ID: 1085252534

View in Genome Browser
Species Human (GRCh38)
Location 11:75153037-75153059
Sequence TGGCTGCCCCAGCACTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085252534 Original CRISPR TGGCTGCCCCAGCACTTGCA GGG (reversed) Intronic
900319535 1:2075757-2075779 TGGGTGCCCCAGACCTTCCACGG + Intronic
901632929 1:10656722-10656744 TGGCTGCCCGAGAACCTGGAGGG + Exonic
901926738 1:12570937-12570959 GGGCTGCCCCAACACATGCAGGG - Intronic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
907394848 1:54181997-54182019 TGGCTGCTCCTTCACATGCACGG - Intronic
914694261 1:150061659-150061681 TGGCTGCCCCAAGACCTGCTTGG + Intergenic
914932737 1:151949455-151949477 TGGCTGCCCCAGAGCCTGCAGGG - Intergenic
921219455 1:212962776-212962798 TGGCAGCCCTAGCCCTTGGAAGG + Intronic
922218894 1:223542972-223542994 TGCCTGCCACAGAACATGCATGG + Intronic
922338657 1:224638197-224638219 TGGCTGACCCGGCCCTTGGATGG + Intronic
924739151 1:246784763-246784785 TGGCAGCCCCAGCACCTGGAGGG + Intergenic
1063372551 10:5531298-5531320 CAGCGGCCCCAGCACCTGCATGG - Intergenic
1063427529 10:5961693-5961715 TGGCTGCCCCTGCACTGTAAGGG + Intronic
1063469219 10:6271196-6271218 TGGCTACTTCAGCAATTGCATGG - Intergenic
1073471894 10:103727639-103727661 TGGCTCACCCAGCCCTGGCAGGG + Intronic
1074697806 10:116066396-116066418 TGGCTTCCCGAGCAGTTGCAAGG + Intronic
1075021124 10:118953143-118953165 TGTCTCCCCCAGCCCTTGGATGG - Intergenic
1075869475 10:125759358-125759380 TGGCTGCCCCACCTCTCTCATGG + Intronic
1076504659 10:130963855-130963877 TGGCTGGCTCAGCCCTCGCAGGG - Intergenic
1076556060 10:131322216-131322238 TGGCTGCCCTGGCACCTGCCTGG - Intergenic
1077106877 11:846001-846023 TGGCTGCCTCAGCCCCTGCGGGG - Intronic
1078369343 11:10732185-10732207 GTGCTGACCCTGCACTTGCATGG - Intergenic
1080986073 11:37467604-37467626 TGTCTGCAGCAGCAATTGCAAGG - Intergenic
1081713184 11:45231112-45231134 TGTCTGCCACAGCCCTGGCATGG - Intronic
1083486222 11:62984473-62984495 TGGCTGCCCCGGGACAGGCAGGG - Exonic
1084706654 11:70819818-70819840 TGGCTGTCTCAGCAGCTGCAGGG - Intronic
1085252534 11:75153037-75153059 TGGCTGCCCCAGCACTTGCAGGG - Intronic
1085869661 11:80334487-80334509 TGGGTGCCCAAGAACCTGCAAGG + Intergenic
1088713703 11:112530205-112530227 TGGCTGGCCCAGCTCTTTCAGGG - Intergenic
1089619121 11:119712487-119712509 TCTCAGCCCCAGCACGTGCAAGG + Intronic
1089668156 11:120033284-120033306 TGGCTCCTCCAGAACTTGGATGG - Intergenic
1090251781 11:125256551-125256573 TGGCAACCCCAGCACTGGCTTGG - Intronic
1091658015 12:2360022-2360044 TGGCTGCCTCAGCATCTCCAGGG + Intronic
1092238441 12:6823619-6823641 TGCCTGCCCCATCAATTGCAGGG + Exonic
1093019929 12:14193924-14193946 TGGCTTCCCCAGCAGCTGCCGGG + Intergenic
1095908992 12:47406494-47406516 AGGGTGTCCCAGCTCTTGCATGG - Intergenic
1096758592 12:53820610-53820632 TGGCTCCCCCTACACTTTCACGG - Intergenic
1100882072 12:99030220-99030242 TGCCAGCCCCTGCACTTGCTGGG - Intronic
1102039946 12:109794291-109794313 TGCCTGCCCCAGCCCCTGCCCGG + Intronic
