ID: 1085252609

View in Genome Browser
Species Human (GRCh38)
Location 11:75153494-75153516
Sequence CAAAGTAAACAGCAGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085252609 Original CRISPR CAAAGTAAACAGCAGAGTGG AGG Intronic
900435947 1:2631397-2631419 CAAAGTCCACAGCAGGGGGGCGG - Intronic
900929113 1:5725225-5725247 CAAAGTTGGCAGCAGGGTGGAGG - Intergenic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
904634460 1:31869140-31869162 CCAAGGAGACAGCAGAGTGGGGG - Intergenic
905432253 1:37932725-37932747 CAGAGTGACTAGCAGAGTGGAGG + Intronic
907808710 1:57846546-57846568 CAGAGTAAACAGCACAGAGTAGG - Intronic
908623801 1:66016984-66017006 CAGAGAAAACAACAGAGTGTGGG + Intronic
910104858 1:83620939-83620961 CAAAGGACACAACAGAGTGAAGG + Intergenic
912047136 1:105472943-105472965 CAAAGGAAACAACAGAGGGAAGG + Intergenic
914836396 1:151210339-151210361 AAAAAAAAACAGCAGTGTGGTGG - Intronic
915595493 1:156894263-156894285 GACAGTAAGCTGCAGAGTGGAGG - Intronic
916210554 1:162356532-162356554 CTAAGGACACAGCAGAGTAGAGG + Intronic
916510649 1:165469753-165469775 GAAAGGCAAAAGCAGAGTGGAGG - Intergenic
917276322 1:173335511-173335533 CATAATAAACAGCAGAGTCAAGG + Intergenic
918431143 1:184462026-184462048 CAAATTAAACAACAGGGAGGAGG + Intronic
919893962 1:201996904-201996926 CAAAGTTAAAAACAGAGTGTGGG - Intronic
920033225 1:203049574-203049596 CAAAGAGGACAGCAGAGTTGGGG - Intronic
920365917 1:205448380-205448402 CATAGGCCACAGCAGAGTGGAGG + Intronic
921203925 1:212831943-212831965 AACAGAAAACAGCAGGGTGGGGG - Intronic
922046498 1:221950607-221950629 CCAAGTTGACACCAGAGTGGGGG - Intergenic
924609510 1:245562218-245562240 CAAATTAAACAGCAGATTAGAGG + Intronic
1063641406 10:7834157-7834179 TAAAGGAAACAGCAGAGTGAAGG - Intronic
1064025873 10:11848468-11848490 CAAGGGAAAGAACAGAGTGGGGG - Intronic
1064569102 10:16673898-16673920 GAAAATAAACAGCAGAGGAGAGG - Intronic
1067256994 10:44651126-44651148 TAAAGACAACAGCAGGGTGGAGG - Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1070109594 10:73471815-73471837 GACAGTAAACAGCAAAGTGGTGG + Intronic
1070598729 10:77851024-77851046 CAAAGCACACAGCAGGGTGTAGG + Intronic
1070680005 10:78442345-78442367 CAAAGTAAACAGAGGATTGTGGG - Intergenic
1070982902 10:80664419-80664441 CAAAGGACACATCAGAGAGGAGG - Intergenic
1071701180 10:87938640-87938662 CAAATTAGATGGCAGAGTGGTGG + Intronic
1072868425 10:99089115-99089137 CAGAGTAAACAGCATAGAGTGGG - Intronic
1076457634 10:130611685-130611707 CACAGTCAGCAGCAGTGTGGAGG - Intergenic
1076925430 10:133481441-133481463 CATGGACAACAGCAGAGTGGTGG + Intergenic
1077298804 11:1838001-1838023 CAGAGGAGACAGCAGCGTGGAGG - Intergenic
1077891880 11:6424560-6424582 AGAAGTAGACAGCAGAATGGTGG + Intergenic
1081765646 11:45608286-45608308 CAAAGGCCACAGCAGAGAGGAGG - Intergenic
1083746340 11:64739190-64739212 CAATGGCAACAGCAGAGTGGGGG - Intronic
1084939752 11:72606243-72606265 CGGAGAAAACAGCAGAGTTGTGG - Intronic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085715135 11:78865750-78865772 CAAAGAAAAAAGCAAAGTGTCGG - Intronic
