1142524201 17:527165-527187 GAGAGCATGAGGAAGGCTTCAGG - Intronic
1142684561 17:1570445-1570467 GTGCCCAGGAAGAAGGCAGCTGG - Intronic
1143633895 17:8153485-8153507 GTCAACAGGAGAAAGGGGGCTGG + Intronic
1143637726 17:8176052-8176074 GTGAAAAAGGGGCAGGCTGCAGG + Intronic
1144325976 17:14180459-14180481 TTGAACAAGAGGAACGCTGCTGG + Intronic
1144474851 17:15577348-15577370 TTGAACAAGAGGAACGCTGCTGG + Intronic
1144949400 17:18985820-18985842 GTGACCAGCTGGAAGGCAGCTGG - Intronic
1145987411 17:29056313-29056335 GTGCACAGAAGGGAGGCTTCTGG - Exonic
1146653492 17:34621656-34621678 GTCATCAGCAGGAAGGCAGCAGG + Intronic
1148857553 17:50587027-50587049 GTGAACAGCAGGAAGGATGCAGG + Intronic
1151457081 17:74232659-74232681 GTGAAGAGGAGGCAGGCAGCAGG - Intronic
1151598440 17:75091722-75091744 GTGAAAGGGAGGGAGGCTGTGGG + Intronic
1152782827 17:82233788-82233810 GGGAACAGGACGCAGACTGCGGG - Exonic
1153343748 18:4004374-4004396 GAGAGCAGGAGGAAGGCAGAGGG - Intronic
1154031403 18:10756870-10756892 GAGATGAGGAGGAAGGATGCAGG + Intronic
1154532455 18:15361461-15361483 GTGAGCTGAAGGAAGGTTGCTGG - Intergenic
1155499124 18:26469584-26469606 TTGAAAAGGATGCAGGCTGCAGG - Intronic
1159626663 18:70703153-70703175 GAGATCAAGATGAAGGCTGCAGG + Intergenic
1162449250 19:10744578-10744600 GTGAACTAGAGGCAGGCAGCCGG - Intronic
1164006397 19:21153688-21153710 TTGAACTTGAGGAAGGCTGTGGG + Intronic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1164180174 19:22811420-22811442 GTGAGCAGGGTGAAGGCAGCAGG - Intergenic
1165690377 19:37858399-37858421 TTGAACAGTTGGAAGGCTGGAGG - Intergenic
1165935510 19:39386312-39386334 GTGAACGGGAGGAAGGTGACAGG - Exonic
1166060038 19:40320430-40320452 AGGAACAGGAAGAAGGCTGGTGG - Exonic
1166279036 19:41778081-41778103 GTAAACAGGAGAATCGCTGCAGG + Intergenic
1167515816 19:49922618-49922640 GTGGACAGGACTCAGGCTGCTGG - Intronic
1167712851 19:51123100-51123122 GTGAAAAGCAGGAGGGCTTCTGG + Intergenic
1168224009 19:54981528-54981550 GAGAAAAGGAGGCAGGCTGATGG - Intronic
924962726 2:47788-47810 GAGAAGAGAAGGAAGGATGCGGG + Intergenic
924963002 2:50863-50885 AAGTACAGGAGGAAGGCTGGAGG + Intergenic
925307331 2:2858476-2858498 GTGAAGAAGAGAAAGGCTGCAGG - Intergenic
925352490 2:3211205-3211227 GTGAACAGGAGGGTCGCTGCTGG + Intronic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
927018744 2:18995911-18995933 CTGAGCAGGATGAAGTCTGCAGG + Intergenic
927266537 2:21159190-21159212 GGGAGCAGGAAGAAGGCAGCAGG + Intergenic
929366304 2:41160434-41160456 GTGAACAGGAGGAAGGTGCTTGG + Intergenic
929560099 2:42951141-42951163 CTCAGCAGGAGGAAGCCTGCAGG + Intergenic
929938823 2:46314968-46314990 GGGAGAAGGAGGCAGGCTGCTGG + Intronic
931428583 2:62192562-62192584 TTGAACAGGTGGTTGGCTGCAGG - Intergenic