1102051010 12:109861975-109861997 TGGCAGCCCCAGCCCTAGCGGGG - Intronic
1106418207 13:29563730-29563752 TGGGTCTCCCAGCACATGCAGGG + Intronic
1106636018 13:31529045-31529067 TGGCTCCCTCAGCCCTTGCCTGG + Intergenic
1113040963 13:106103641-106103663 GGGATGCCCCTGCCCTTGCAGGG - Intergenic
1113504740 13:110807674-110807696 TGGCTGCACCAGGACCTGGAGGG + Intergenic
1113634571 13:111910659-111910681 TGGCTGCTCCTGCTCCTGCAGGG + Intergenic
1113656169 13:112068766-112068788 TCGCTGCCGCAGCACTACCAGGG + Exonic
1114333136 14:21658189-21658211 TGGCTTTCCCAGCTTTTGCATGG - Intergenic
1114568575 14:23649846-23649868 TCACTGCCCCATCACTTCCAGGG - Intergenic
1114725120 14:24928241-24928263 TGGCTCCCCCAGCACTACCATGG + Intronic
1115775204 14:36707324-36707346 AAGCTGTCCCAGCACTTACAAGG - Intronic
1116526851 14:45916401-45916423 TGGCTGCTCCAGCTCTAGCTGGG - Intergenic
1117466675 14:56001047-56001069 TGGCTGCCTTAGCACTACCAAGG - Intergenic
1117777657 14:59199087-59199109 TGGCTGCCCCTGCCTTGGCATGG + Intronic
1117974072 14:61280831-61280853 TCGCTGCCCGAGCTCTTCCAGGG - Exonic
1118348961 14:64960085-64960107 TGTCTGCCCCAGCAGCTGCCAGG + Intronic
1119718383 14:76874642-76874664 TGCCTTCCCCAACACTTGTAAGG - Intergenic
1121711815 14:96044075-96044097 TGGCCCCCCCAGCTCTTGCAGGG - Intronic
1122337972 14:101006310-101006332 TGGCAGCCCCTGCACATGGAAGG + Intergenic
1122413213 14:101536431-101536453 TGGATGCCCCAGCACTTGCCTGG - Intergenic
1123774530 15:23565830-23565852 TTGCTGCCTCAGCACCTGCCTGG - Exonic
1128722295 15:69958968-69958990 TGCCTGCTCCAGCACTTACATGG + Intergenic
1130326232 15:82882428-82882450 TGGCAGCCCCAACACTGACATGG + Intronic
1132832019 16:1933087-1933109 AGGCTGCCACAGCACATGCTGGG + Intergenic
1133044143 16:3076773-3076795 TGGCTGCAGCTGCACTTGCAGGG + Intronic
1133136587 16:3716888-3716910 TGGCGTCCCCAGAACCTGCACGG + Intronic
1133491487 16:6274036-6274058 TGGCAACCCCAGTACTTGCAAGG + Intronic
1134043547 16:11085380-11085402 GTGCTGCCCCAGCACCTCCACGG - Intronic
1135175633 16:20226000-20226022 TGGCTGCTCCATCAGTTACAAGG + Intergenic
1137276172 16:46935354-46935376 TGGCTGCCTCAGCCATTCCATGG + Intergenic
1137845589 16:51684716-51684738 GGGCTGCCCCTGCACTTGCTTGG + Intergenic
1139476756 16:67206669-67206691 GGGCTCCCCCAGTACCTGCAGGG - Intergenic
1141849810 16:86637449-86637471 TCGCTGCCCAAGCAAATGCATGG + Intergenic
1141979484 16:87541144-87541166 TCGCTGCCCCAGGCCTGGCATGG + Intergenic
1143256007 17:5558557-5558579 TGGCTGCAGCAGCAGCTGCAGGG + Exonic
1144590357 17:16518507-16518529 TGGCTGCCTTAAGACTTGCAAGG + Intergenic
1145127454 17:20314066-20314088 TGGCTGCCCCAGGCCCTCCAGGG - Exonic
1146074531 17:29715796-29715818 TGGATGCCACAGCACATTCACGG + Intronic
1146786541 17:35726520-35726542 TGACTGCCCCAGCCCTCCCAGGG + Intronic
1146950119 17:36899909-36899931 TGGCAGCCCCAGCATCTGGAGGG - Intergenic
1148073718 17:44923254-44923276 CTGCTGCCTCTGCACTTGCAGGG + Intergenic
1148335376 17:46837505-46837527 TGGCAGCGGCAGCTCTTGCATGG - Intronic