1086920743 11:92583574-92583596 CAAAGAGAACAGCAGAATAGGGG - Intronic
1087011633 11:93519807-93519829 AAAAGTCAACAGCAAAGTGATGG + Intronic
1087733794 11:101809088-101809110 GAAGGTAAGCAGCAGAATGGAGG + Intronic
1087822471 11:102727909-102727931 CAAAGAGAACAGCACAGTGAAGG - Intergenic
1088217780 11:107532709-107532731 CGTAGAAAACAGCAGAGTAGAGG + Intronic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1089997459 11:122922509-122922531 CAAGGTAAACAGCAGAGGGGAGG + Intronic
1090024591 11:123156880-123156902 CAAAGTAAAAGGCAGAGTCCTGG - Intronic
1091176918 11:133567478-133567500 CAAACTTAACAGCAGATTGGAGG + Intergenic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1093378739 12:18463902-18463924 CCAAGTAAAGAGCAGAGCGGAGG - Intronic
1093787380 12:23208176-23208198 CAAAGGGAACAGCAGCATGGTGG - Intergenic
1095454267 12:42365683-42365705 CAAAGTCATCAGGAGAATGGAGG - Intronic
1096323453 12:50636597-50636619 GAAAGCAAACAGCAGACTGTGGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096783464 12:54004082-54004104 CAAACTAAACACCAGAGTAGGGG - Intronic
1097236562 12:57544292-57544314 CAAAGTATACAGGAGGGTGTAGG - Intronic
1097480311 12:60116106-60116128 GAAAGGAAACAGAAGAGAGGAGG + Intergenic
1097692251 12:62744540-62744562 AAAAGTAAACTGCAGAGTAATGG + Intronic
1098307042 12:69112794-69112816 CATGGTAAACAGCAGAGAGTGGG + Intergenic
1098881698 12:75924060-75924082 CTAAGTGAACATCAGAGAGGGGG + Intergenic
1101166638 12:102042839-102042861 CAAAGTAATCATCAAAATGGTGG - Intronic
1101676115 12:106918034-106918056 AAAAGTAAAGAGCAAAGTGGCGG - Intergenic
1102354343 12:112220373-112220395 CACAGTAAAGAGCACAGTGCTGG + Intronic
1102581357 12:113890295-113890317 AAAAGAAAACAGCAGAGCAGAGG - Intronic
1105392164 13:19990330-19990352 CAAAGTAAGAAGCAAAGAGGAGG - Intronic
1106501446 13:30332889-30332911 CACTGTTAACAGCAGAGTGCAGG + Intergenic
1106903248 13:34377360-34377382 CAAAGGAAGAAGCAGATTGGTGG + Intergenic
1107078111 13:36345857-36345879 CAAAGTAAACAACGGGGTTGGGG + Intronic
1107643858 13:42473879-42473901 GCAAGTAAACAGCAGAGTTGGGG - Intergenic
1109700484 13:66018587-66018609 AAAAGTAGACAGAAGAGTGAAGG - Intergenic
1109780380 13:67103734-67103756 CAGAATACACAGTAGAGTGGTGG + Intronic
1110724326 13:78802125-78802147 AAAAGTAGAGAGCAGAATGGTGG - Intergenic
1111654635 13:91136923-91136945 TCATGTAAAAAGCAGAGTGGAGG + Intergenic
1113199763 13:107854419-107854441 CGTAGTGAACAGCAGACTGGTGG - Intronic
1113608676 13:111627969-111627991 CAAAGTATGCAGCTGTGTGGAGG - Intronic
1113832171 13:113304585-113304607 CAAAGCAGACAGTAGATTGGAGG + Intronic
1116744591 14:48800764-48800786 AAAAGGAAACAACAGAGTGAAGG - Intergenic
1120067861 14:80065658-80065680 AAAAGTAGACAGTAGAATGGTGG + Intergenic
1120261677 14:82193099-82193121 CAAAGGAGAAAGCAGAGTGTGGG - Intergenic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1121158185 14:91707157-91707179 CATAGTAAATGACAGAGTGGTGG - Intronic
1122280702 14:100620635-100620657 CAGAGAATGCAGCAGAGTGGTGG + Intergenic
1122381249 14:101308742-101308764 CCAAGTTAGCACCAGAGTGGGGG + Intergenic