931649594 2:64455237-64455259 GTGTGCATGTGGAAGGCTGCTGG + Intronic
932239199 2:70143766-70143788 CTGGACAGCAGGGAGGCTGCTGG - Intergenic
932355076 2:71061688-71061710 GAGAACTGGAGGAATACTGCTGG + Intergenic
932423341 2:71613926-71613948 GGGAAAAGGAGGAAGGAGGCAGG + Intronic
932565252 2:72902017-72902039 GTGACCAGAAGGAAGGCCACGGG + Intergenic
932780464 2:74555701-74555723 GTGAAGAGGAGGAGGGCCGAGGG + Intronic
933706729 2:85296650-85296672 ATGAACAGAAGGAACGATGCAGG - Intronic
935458219 2:103295556-103295578 GGGAACAGGTGGTAGTCTGCAGG + Intergenic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
936373842 2:111924481-111924503 GTGAAGAGTAGGAAGGATACAGG - Intronic
936996442 2:118419245-118419267 GTGAAAAGGATGAAGGATGTTGG - Intergenic
937926685 2:127173273-127173295 GAGAACATGAGGAAGCCAGCTGG - Intergenic
938531555 2:132192681-132192703 GTGAGCTGAAGGAAGGTTGCTGG - Intronic
938710921 2:133975668-133975690 CTGACCAGGTGGAAGGCTGATGG - Intergenic
939449125 2:142349602-142349624 ATGAACTGGTGGAAGACTGCAGG - Intergenic
940694326 2:156959673-156959695 GAGCACAGGAGGGAGGCTGAGGG - Intergenic
941541057 2:166784788-166784810 TTGAACAGGCTGAAGGCAGCAGG - Intergenic
943754290 2:191541920-191541942 CTGTACAGGAGGAAGCCTGGAGG - Intergenic
943932125 2:193868001-193868023 GAGCACATGAGGAAGGCTGATGG + Intergenic
946614797 2:221497857-221497879 GTGAAGGGAAGGAAGGCTGGTGG - Intronic
947606357 2:231488541-231488563 GAGGACAGGAGGTAGGATGCTGG + Intergenic
947644604 2:231729211-231729233 GTGTACATGAGGATGGCTGCAGG - Intergenic
948099089 2:235359461-235359483 GTGCCCAGGAGGAGGGCTGCTGG - Intergenic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170787937 20:19483636-19483658 GTGAACAGGAAAAAAGCTACTGG + Intronic
1171339514 20:24416286-24416308 GTGCACCTGAGGAAGGCTGAAGG - Intergenic
1172071634 20:32261630-32261652 GAGACCAAGGGGAAGGCTGCTGG - Intergenic
1172347768 20:34217478-34217500 CTGAAAAGGAGGAAGGGTCCTGG - Intronic
1172607015 20:36220821-36220843 GTGGCCAGGAGGAAGGCAGGAGG + Intronic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1172893863 20:38285792-38285814 GTGGACAGGAAGCAGGATGCTGG - Intronic
1173153194 20:40585311-40585333 CTGAGCAGGAGGTGGGCTGCTGG - Intergenic
1173348051 20:42219087-42219109 GTGTACACTAGGAAGGCGGCTGG + Intronic
1173475180 20:43353660-43353682 GTGAGCAGAAGAATGGCTGCCGG + Intergenic
1173885755 20:46457614-46457636 GTGGGCAGGAGGCCGGCTGCGGG - Intergenic
1174352899 20:49981226-49981248 AGGAACAGAAGGAAGGCTGGGGG + Intergenic
1174516419 20:51095760-51095782 CTGAACATGACGAAGGCAGCTGG - Intergenic
1175445335 20:59015915-59015937 GTGAGCAGGATCCAGGCTGCTGG - Intergenic
1176019324 20:62954476-62954498 GTTCACAGGAAGCAGGCTGCTGG + Intronic
