ID: 1085253489

View in Genome Browser
Species Human (GRCh38)
Location 11:75159222-75159244
Sequence CTGTGTGTCTGACTGTCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 361}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085253489_1085253493 -1 Left 1085253489 11:75159222-75159244 CCGACTGACAGTCAGACACACAG 0: 1
1: 1
2: 0
3: 33
4: 361
Right 1085253493 11:75159244-75159266 GACCCATTGCGGGCCAGCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1085253489_1085253499 20 Left 1085253489 11:75159222-75159244 CCGACTGACAGTCAGACACACAG 0: 1
1: 1
2: 0
3: 33
4: 361
Right 1085253499 11:75159265-75159287 GGCTGTGGGTCCCTAGCCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 282
1085253489_1085253492 -2 Left 1085253489 11:75159222-75159244 CCGACTGACAGTCAGACACACAG 0: 1
1: 1
2: 0
3: 33
4: 361
Right 1085253492 11:75159243-75159265 AGACCCATTGCGGGCCAGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 77
1085253489_1085253496 5 Left 1085253489 11:75159222-75159244 CCGACTGACAGTCAGACACACAG 0: 1
1: 1
2: 0
3: 33
4: 361
Right 1085253496 11:75159250-75159272 TTGCGGGCCAGCTCGGGCTGTGG 0: 1
1: 0
2: 0
3: 27
4: 808
1085253489_1085253497 6 Left 1085253489 11:75159222-75159244 CCGACTGACAGTCAGACACACAG 0: 1
1: 1
2: 0
3: 33
4: 361
Right 1085253497 11:75159251-75159273 TGCGGGCCAGCTCGGGCTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 240
1085253489_1085253501 30 Left 1085253489 11:75159222-75159244 CCGACTGACAGTCAGACACACAG 0: 1
1: 1
2: 0
3: 33
4: 361
Right 1085253501 11:75159275-75159297 CCCTAGCCCCTGGAGCCACCTGG 0: 1
1: 0
2: 3
3: 22
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085253489 Original CRISPR CTGTGTGTCTGACTGTCAGT CGG (reversed) Intronic
900713256 1:4128364-4128386 CTGTGTGTCTCCCTCTCTGTGGG + Intergenic
900972908 1:6001336-6001358 CTGTGTGTCTGTGTGTGTGTTGG - Intronic
902091433 1:13906884-13906906 CTGTTTGCCTGACTGTCGCTAGG - Intergenic
902373268 1:16018175-16018197 CTGCGTGTCGGGCTGTCAGCAGG - Exonic
902912861 1:19613572-19613594 TTGTGGGTCTGATTATCAGTTGG + Intronic
903659980 1:24970972-24970994 CTGTGTGTGTGAGTGTGTGTAGG + Intergenic
903683702 1:25115254-25115276 CTATGTCTCTTACTATCAGTAGG - Intergenic
904320450 1:29694756-29694778 CAGTGTCTCAGACTGTCAGCTGG - Intergenic
905149385 1:35915329-35915351 CTTTCTCTCTGACTGTCAGGTGG + Exonic
905347173 1:37319080-37319102 GTGTGTGTGTGCCTGTCTGTTGG + Intergenic
905468567 1:38174862-38174884 CTGTGTGTATGACTTTAAGATGG + Intergenic
906453028 1:45968728-45968750 CTTTGTGTCTGACTTTAATTTGG + Intronic
906768379 1:48458458-48458480 CTTTTTTGCTGACTGTCAGTGGG + Intronic
908302682 1:62777897-62777919 CTCTGTATCTAACTGTCTGTTGG + Intergenic
908709101 1:66995126-66995148 CTGCGTGGATGACTGTCAGGTGG - Intergenic
910004197 1:82375408-82375430 CTGTGTCTCTGTGTGTCTGTGGG + Intergenic
910550485 1:88468405-88468427 CTGAGTGTCTGTCTGTCACATGG - Intergenic
910771015 1:90832725-90832747 CTGTGTGTCTGATTGAAATTGGG - Intergenic