1123216213 14:106811440-106811462 TAAGGTAAACAGGAGAGTGCAGG - Intergenic
1124390582 15:29252891-29252913 CAAAGAAAACAGCATAATGAAGG + Intronic
1125401341 15:39306963-39306985 GAAAGGAAACAACAGAGTGAAGG - Intergenic
1125411938 15:39415363-39415385 CAATGTGGACAGCAGATTGGAGG + Intergenic
1125775072 15:42205305-42205327 CTAAGAAAACAGCACATTGGTGG + Intronic
1126600993 15:50427379-50427401 GAAAGTAAACTGAAGAGTGGTGG + Intronic
1127466403 15:59248700-59248722 GAAAGTAAACAGCAGAGATGGGG + Intronic
1127875041 15:63104736-63104758 CAAAGGATACAGCAAGGTGGTGG + Intergenic
1128930359 15:71698877-71698899 AAAAGCAAAGAGTAGAGTGGTGG + Intronic
1130442736 15:83971652-83971674 AAAAGCAGGCAGCAGAGTGGTGG + Intronic
1133433710 16:5761181-5761203 CAAAATAAACAGCAGCGAGAGGG - Intergenic
1133843674 16:9434482-9434504 CAAAGGAAACAACAGAGTAAAGG + Intergenic
1134201798 16:12205376-12205398 AACGGTAAACAGCAGAGTGACGG - Intronic
1135289667 16:21224440-21224462 AAAAGTAAAAAGCAGAGATGAGG - Intergenic
1135721528 16:24822255-24822277 CAGAGGAAACAGCAGAGGAGTGG + Intronic
1135762226 16:25146639-25146661 CAAAGTCAACAGCAGGGTCTGGG + Intronic
1136637208 16:31532060-31532082 GAAAGTAAGCAGCAGAGTCAGGG - Intergenic
1136669865 16:31846517-31846539 GAAAGTAAGCAGCAGAGTCAGGG + Intergenic
1137553864 16:49457928-49457950 CAAAGGGAAAAGCAGAGGGGGGG + Intergenic
1140160144 16:72481871-72481893 AAAAGTGATCAGCTGAGTGGAGG + Intergenic
1140480254 16:75258559-75258581 CAAAGCAGACAGCAGAGGGATGG + Intronic
1140908387 16:79429519-79429541 CAAAGGAAGCAGCAGAGAGAGGG + Intergenic
1142523797 17:523474-523496 CAAAGTAAATAGGAAATTGGAGG - Intronic
1142885744 17:2911231-2911253 CAAAACAAACAGCAAAGAGGTGG - Intronic
1143316814 17:6039175-6039197 CAAAGGGAACAGCATATTGGGGG - Intronic
1143446047 17:7010164-7010186 GAAAGGAAACATCAGAGTGAGGG + Intronic
1144119270 17:12134660-12134682 CAAATTAAACAAGAGAGTAGAGG + Intronic
1145362793 17:22226081-22226103 AAAGGAAAACAGCAGAGTGTTGG - Intergenic
1145930608 17:28682703-28682725 TAAAGCAAACAGAAGAGTGAAGG - Intronic
1146816806 17:35948897-35948919 CTAAATAAACTGCAGAGAGGTGG + Intergenic
1147250420 17:39149903-39149925 CAAGGTAAACAGGAGAGAGTTGG - Intronic
1148775636 17:50094379-50094401 CAAAGAAAGCATCAAAGTGGCGG + Intergenic
1150472759 17:65451128-65451150 AGAAGGAAACAGCAGAGAGGAGG + Intergenic
1150591983 17:66571154-66571176 GAAAGTAACCAACAGAATGGAGG + Intronic
1150922221 17:69495653-69495675 CAAAAAAAAAGGCAGAGTGGGGG - Intronic
1154287605 18:13074768-13074790 TAAAGTAGCCTGCAGAGTGGCGG + Intronic
1155315002 18:24562803-24562825 CAAATTCCACTGCAGAGTGGGGG + Intergenic
1155579437 18:27286194-27286216 GAAAGTTAACAGCAGGGTTGGGG - Intergenic
1155623031 18:27802944-27802966 AAAAGTAAAGAGCAGACTGATGG + Intergenic
1155718120 18:28971965-28971987 CAAAGTAAAAACAAGAGTGGTGG + Intergenic
1156441640 18:37195272-37195294 CAAAGGAAACAACAAAGTGAAGG - Intronic
1156721914 18:40080520-40080542 GAAAGTAAACACCAAAGTGTGGG + Intergenic
1156918958 18:42495592-42495614 CAATGAAAACACCAGAGTGATGG - Intergenic