1176117449 20:63439270-63439292 GTGACCAGGAGCAGGGCGGCTGG - Intronic
1176764905 21:13006749-13006771 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1179580315 21:42339125-42339147 GTGAGCAGGTGGAATGCTGAGGG + Intergenic
1179642485 21:42756690-42756712 GTGCAGAGCTGGAAGGCTGCAGG + Intronic
1180429480 22:15233208-15233230 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1180512091 22:16101542-16101564 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1183279010 22:36922373-36922395 GGGAGCAGGAGGAGGGCTGGCGG - Intronic
1183290708 22:37000101-37000123 GTGAATAGGTTGAGGGCTGCAGG - Intronic
1183615022 22:38938772-38938794 GTGAACAGGAGGCAGGAAACTGG + Intergenic
1184489204 22:44799503-44799525 AAGAACTGAAGGAAGGCTGCTGG + Intronic
1184847909 22:47100370-47100392 GAGCACAGGAGTAAGGCTGTGGG + Intronic
949104096 3:182534-182556 GTGAACAGGAGGAAGTTGACAGG - Intergenic
949828223 3:8185420-8185442 GTGAGCAGGAGGAGGCCTGAGGG - Intergenic
950046061 3:9949270-9949292 CTCAGCAGGAGGAAGGCTTCTGG + Exonic
950443947 3:13025435-13025457 GTGCACTTGAGGAAGGCAGCAGG + Intronic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
950664195 3:14485028-14485050 GTAAACAGCAGGAAAGCCGCCGG - Exonic
950670899 3:14524860-14524882 TTGAACAGCAGGAAGGTTGGTGG - Intronic
951794474 3:26523492-26523514 GTGAAGAGTAGGAAGGATGAGGG - Intergenic
951998276 3:28755859-28755881 GTGAACAGGATGTGGGCTGGTGG + Intergenic
952544877 3:34408153-34408175 AGGAAGAGGAGGAAGGCTGGTGG + Intergenic
953406737 3:42663495-42663517 CTGATCAGGAGGAAGGATGAGGG + Intronic
953718297 3:45334301-45334323 ATGCACTGGATGAAGGCTGCAGG + Intergenic
953867437 3:46596361-46596383 GAGAAGAGGAGGAGGCCTGCAGG - Intronic
953905412 3:46866075-46866097 GTGAACAGGAGGCAGGAAGGTGG + Intronic
954273234 3:49525524-49525546 CGGAACAGGAGGAAGGCTGGGGG + Intronic
954480824 3:50798809-50798831 GTAAACAGGAGAAATGCTTCAGG - Intronic
955164369 3:56496404-56496426 TTGAACAGGCTGAAGGCTGCCGG + Intergenic
955410451 3:58652351-58652373 ATGGACAGGTGGAAGGATGCTGG - Intronic
957354409 3:79062828-79062850 GTCAGCAGGTGGAAGGCTGGAGG + Intronic
958531799 3:95341724-95341746 TTGAACAGGCTGAAGGCAGCCGG - Intergenic
958748458 3:98165520-98165542 TTGAACAGGCTGAAGGCAGCCGG - Intergenic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
961602978 3:128075388-128075410 GGGAACAGGAGGCAGGGGGCAGG + Intronic
962804244 3:138915689-138915711 GGGAAGAGGAGGAGGGCTGGGGG + Intergenic
964404265 3:156332020-156332042 ATGAACTGAAGGAAGGCTGCAGG - Intronic
964831846 3:160892313-160892335 GAGAGCAGGAGCAAGGCTGGGGG + Intronic
967472193 3:189874867-189874889 GTGAACAGGAGGAAATTTGAGGG - Intronic
968046982 3:195630063-195630085 GTAAACAGGAACACGGCTGCAGG + Intergenic
968153174 3:196355794-196355816 GTGATCTGTAGGAAGGCAGCTGG - Exonic