1150462491 17:65364360-65364382 TGGCTTCTGCATCACTTGCAGGG - Intergenic
1151391690 17:73791479-73791501 TGGGTGCACCTGCACATGCAGGG - Intergenic
1151660756 17:75516783-75516805 AAGCTGCCCCAGCGCTCGCATGG + Exonic
1151829900 17:76543333-76543355 TGGCTGCCCCAGAATTAGCCTGG - Exonic
1152360451 17:79830935-79830957 TGGCTGCTCCACCACCTGCAGGG - Intergenic
1152372097 17:79895101-79895123 TGGCAGCCCCAGCACAGGGATGG - Intergenic
1152577409 17:81148996-81149018 TCGCTGCCCCATCACTGGCCTGG - Intronic
1153624496 18:7011307-7011329 CGGCTGCCGCAGCAGTTCCAAGG - Exonic
1154325993 18:13390763-13390785 TGGGTGCGCCAGCACCTGCAGGG + Intronic
1157203451 18:45678780-45678802 TTGCTGCACCAGCATTTGCATGG + Intronic
1161154892 19:2727437-2727459 AGGCTGCCCCAGCCTTTCCAGGG - Intronic
1162013051 19:7829777-7829799 TGGCGCCCCCAGCAGTTGCCAGG + Intergenic
1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG + Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163443019 19:17331051-17331073 TGGATCCCCCAGACCTTGCAGGG + Intronic
1164628844 19:29747727-29747749 TGGCCTCCCCAGCACTGACAGGG + Intergenic
1164989517 19:32674414-32674436 TGGCTGCCCCACGAGGTGCAGGG - Intronic
1167782161 19:51605826-51605848 TGTCTGGGTCAGCACTTGCAGGG - Intergenic
925304852 2:2840833-2840855 TGGCTGCTCCAGAACTGCCATGG + Intergenic
925614487 2:5732528-5732550 TGGCTGTTCCAGCCCTTGGAGGG + Intergenic
927868916 2:26611064-26611086 TGGCCACCCCAGCAAATGCAGGG - Intronic
929821538 2:45277970-45277992 TGGCTGCCCCAGCCGCTGAAAGG - Intergenic
930053245 2:47233299-47233321 TGGCTGGCCCATCACCGGCAGGG - Intergenic
932579045 2:72981697-72981719 TGGCAGCCTCAGAACTGGCATGG - Intronic
932662034 2:73663353-73663375 TGGCTGCTTTAGCAATTGCAGGG + Intergenic
935179078 2:100674268-100674290 TGGCTGGCCCAGCAGTTGCAAGG - Intergenic
936528916 2:113261490-113261512 GGGCTGCCACATGACTTGCATGG + Intronic
936797528 2:116224789-116224811 TGCCGGCCCCAGCACCTGGATGG + Intergenic
937248927 2:120511295-120511317 TGGCACCCCCAGCCCTTGCTGGG - Intergenic
937270826 2:120651110-120651132 TGCATGGGCCAGCACTTGCATGG + Intergenic
938047360 2:128133976-128133998 TGGCCTCCTCAGAACTTGCAGGG + Intronic
938189372 2:129261898-129261920 TGCCAGCCCCAGGCCTTGCAAGG - Intergenic
938678952 2:133669489-133669511 TGGGTGCTCCACCACTTGCCAGG + Intergenic
940285068 2:152026009-152026031 CGGCTGCATCAGCACCTGCAGGG - Intronic
945199695 2:207268784-207268806 TGGCTGGTCCAGTACTTGCCAGG - Intergenic
1168891067 20:1295636-1295658 TGGCTGCCTGAGCACGTTCATGG + Intronic
1169146485 20:3255863-3255885 TGGCCCAGCCAGCACTTGCAGGG - Intronic
1172145740 20:32756709-32756731 TGGCTGCCTCAGCTCTTGGCAGG - Intergenic
1172240952 20:33412251-33412273 TGTCTCCCCCAGAACTTGCCAGG - Intronic
1172467259 20:35165455-35165477 TGCCTGCCCCAGCAATTGATGGG - Intergenic
1172526514 20:35603058-35603080 GCGCTGCCCCCCCACTTGCACGG + Intergenic
1172627003 20:36353085-36353107 AGGCTGCCCCAGCATCTCCATGG - Intronic
1172767577 20:37358932-37358954 TGGCTGCCCTGGCACGCGCACGG + Intronic