1157632685 18:49114532-49114554 AGAAGTGAAAAGCAGAGTGGAGG - Intronic
1157874458 18:51259588-51259610 CAATGTGAAGAGTAGAGTGGAGG - Intergenic
1159108741 18:64032049-64032071 CAATCTAAAGAGCAGAGTGATGG - Intergenic
1159122098 18:64182932-64182954 GAAAGAAAGCAGCAGAGAGGAGG - Intergenic
1159173919 18:64810344-64810366 CTAAGTAAACAACACAGTGTTGG + Intergenic
1159834503 18:73321881-73321903 TAAAGTAGAAAGTAGAGTGGTGG - Intergenic
1159896156 18:73997717-73997739 CAAATTATACTGCAGAGTGATGG - Intergenic
1160259239 18:77275600-77275622 CCAAGAAAGCAGAAGAGTGGGGG + Exonic
1162082247 19:8225171-8225193 TAGAGAAAACAGCAGAGAGGAGG + Intronic
1162721680 19:12666583-12666605 AAAAGGAAAAAGCAGAGAGGCGG + Exonic
1164022354 19:21319873-21319895 CACTGTAAAAAGCAGTGTGGCGG + Intronic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1167624538 19:50578809-50578831 TGAAGTCAACAGCTGAGTGGAGG - Intergenic
1168673466 19:58258856-58258878 CAGAGTGACAAGCAGAGTGGAGG + Intronic
925626310 2:5845020-5845042 CTAAGTAAACACCACACTGGAGG - Intergenic
925771049 2:7283616-7283638 CAAAGTGAACACCTAAGTGGGGG - Intergenic
926969782 2:18454931-18454953 CAAAGTAAACTGAAAAGTAGAGG - Intergenic
927182004 2:20453374-20453396 GAAAGCAAACTGCAGTGTGGAGG + Intergenic
927432089 2:23035318-23035340 CAAAGAGAAAATCAGAGTGGGGG + Intergenic
927806865 2:26155794-26155816 CAAAATCAAAAGCAGAATGGTGG + Intergenic
928934179 2:36657452-36657474 GAAAGGAAAAAGCAGAATGGTGG + Intergenic
928949115 2:36798957-36798979 CACAGCAATCAGCAGAATGGGGG - Intronic
929869762 2:45748834-45748856 CCAAGTAAACAGTACAGTGCAGG + Intronic
930422826 2:51176050-51176072 CAAAGAAAACTGCAGATAGGAGG + Intergenic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
931898817 2:66764999-66765021 CAAAATAAAGAGCAGAGTCAGGG + Intergenic
932518281 2:72377666-72377688 AGAAGTAGACAGCAGAATGGTGG + Intronic
934478704 2:94614464-94614486 TAAACAAAACAGCATAGTGGTGG - Intergenic
936462935 2:112725215-112725237 CAGAGTAGACAGCACAGTGCTGG - Exonic
937024186 2:118683652-118683674 CAAAGTCAACAGGATGGTGGAGG + Intergenic
937786316 2:125903653-125903675 CAAAGTACTTAGCACAGTGGTGG + Intergenic
939318721 2:140587082-140587104 TAAACTCAACAGCAGAATGGAGG + Intronic
940787980 2:158002416-158002438 CAAAATAAAGAGCAGAGAGTTGG - Intronic
940988414 2:160072923-160072945 CAGAGTACAGAGCAGAGTGGAGG + Intergenic
941599598 2:167525556-167525578 CAAAATAAACAGCAGAGTGTTGG - Intergenic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
942855501 2:180541741-180541763 CAAAGTAATGAGTAGGGTGGGGG - Intergenic
945500808 2:210572129-210572151 CAAAGTAATCAGCAGTCAGGGGG - Intronic
946672760 2:222123880-222123902 CAAGGCAAACAGCAGAGTGCTGG + Intergenic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
947897699 2:233691033-233691055 CAACGTCCACAGCAGAGTGGAGG + Intronic
948126192 2:235566392-235566414 CAAAGTCAACGGCAGACTGAAGG + Intronic
948726374 2:239936494-239936516 TAAAGTAAACTGCAGGCTGGGGG + Intronic
1169751541 20:8999563-8999585 CAAAGTAAAAAGCAATCTGGAGG + Intergenic