968235420 3:197028106-197028128 CTGACCAGGAGCACGGCTGCTGG + Intronic
968307671 3:197659981-197660003 GTAAACAGGAACACGGCTGCAGG - Intergenic
969560422 4:7943277-7943299 GTGACCAGGGAGAAGGCAGCTGG - Intergenic
970707046 4:18816754-18816776 GTTAAAAAGAGGATGGCTGCTGG + Intergenic
972083975 4:35190389-35190411 TTGAACAGGCTGAAGGCAGCCGG + Intergenic
972578364 4:40372818-40372840 GAGAACAGGAGGAAGGTTTAGGG - Intergenic
972963750 4:44485708-44485730 GTGAACAGGTGGCAGGCAGCTGG - Intergenic
975105472 4:70564014-70564036 TTGAACAGGCTGAAGGCAGCTGG + Intergenic
975673107 4:76801711-76801733 GACAACAGGAGGAGGGCTGTTGG + Intergenic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
976097863 4:81528248-81528270 GAGTACAGGAGGAAAGCTGAGGG - Intronic
976779393 4:88741501-88741523 GGGAACATGAGCAAGGCTTCTGG + Intronic
977026283 4:91822602-91822624 TTGAACAGGCTGAAGGCAGCTGG + Intergenic
979375499 4:119941840-119941862 GGGGAAAGGAGGAAGGCTGAGGG + Intergenic
980608299 4:135122549-135122571 TTGAACAGGCTGAAGGCAGCCGG + Intergenic
980755223 4:137149609-137149631 ATGAATATGAGGAAAGCTGCAGG + Intergenic
981141967 4:141279107-141279129 TTGAACAGGCTGAAGGCAGCTGG - Intergenic
982385180 4:154793622-154793644 TTGAACCGTAGGAAGCCTGCAGG + Intronic
982771559 4:159401472-159401494 GTGAGCAGCAGGAAGCCTTCAGG - Intergenic
983676690 4:170302842-170302864 GAGAACAGGAGGTAGGGTGCTGG + Intergenic
984402517 4:179285706-179285728 TTGAACAGGCTGAAGGCAGCCGG + Intergenic
984532666 4:180935682-180935704 GTGAACTGGGGGAAGCCTGCTGG + Intergenic
985320890 4:188709635-188709657 GAGAACAGGAGGAAAGAAGCTGG + Intergenic
985744636 5:1639081-1639103 CTAAACAGGAGCACGGCTGCAGG - Intergenic
985837718 5:2282649-2282671 GTGAACAGCAGGCAGGGAGCTGG + Intergenic
986306824 5:6522472-6522494 GTGAACAGGTGGTGTGCTGCGGG - Intergenic
987002671 5:13675973-13675995 ATGAACAGGAGGCAGGTGGCAGG + Intergenic
987085042 5:14460339-14460361 GTGAACAGGAAAGAGGCTGAGGG + Intronic
989165943 5:38433676-38433698 GAGGAAAGGAGGAAGGATGCAGG - Intronic
989520616 5:42396378-42396400 ATGCACAGGAGGGAGGCTGAGGG + Intergenic
989712552 5:44417408-44417430 GTAAAAAGGAGGAAGTCTCCTGG + Intergenic
990196501 5:53322833-53322855 GTGAACAAGAGGATAGATGCTGG + Intergenic
990845123 5:60128576-60128598 GTGACCAGGTGGAAGGCAGCTGG + Intronic
991009701 5:61870268-61870290 GAGAGGAGGAGGGAGGCTGCTGG - Intergenic
992099994 5:73397828-73397850 GTGGACAGTTTGAAGGCTGCAGG - Intergenic
993537273 5:89102534-89102556 GTGGTCATGAGGAAGACTGCTGG + Intergenic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
994924393 5:106095865-106095887 GTGGACAGAAGGAAAGCAGCGGG + Intergenic
996662450 5:126020469-126020491 TGGAACAGGAGGAAGGAAGCAGG - Intergenic