1172875470 20:38161470-38161492 TGGCTGACCCTGCACTTTGAGGG - Exonic
1174165038 20:48578380-48578402 GGGCTGACCCAGCACTGGCCTGG + Intergenic
1175198042 20:57259334-57259356 TGGCAGCCCCCGCTCCTGCATGG + Intronic
1175778945 20:61670137-61670159 TGGCTGCCACATGACATGCAGGG + Intronic
1175986866 20:62768382-62768404 CTGCTGCCCCAGCCCCTGCAAGG + Intergenic
1178591613 21:33915740-33915762 TGGCTGCCCCAGCAGTGTCCGGG - Exonic
1179271331 21:39853332-39853354 TGGCTGCCCAAGCCCTGGCCCGG - Intergenic
1181593253 22:23897186-23897208 TGACTGCCCCAGGACCTGCAGGG + Intronic
1182109524 22:27713151-27713173 TGGCTGCCCCAGGGCCTGAATGG - Intergenic
1183213828 22:36466680-36466702 TGGCTGCCCCAGCAGGTGCCTGG - Intergenic
1184335424 22:43850012-43850034 TGGCTGCTCTGGCACTGGCAGGG - Intronic
949908309 3:8878000-8878022 GGGCTGCCCTAGCACTTGGCAGG + Exonic
949991361 3:9581939-9581961 TGGCTCCCCCAGCACCTTAAAGG - Intergenic
950708833 3:14800936-14800958 TGGCAGGCACAGCACTTACAAGG - Intergenic
950721880 3:14889058-14889080 TAGCTGCACCAGCTCCTGCAGGG + Intronic
951187797 3:19734607-19734629 GGGCTGCCACAGCGCCTGCAAGG - Intergenic
954365985 3:50146432-50146454 TGGCTGGCCCAGCCCTTGACAGG - Intergenic
954974423 3:54679467-54679489 TTGCTGCCCCAGCTCTCCCAGGG - Intronic
956683404 3:71802776-71802798 TGGCTGCTCCATCACCAGCACGG + Intergenic
958930246 3:100199820-100199842 TGGCTGCCCCAGCTCATTCCTGG - Intergenic
963960617 3:151305142-151305164 TGCATGTCCCAGCACTTGCAGGG + Intronic
967214484 3:187198958-187198980 TGGCTGCCCCAGACCTGGCTGGG + Intronic
971199513 4:24499398-24499420 GTGCTGACCCTGCACTTGCATGG - Intergenic
972066608 4:34953534-34953556 TGGCTGCTCTAGCACCAGCAGGG - Intergenic
972722866 4:41718169-41718191 TGGCCTCCCTAGCACTTGCCAGG + Intergenic
975725135 4:77284453-77284475 TGGCTGCCCCAGTTCTGGCTGGG - Intronic
977672952 4:99716734-99716756 TGGCTGCTTCAGCGCTGGCAGGG - Intergenic
981532089 4:145762847-145762869 TGGCTGCCTCAGCTCTTGCTTGG + Intronic
987354346 5:17049422-17049444 TGGCTCCTCCAGCATTTGCCTGG + Intergenic
988620835 5:32821814-32821836 TGGCTGCCCAGCCAATTGCAAGG - Intergenic
990471527 5:56120566-56120588 TGGCTCCCCCAGCACTGGAAAGG + Intronic
990515385 5:56526871-56526893 TGGCTGTGCCAGTAGTTGCATGG - Intronic
996234511 5:121108937-121108959 AGGCGGCCCCTGCCCTTGCAAGG - Intergenic
997781859 5:136667388-136667410 TGGCTGCCCCAGCCCATACCTGG - Intergenic
999247261 5:150161799-150161821 TGGCGGCCCCAGCCCCTGGAGGG + Intergenic
999282579 5:150375024-150375046 GGGCTGCCCCAGCACCTCCTAGG + Exonic
1002133507 5:177095101-177095123 TGCCTGTCACAGCAGTTGCAAGG - Intronic
1002526447 5:179818402-179818424 TGGCTGCCCCAGCACCCACGCGG + Intronic
1002640078 5:180626564-180626586 CGGCTGCCCCAGCAGTGACATGG - Intronic
1002762214 6:210827-210849 TTGCTGTTGCAGCACTTGCATGG + Intergenic
1004237983 6:13891859-13891881 TGGCTGCCTCAGCACTGCAATGG - Intergenic
1004839711 6:19569132-19569154 TGGAGTCCCCAGCACTTGGAAGG - Intergenic
1006311441 6:33264011-33264033 CAGCTGTCCCAGCAATTGCATGG + Exonic