1170536757 20:17348486-17348508 CAAAGTACACATGGGAGTGGAGG + Intronic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1170815790 20:19713190-19713212 CAAAGTAAACTGCAGAGACCAGG - Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172532490 20:35642563-35642585 AAAAGGAAAAAGAAGAGTGGTGG - Intronic
1173773716 20:45685420-45685442 CAAAGGAGCCAGGAGAGTGGTGG - Intronic
1174132603 20:48356549-48356571 CAAGGAAAAAAGGAGAGTGGTGG - Intergenic
1175207710 20:57324192-57324214 CATGGTAAGCAACAGAGTGGGGG + Intergenic
1176155526 20:63618186-63618208 CAAAGGAAAAAGGAGAATGGAGG + Intronic
1178699635 21:34822031-34822053 CCAAATAAGCAGCAGAGTGAGGG + Intronic
1179933063 21:44584117-44584139 CAAAGCAGAGAGTAGAGTGGGGG - Intronic
1180738598 22:18037088-18037110 CAAAATAGACAGGAGACTGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1183314564 22:37129744-37129766 CAGACTGCACAGCAGAGTGGGGG + Intronic
1183780984 22:39998660-39998682 ACAAGTAAACAGCTGAATGGCGG - Intronic
1184581163 22:45418714-45418736 CAAACTAACAAGCAGAGAGGAGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
952070683 3:29631803-29631825 CAAATTAAACAGAAAAGGGGAGG + Intronic
954225673 3:49179343-49179365 CTAAGCAGACAGCAGACTGGAGG - Intronic
954954274 3:54505457-54505479 CAAAGTAAAGAGTAGGGTAGAGG - Intronic
957155029 3:76535682-76535704 CCAAGTTGACACCAGAGTGGGGG + Intronic
958415075 3:93864377-93864399 CAATGTAAACTGAAGAGTTGAGG + Intergenic
958738017 3:98032373-98032395 GAAAATAATCAGCAGAGTGCTGG - Intronic
959042454 3:101438378-101438400 CAAAACAAACAGCAAACTGGTGG + Intronic
959541711 3:107547638-107547660 GAAAGTACACAGAAGAGTGCCGG - Intronic
961649997 3:128412550-128412572 CAGAGGGAACAGCAGAGTGAAGG + Intergenic
963173146 3:142271404-142271426 CACAGTAGACAGCAGATTTGTGG + Intergenic
963648708 3:147949006-147949028 CATAGTACACAGCAGTGTGCAGG - Intergenic
964212565 3:154244904-154244926 CAAACTGAGCAGCAAAGTGGGGG - Intronic
964790588 3:160450360-160450382 AAAAGCAAACAGCTGAGCGGCGG - Intronic
964963117 3:162453182-162453204 CAATGTAAATAGCAGAGTATTGG - Intergenic
966618928 3:181943291-181943313 TAAAGTAAACAGCAGGGGAGAGG - Intergenic
967091466 3:186138179-186138201 CACAGAAAACAGCCGAGTGAAGG + Intronic
967276576 3:187781663-187781685 GAAAGTAGACAGCAGAGTATGGG + Intergenic
967542920 3:190690464-190690486 CAAAGAACATAGGAGAGTGGAGG + Intergenic
967737892 3:192972775-192972797 CAAAGGAACCAGCAGAGTCTTGG + Intergenic
969141926 4:5082780-5082802 CAAAGTTAAGACCAGAGTAGTGG - Intronic
975000244 4:69216422-69216444 CAAATTTAACAGCAGATTGTTGG + Intergenic
975005517 4:69278782-69278804 CAAATTTAACAGCAGATTGTTGG - Intergenic
975013939 4:69387771-69387793 CAAATTTAACAGCAGATTGTTGG - Intronic
975015193 4:69407122-69407144 CAAATTTAACAGCAGATTGTTGG - Intronic
975294567 4:72718111-72718133 AAAAGTAGAGAGCAGAATGGTGG + Intergenic
976536211 4:86221195-86221217 CAAACTAAACAGAAGTGAGGAGG + Intronic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
977824718 4:101517364-101517386 CAAAGTGTACTGCAGAATGGTGG - Intronic