996671710 5:126125055-126125077 GTGCAAAGGGGAAAGGCTGCAGG + Intergenic
996892618 5:128440418-128440440 GTGAACAGGAAGCAGGCACCTGG + Intronic
998171375 5:139873774-139873796 GTGGACAGCAGGGAGGATGCTGG + Intronic
999143364 5:149377279-149377301 GTGAAGAGGCAGAATGCTGCAGG - Intronic
1000641422 5:163707068-163707090 ATTAACAAGTGGAAGGCTGCAGG - Intergenic
1001588389 5:172849005-172849027 CAGAACAGGAGTAAGGCAGCCGG + Intronic
1002132885 5:177092234-177092256 TTGAACTTGAGGAAGGCTGGAGG + Intronic
1002160339 5:177311070-177311092 GAGAAGAGGAGGAAGCCAGCGGG + Intronic
1003088500 6:3081263-3081285 GTGATTGAGAGGAAGGCTGCAGG + Intronic
1003263233 6:4543166-4543188 GGGATGAGGAGGAAAGCTGCTGG + Intergenic
1003438942 6:6121940-6121962 GAGCACAGGAGGGAGGCTGGGGG + Intergenic
1004176091 6:13341444-13341466 GTGCACTGGAGGGATGCTGCAGG + Intergenic
1006021426 6:31120293-31120315 GGGAACAGGAGGGAGGCGGGAGG - Intronic
1006793481 6:36718130-36718152 GTGGGAAGGAGGCAGGCTGCCGG - Intronic
1007048632 6:38802881-38802903 GTGAAAAGAAAGAAGGCTGAAGG - Intronic
1007597108 6:43058079-43058101 GTGAAGATGAGGAAGTCTGGGGG - Exonic
1008882910 6:56399674-56399696 CTGAACAGGCTGAAGGCAGCTGG + Intergenic
1009518749 6:64655109-64655131 GTTAAGAGGAAGAGGGCTGCAGG - Intronic
1009939943 6:70280150-70280172 GTAAACTGGAGAAAGCCTGCTGG + Intronic
1011084900 6:83529037-83529059 GAGCCCAGGAGGAAGGCTTCAGG - Intergenic
1011854964 6:91678615-91678637 AGAAACAGGAGGAAGGCTCCTGG + Intergenic
1012484994 6:99711222-99711244 GTGAACAGTAAGAAAGCTGTAGG + Intergenic
1013893443 6:115054506-115054528 TTGAACAGGCTGAAGGCAGCTGG - Intergenic
1016843841 6:148551249-148551271 GTGAACAGGTGGTAGGCTTCAGG + Exonic
1016995923 6:149962585-149962607 GGGAACAGGAGGAAGGCAGAAGG - Intergenic
1017002660 6:150006583-150006605 GGGAACAGGAGGAAGGCAGAAGG + Intergenic
1017012264 6:150070584-150070606 GGGAACAGGAGGAAGGTAGAAGG + Intergenic
1017443138 6:154483166-154483188 GTGATCAGGAGGAAGGGTTAGGG - Intronic
1017572743 6:155764787-155764809 GTGAAGAGGAGGAAGACAGGTGG + Intergenic
1017638766 6:156469806-156469828 GAGAACAGGGGAAAGGCTTCAGG + Intergenic
1018452920 6:163925573-163925595 GTGAACAGCAGGCAAACTGCAGG + Intergenic
1018762570 6:166904565-166904587 GGGAAGAGGAGAAAGGCAGCAGG + Intronic
1018813941 6:167317176-167317198 GGTAACAAGAAGAAGGCTGCTGG - Intergenic
1018958925 6:168432338-168432360 GTGCACAGGAGCAAGCCTGCCGG - Intergenic
1019642545 7:2111960-2111982 GTGAAATGGAGTAAAGCTGCTGG - Intronic
1019660317 7:2220334-2220356 GTGGTCAGGAGGAAGCCTGGCGG - Intronic
1020449602 7:8306199-8306221 GTGAACAAGAGTGAGGATGCTGG - Intergenic
1021712673 7:23431617-23431639 CTGAACAGGAGGAAGGAAGGGGG + Intronic
1021730046 7:23587056-23587078 CTGAACAGGAGGAAGACTTTGGG - Intergenic