1007228327 6:40330209-40330231 TGGCTGCCCCAGATCTTGACAGG - Intergenic
1007816386 6:44528296-44528318 TGGCTGCCCGAGGACTTGGCTGG + Intergenic
1009873050 6:69472574-69472596 TGGCTGCCACAGAACTAGAAAGG - Intergenic
1010374093 6:75146174-75146196 AGGCTGCCACTGCACATGCATGG + Exonic
1013432118 6:110064586-110064608 TGGGTGCCCCAGCCCCAGCAGGG + Intergenic
1015292919 6:131558982-131559004 TGGATGCCACAGCTCATGCAGGG - Intergenic
1016561125 6:145396205-145396227 TGGCAGCTCCAGCTCCTGCAGGG + Intergenic
1019118764 6:169786582-169786604 TGGCTGCCCACGCACCTGCAGGG - Intergenic
1019171199 6:170134216-170134238 TGGGAGCCCCATCACATGCAGGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029032996 7:97488437-97488459 GAGCTGCCCCAGCAGTTGCAGGG + Intergenic
1029489064 7:100860545-100860567 GGGGTGCCCCAGCACTTTGAGGG + Intronic
1033453454 7:141481873-141481895 TGTCTGCCCCAGCCCGGGCAGGG + Intergenic
1033638538 7:143237663-143237685 TGGCAGCCCCACTACTTGAAGGG + Intergenic
1034192174 7:149221310-149221332 CGGCAGCCCAGGCACTTGCAAGG - Intronic
1034387816 7:150755088-150755110 TGGCTTCCCCACAAATTGCAGGG - Intergenic
1034739000 7:153456070-153456092 TGGCTGCCTCACCACTGCCACGG + Intergenic
1035006722 7:155668732-155668754 AGTCAGCCCTAGCACTTGCAGGG + Intronic
1035038954 7:155913815-155913837 TGGGAGCCCCAACACTTGCAGGG + Intergenic
1035126751 7:156613420-156613442 TGGATGGCCCAGGACTTGGAAGG + Intergenic
1035577583 8:717704-717726 TGGCTGCCCCAGGCCCAGCAAGG - Intronic
1035970097 8:4238349-4238371 GGGCTGCCCCAGTCCTTGCTGGG - Intronic
1036824318 8:11964320-11964342 TGCCTGACCCAGCACTTGTCAGG + Intergenic
1037565252 8:20112514-20112536 TGGCTTCCACAGCACTTTCCTGG + Intergenic
1037684828 8:21129826-21129848 TGGGTGCCCCCGCTCTTCCAGGG - Intergenic
1041134155 8:54737810-54737832 TGACTGTCCCAGCTCTTTCAGGG + Intergenic
1042275281 8:66998011-66998033 TGCCTGCCCCTACACATGCATGG - Intronic
1043391283 8:79794720-79794742 TGGCTGGTCCTGTACTTGCAAGG - Intergenic
1045020824 8:98042955-98042977 TGGTTGCCCCTTCACTTGCAAGG - Intronic
1049336416 8:142089066-142089088 GGCCTGTCCCACCACTTGCATGG + Intergenic
1050601053 9:7251870-7251892 TCCCTGCCCCAACACATGCAGGG + Intergenic
1052338415 9:27342091-27342113 TGGCTGCTTCTGCACTTCCATGG + Intronic
1053895260 9:42736322-42736344 TGGCTGCCGCTGCACTTGGGAGG - Intergenic
1057201430 9:93142422-93142444 TCCCTGCCTCAGAACTTGCAGGG - Intergenic
1057441809 9:95088967-95088989 GGGCAGCCCCAGCACGGGCAGGG - Intergenic
1059138181 9:111827332-111827354 TTGCTACCCCAGCTTTTGCAGGG - Intergenic
1061762988 9:132863270-132863292 GGGCTGCGCCAGCAGTTGAAAGG - Intronic
1062096987 9:134708591-134708613 GGGCTGCCTCAGCACTGCCAGGG - Intronic
1188022034 X:25169818-25169840 TGCCTGCCCCAGCTCTGGCTGGG + Intergenic
1188862240 X:35271595-35271617 GGGCTGACCCAGCACTGGGAAGG + Intergenic
1195858073 X:109352099-109352121 TGGCTGCAACAGCTCCTGCATGG + Intergenic
1197226562 X:123961140-123961162 TCGCTACCCCAACACTTCCAAGG + Intronic
1200164977 X:154029712-154029734 TGTCTGCTCCAGCTCTGGCATGG - Intronic