977882360 4:102219459-102219481 CAACATAAATTGCAGAGTGGAGG - Intergenic
978167252 4:105624028-105624050 AAAGGAAAAGAGCAGAGTGGAGG - Intronic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980461961 4:133126056-133126078 CCTAGTAAACAGAAGAGGGGAGG + Intergenic
982220549 4:153121545-153121567 GAATGAAAACAGCAGAATGGAGG + Intergenic
984167914 4:176325021-176325043 AAAAGGAAACAGCTGAGTGGTGG - Intronic
985004889 4:185524288-185524310 CCAAGGAAACGGCAGATTGGTGG + Intronic
985479179 5:96960-96982 TAAAGTAAACAGTTCAGTGGCGG + Intergenic
985986389 5:3520197-3520219 CAAAATACACAGCAGAATTGTGG + Intergenic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
986359714 5:6965273-6965295 CAAATGAGACAGGAGAGTGGAGG + Intergenic
987054981 5:14182871-14182893 CAAAGTGCACGGCAAAGTGGAGG - Intronic
987161363 5:15147191-15147213 CAAAGTAAAAAGCAGTGTAGAGG + Intergenic
987311102 5:16681892-16681914 CAAAGGGGACACCAGAGTGGAGG - Exonic
988063918 5:26210067-26210089 GAAAGTAAACAGCATGGTAGTGG + Intergenic
988233587 5:28509523-28509545 AGAAGTAAACAGCAGTGTTGGGG + Intergenic
989203726 5:38791097-38791119 CAAAGTAACCAGTAGAATGCAGG + Intergenic
990199563 5:53356146-53356168 CAAAGTTAACAGAAGACTGTGGG - Intergenic
990734509 5:58845278-58845300 CAAAGTGGACAGAAGAGTGTCGG + Intronic
991315955 5:65306967-65306989 TAAAACAAACAGCACAGTGGAGG - Intronic
994128511 5:96197327-96197349 CAGAGTAGACAGCTGAGTAGGGG - Intergenic
994144445 5:96377792-96377814 CAAGGTAAACTGCTGAGTGGGGG - Intergenic
994685462 5:102945654-102945676 AAAAGTAAAAAGGAGAGAGGGGG - Intronic
995034138 5:107514208-107514230 TAAAGAAAACAGCAGAGAGACGG + Intronic
995905993 5:117123802-117123824 CAAAGTTACCACCATAGTGGAGG - Intergenic
995975506 5:118031121-118031143 CAAAGGAAATAACAGAGTGAAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996610510 5:125373249-125373271 GAAAAGAGACAGCAGAGTGGGGG - Intergenic
998412913 5:141924659-141924681 CACAGGAACCAGCAAAGTGGAGG - Exonic
999837211 5:155387168-155387190 CAAAGTAATAAGCAGTGAGGAGG - Intergenic
1000013499 5:157256540-157256562 GAAAGTCAAAAGCAGATTGGAGG + Intergenic
1000282137 5:159791427-159791449 AAAAGAAAGCAGCAGAGTGTGGG - Intergenic
1000922456 5:167154844-167154866 TAAAGTAATTAGCAGAGTGTTGG + Intergenic
1002188658 5:177467821-177467843 CAAAGTACCCAGCAAAGAGGGGG + Intronic
1003390820 6:5711204-5711226 CAAAATAAACAATAGAGTGCTGG + Intronic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004691714 6:17997901-17997923 GACAGTGATCAGCAGAGTGGAGG + Intergenic
1005114851 6:22324600-22324622 CAAACTAATCAGCAGACTGAAGG - Intergenic
1005357078 6:24995185-24995207 CAAAGCAAACAGCAGAGCCAGGG - Intronic
1005449868 6:25962171-25962193 CAAAGCACAAAGCAGAGTGATGG + Intergenic
1005544377 6:26849924-26849946 AGAAGTAGACAGCAGAATGGTGG + Intergenic
1006241345 6:32682007-32682029 CAAAGAGAAAAGAAGAGTGGGGG + Intergenic
1007696775 6:43739044-43739066 GAAGGTAAACAGTGGAGTGGGGG - Intergenic
1008145591 6:47888054-47888076 CAGAGTAAAGAGCAGAGAGTAGG + Intronic
1008252559 6:49258303-49258325 TAAAGGCAACAGCAGATTGGGGG + Intergenic