1021740195 7:23679218-23679240 CTGAACAGGAGGAAGACTTTGGG + Intergenic
1022071553 7:26920774-26920796 TTGAACTGGAGGAAGACTCCAGG - Intronic
1022440045 7:30425885-30425907 GTGAACAGAGGGATGGCAGCTGG - Intronic
1022494637 7:30845116-30845138 GAGGCCAGGAGGAAGGCTGAGGG + Intronic
1023387223 7:39671137-39671159 AAGAACAGGTGGAAGGCTACAGG - Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1028789127 7:94833879-94833901 GTGGACAGGTGGAAGGATGCTGG - Intergenic
1028814894 7:95132578-95132600 GTGAGCAGGAGGGAGGATTCCGG + Intronic
1030277993 7:107740379-107740401 CAGAAAAGAAGGAAGGCTGCAGG + Intergenic
1030653889 7:112145070-112145092 GTAAAAAGGAGGAAAGTTGCAGG + Intronic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1031924031 7:127621012-127621034 GCGACCAGGAGGAAGCCTGTGGG + Intergenic
1032433267 7:131880137-131880159 GGGAGCAGGAGGAGGGCTGCAGG + Intergenic
1032991955 7:137403546-137403568 GGGCTCAGGAGTAAGGCTGCAGG + Intronic
1033449351 7:141448927-141448949 GTGAACAGGAGGAGGGAAGAGGG + Intronic
1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG + Intergenic
1034487472 7:151374900-151374922 GTGCACAGGAGGCAGGGGGCTGG + Intronic
1034702760 7:153110808-153110830 GTGCTCAGGAGGGAGGCTGTTGG + Intergenic
1034900583 7:154905837-154905859 GGGATCAGGAGGGAGGGTGCAGG + Intergenic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1036706276 8:11049389-11049411 GTGAACAGGTGGATGCCTGATGG + Intronic
1036765814 8:11548759-11548781 TTCATCAAGAGGAAGGCTGCTGG + Intronic
1036792463 8:11730584-11730606 GCGAAGAGGAGGATGGCTCCTGG + Intronic
1037612107 8:20484458-20484480 GTCAGCAGGGGGAAGGCTGAAGG - Intergenic
1037977234 8:23222585-23222607 ATGCACAGGAAGAAGGCTGAGGG + Intronic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1040517120 8:48144413-48144435 GTCCACAGGAGGGAAGCTGCAGG + Intergenic
1041346277 8:56901929-56901951 GTGGACTGGAGTGAGGCTGCAGG - Intergenic
1041359468 8:57036778-57036800 TTGAACAGGCTGAAGGCAGCCGG - Intergenic
1041939375 8:63369892-63369914 GTGAAGAGTAGAAAGGGTGCTGG + Intergenic
1045031203 8:98138124-98138146 CTGAAAAGGAGGAAGGATGGAGG - Intronic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046781381 8:118219080-118219102 GTGAACAGTAGAAAGGATGTTGG - Intronic
1046960705 8:120110182-120110204 ATTAACTGGAGGAAGGATGCAGG - Intronic
1049217142 8:141413385-141413407 GGGCCCAGGAGGAAGGCAGCAGG + Intronic
1049306463 8:141906823-141906845 TGGAGCAGGAGGAAGGCTGAGGG - Intergenic
1049306474 8:141906865-141906887 TGGAGCAGGAGGAAGGCTGAGGG - Intergenic
1049420337 8:142513627-142513649 GTGGAAAGGAGGAAGGCTGCGGG + Intronic
1049596308 8:143485184-143485206 GAGAACAGGAGGGAGGCAGGCGG + Intronic
1049770178 8:144376406-144376428 GTGAGCATGAGCAAGGCTGCTGG + Intronic