1008721321 6:54357190-54357212 CAAAGTACACTGCAAAGTTGTGG - Intronic
1008860152 6:56139188-56139210 TTAAGTAATCAGCAGAATGGTGG + Intronic
1010101557 6:72114556-72114578 CCAAGCAAACAGCAAAGTGAAGG - Intronic
1013182434 6:107729358-107729380 CAGAGAAAACACCACAGTGGAGG - Intronic
1014736017 6:125097104-125097126 CAAAGCAAACAGCAGAGACAAGG + Intergenic
1014780026 6:125554284-125554306 CAAGGTGAACAGCAGACAGGTGG - Intergenic
1015220349 6:130797111-130797133 CAAAACAAAGAGTAGAGTGGTGG - Intergenic
1017115351 6:150971061-150971083 CAAAGTAAAGAGTAGAATAGTGG + Intronic
1017269893 6:152492889-152492911 CCAAGTTGACACCAGAGTGGGGG - Intronic
1017637097 6:156454262-156454284 CAAATCAATGAGCAGAGTGGAGG - Intergenic
1018721802 6:166578461-166578483 AAAAGTGAACAGCAAAGTGCCGG - Intronic
1020414664 7:7932189-7932211 CAATGTAAAAATCAGAGTAGTGG + Intronic
1020469192 7:8516615-8516637 CAAGGCCAACAGCAGAATGGGGG + Intronic
1020498585 7:8888295-8888317 AATAGTAAACAGAAGAGTGAAGG + Intergenic
1020979001 7:15044587-15044609 CAAAGAAAACAGCAGACTAGAGG - Intergenic
1021058562 7:16081057-16081079 GAATGTAATCAGCAAAGTGGAGG + Intergenic
1023753114 7:43390551-43390573 AAAAAAAAACAGCAGAGTTGTGG + Intronic
1023777185 7:43618900-43618922 CAAAATAGAATGCAGAGTGGTGG + Intronic
1023964495 7:44955893-44955915 CAAGATAAGCAGCAGGGTGGGGG - Intergenic
1026153653 7:67809242-67809264 CACAGAAGACAGCAGAGTGATGG + Intergenic
1027727956 7:81830916-81830938 GAAAGTAAAGAGTAGAGTGGTGG + Intergenic
1027927946 7:84491642-84491664 CCAAGTAAAAATCAGAGTAGGGG + Intronic
1028161800 7:87494126-87494148 TAAAGTAAACAGCAGTGTGGAGG + Intergenic
1028276368 7:88862839-88862861 CAAAGTGAAAAGCAGAGTGCAGG - Intronic
1030610296 7:111681424-111681446 CCACGTAAATAGCAGAGAGGTGG - Intergenic
1031472271 7:122181299-122181321 CAAAGGAAACAACACAGTGAAGG - Intergenic
1031579268 7:123451209-123451231 GAAAGTAAACATCAGGGCGGGGG - Intergenic
1031711247 7:125048585-125048607 CAAAATAAAAAGAAAAGTGGAGG + Intergenic
1031862638 7:126999024-126999046 CAAATAAAACAGCAGGGTGCTGG + Intronic
1032504148 7:132423192-132423214 CAAAGTACCCAGCACAGTGCTGG - Intronic
1033291833 7:140091676-140091698 CATAGTAGACAGCATAGTGATGG - Intronic
1033959485 7:146896119-146896141 CAAAATAAGCTTCAGAGTGGTGG + Intronic
1035140412 7:156753716-156753738 CAAAGCAGACGGCAGAGGGGAGG + Intronic
1035670645 8:1414559-1414581 CAGAGTCCACACCAGAGTGGAGG + Intergenic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1036675765 8:10831244-10831266 AAAAGTAGACAGCAGAATAGTGG + Intronic
1036788813 8:11704449-11704471 CAAAGTCAAAAGCAGAGCAGGGG - Intronic
1037495826 8:19439879-19439901 CAAAGTAAACAACAGTGAGATGG + Exonic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1039651376 8:39342602-39342624 CAAAGTAGAGAGTAGAATGGTGG + Intergenic
1040694194 8:49976675-49976697 AAGAGTTAACAGCAGAGCGGAGG + Intronic
1041332690 8:56744742-56744764 AAAAGTAAAAAGTTGAGTGGTGG + Intergenic
1041418401 8:57639843-57639865 CAAAGTAATCAGACAAGTGGAGG - Intergenic