1049814433 8:144591566-144591588 GGGAGCAGGATGAAGGCTCCGGG + Intronic
1050267478 9:3906088-3906110 GGGAGCAAGAGGAAGGGTGCAGG + Intronic
1050413373 9:5389213-5389235 GTGAAAAATAGTAAGGCTGCAGG + Intronic
1050641302 9:7670596-7670618 GGGAAAAGCAGGAAGGCTGGTGG - Intergenic
1051232599 9:14968007-14968029 TTGAACAGGCTGAAGGCAGCCGG + Intergenic
1052597078 9:30574827-30574849 GAGAACGTGAGGGAGGCTGCGGG + Intergenic
1053710164 9:40799177-40799199 GTGAGCTGAAGGAAGGTTGCTGG - Intergenic
1054420068 9:64919972-64919994 GTGAGCTGAAGGAAGGTTGCTGG - Intergenic
1054955297 9:70902910-70902932 GTGAACTGGAGGCAGGCCGAGGG - Intronic
1058109298 9:101014679-101014701 TTGGACAGGAGGAAAGCTCCTGG - Intergenic
1058754635 9:108073034-108073056 GTGAACAGGTGGATGGCTGATGG - Intergenic
1058817003 9:108693664-108693686 GGGAAAGGGAGGAAGGCAGCTGG + Intergenic
1059296557 9:113275871-113275893 GGGCTGAGGAGGAAGGCTGCGGG + Intronic
1059429360 9:114240710-114240732 GTGCAGAGGAGGGAGGGTGCGGG - Intronic
1059638257 9:116191493-116191515 GTGAAGAGCAGAAAGGCTGGTGG - Intronic
1060452518 9:123756536-123756558 GGGCACAGGAGGATGACTGCTGG - Intronic
1060459929 9:123841842-123841864 GTGACCAGGATGAAGGCAGTAGG + Intronic
1060732600 9:126047958-126047980 TTGAACAGGAGGGAGGCGGTTGG + Intergenic
1060937161 9:127522343-127522365 GTGCAGAGGTGGAAGGTTGCAGG - Intronic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1062164796 9:135102228-135102250 GGGAACAAGAGGGAGGCTTCAGG - Intronic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1186626273 X:11297004-11297026 GTGGCCAGGCGGGAGGCTGCTGG - Intronic
1188676775 X:32951218-32951240 GTGGCCTGAAGGAAGGCTGCTGG - Intronic
1188939127 X:36215739-36215761 TTGAACAGGCTGAAGGCAGCTGG + Intergenic
1189079885 X:37959644-37959666 TTGAACAGGCTGAAGGCAGCCGG - Intronic
1191025707 X:55910562-55910584 GTGGACAAGAGGAAGAGTGCGGG + Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194086832 X:89538488-89538510 GTAATTAGGAGGAAAGCTGCTGG + Intergenic
1194922483 X:99783315-99783337 GAGATCAAGTGGAAGGCTGCGGG - Intergenic
1195668148 X:107449122-107449144 GTGACCAGGAGGGGAGCTGCAGG + Intergenic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1199807615 X:151316074-151316096 GTGAACAGGAGGTAGGAGGTAGG - Intergenic
1200061738 X:153486816-153486838 GTGTGCTGGAGGAAGGCGGCAGG - Exonic
1200099246 X:153681430-153681452 GTGATCAGGAGGAAGACCACGGG - Intronic
1200184927 X:154175978-154176000 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200190580 X:154213116-154213138 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200196331 X:154250918-154250940 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200201986 X:154288036-154288058 AGGAGCTGGAGGAAGGCTGCAGG - Exonic