1042132401 8:65600507-65600529 AAAAGTTGACAGTAGAGTGGAGG + Intergenic
1042682498 8:71401408-71401430 CAAAGTAAACAGCAGATATTGGG - Intergenic
1043513994 8:80979282-80979304 CAGAGTAGAAAACAGAGTGGAGG + Intronic
1045077193 8:98583475-98583497 GAAAGTTAACAGCAGGGTTGGGG + Intronic
1046560475 8:115831009-115831031 CAGAGTAAAAAGCCCAGTGGTGG - Intergenic
1048030409 8:130626261-130626283 CAGAGGAAACAGCAAAGTGAAGG - Intergenic
1048263501 8:132965439-132965461 CCAAGTCCACAGCAAAGTGGAGG + Intronic
1048522374 8:135168791-135168813 CAAAGTCAGGAGCAGAGTGGGGG + Intergenic
1049425228 8:142535214-142535236 CAAAGGAGACAGCGGAGAGGAGG + Intronic
1051488329 9:17633078-17633100 CAAAGTGAAAAGCAATGTGGAGG - Intronic
1051535416 9:18152146-18152168 CAAAGCACACAGCAGAGAGGTGG + Intergenic
1052236621 9:26218777-26218799 CAAAATAAACAGCATAGGAGGGG - Intergenic
1053679357 9:40471623-40471645 TAAACAAAACAGCATAGTGGTGG + Intergenic
1053929349 9:43099968-43099990 TAAACAAAACAGCATAGTGGTGG + Intergenic
1054284361 9:63153320-63153342 TAAACAAAACAGCATAGTGGTGG - Intergenic
1054292438 9:63307161-63307183 TAAACAAAACAGCATAGTGGTGG + Intergenic
1054390457 9:64611635-64611657 TAAACAAAACAGCATAGTGGTGG + Intergenic
1054505261 9:65904672-65904694 TAAACAAAACAGCATAGTGGTGG - Intergenic
1054829674 9:69609594-69609616 CAATCTAAATAGCAGAGAGGTGG - Intronic
1055407372 9:75988903-75988925 CACCGTAAACAGCAGAAGGGTGG - Intronic
1056226304 9:84498704-84498726 CAGAGAAAACAGCAGAGTTCAGG + Intergenic
1057226036 9:93293675-93293697 CCAAGCAGACAGCAGGGTGGGGG - Intronic
1057956379 9:99411586-99411608 TGAAGAAAACAGTAGAGTGGGGG + Intergenic
1058129916 9:101239852-101239874 CAAAGGAAACAACAGTGTGAAGG - Intronic
1058192062 9:101930212-101930234 CAAAGAAAACAGCAGTGAAGAGG + Intergenic
1058624655 9:106922390-106922412 CAAAGTAAATAGCAGAATGAAGG + Intronic
1058832123 9:108828037-108828059 CAAAGTAAACAGCCCAGAGTGGG + Intergenic
1059179685 9:112200176-112200198 CAAAATGAAAAGCAGCGTGGTGG + Intergenic
1059723091 9:116980595-116980617 CAATGCAAACAGCAGAGTCTTGG - Intronic
1059809342 9:117838490-117838512 AAAAGTAAACGGCAGAGGGCCGG + Intergenic
1061303412 9:129719145-129719167 CAGAGCAAACTGCAGAGTTGGGG + Intronic
1203490327 Un_GL000224v1:98557-98579 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1203502950 Un_KI270741v1:40438-40460 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1187439771 X:19307484-19307506 CCAGGCATACAGCAGAGTGGAGG + Intergenic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1191706595 X:64100522-64100544 CAAGATAAACAGAAGAGTGTGGG + Intergenic
1192408964 X:70915526-70915548 CAAAGTCAACAGCAGAGAGTAGG + Intergenic
1192986410 X:76404363-76404385 AAAAGTAGAAAGCAGAATGGTGG + Intergenic
1193138623 X:78001597-78001619 ATAAGTAAACAGGATAGTGGGGG - Intronic
1193234568 X:79091117-79091139 CAAAGGAAACAGCTGAGGGCAGG + Intergenic
1197498355 X:127214337-127214359 CAAAGAATACAGCAGAGTTTCGG - Intergenic
1201639175 Y:16160456-16160478 AAAAGTTAACAGCTCAGTGGAGG - Intergenic
1201663638 Y:16424871-16424893 AAAAGTTAACAGCTCAGTGGAGG + Intergenic