910963237 1:92784171-92784193 CTGTCTGTCTGTCTGTCTTTGGG - Intronic
913483016 1:119307347-119307369 GTGTGTGTGTGTGTGTCAGTTGG - Intergenic
913497863 1:119445125-119445147 CTGTGGCTCTGACTGACACTGGG - Intergenic
914347217 1:146810116-146810138 CTGTTTCTCTGACTCTCATTTGG + Intergenic
915300533 1:154948887-154948909 CTGTATGTCTGACTGCCTGCTGG + Intronic
915325613 1:155080090-155080112 GTGTGTGTCTGTGTGTTAGTAGG + Intronic
916339987 1:163722527-163722549 TTGTGTGTCTGCAAGTCAGTGGG + Intergenic
916474224 1:165153308-165153330 CTGTCTGCCCGCCTGTCAGTGGG + Intergenic
917537513 1:175884991-175885013 TTGGGTGTCTGGGTGTCAGTGGG - Intergenic
918950120 1:191126027-191126049 CTTTTGGTCTGACAGTCAGTGGG - Intergenic
919272423 1:195365142-195365164 TTGTGTGTGTGTCTGTGAGTGGG - Intergenic
920440035 1:205974379-205974401 CTGTGTGTGTGAGTGTGGGTGGG - Intergenic
1063859695 10:10294182-10294204 CTGTGTGTGTGTGTGTGAGTGGG + Intergenic
1064855220 10:19760080-19760102 CTGTGTGTGTGACTGGCCCTCGG + Intronic
1064855231 10:19760126-19760148 CTGTGTGTGTGACTGGCCCTCGG + Intronic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1065895012 10:30155535-30155557 CTGTGAGTGTGACTGTGAGGTGG - Intergenic
1066988380 10:42488555-42488577 CAGTGAGTCAGACTGCCAGTTGG + Intergenic
1067014082 10:42742775-42742797 TTGTGTTTCTGACTTTCTGTAGG + Intergenic
1067767863 10:49101993-49102015 GTGTGTGTATGAATGTCAATAGG + Intronic
1068530700 10:58182764-58182786 CTGTCTGTCTGTCTGTCTTTGGG + Intergenic
1068568317 10:58599940-58599962 GTGTGTGTGTGTGTGTCAGTGGG + Intronic
1068741481 10:60477494-60477516 ATGTCTGTCTGTCTGTCAGTAGG - Intronic
1069824861 10:71248794-71248816 CAGTGTGCCTGCCTGTAAGTGGG - Intronic
1071484175 10:86087226-86087248 GTGTGTGTCTGTGTGTCTGTCGG + Intronic
1071973850 10:90935430-90935452 CTTTGTGTCTGCCTGTAGGTAGG + Intergenic
1072139167 10:92574339-92574361 ACGTGTGTCTGACTGTGAGGGGG + Intergenic
1073109818 10:101055030-101055052 CGGTGTGTCTGTCTGTCGGAGGG - Intergenic
1073802259 10:107054975-107054997 CTGTGTCTCTGACTATCTGATGG - Intronic
1074135313 10:110620395-110620417 ATGTGTGTGTGTCTGTGAGTGGG - Intergenic
1074157586 10:110812203-110812225 CTGTGTGTCTGTGTGTGGGTGGG + Intronic
1075402532 10:122171396-122171418 CACTGTGACTGCCTGTCAGTAGG - Intronic
1075627071 10:123971048-123971070 GTGTGTGTGTGACTGTGTGTGGG - Intergenic
1075627099 10:123971339-123971361 TTGTGTGTGTGACTGTGTGTGGG - Intergenic
1075678361 10:124313582-124313604 GTGGGTGTGTGACTGTGAGTGGG - Intergenic
1075855221 10:125624254-125624276 CGGTGTCTCTCACTGTCATTTGG - Intronic
1076344470 10:129771074-129771096 CTGTCTGTCTGTCTGTCTGAAGG + Intergenic
1077992537 11:7424831-7424853 CTGCATGTCTGACTGTCTGCTGG + Intronic
1079920339 11:26426101-26426123 CTGTGTGTGTGTCTGTAAATGGG + Intronic
1081600364 11:44488509-44488531 CAGTGTGGCTGGCAGTCAGTGGG - Intergenic
1081661248 11:44889658-44889680 ATGTGGGTTTGACTGGCAGTTGG + Intronic
1083771555 11:64870500-64870522 CTTTGTGTCTGACTTTCTGCTGG - Intronic
1083997325 11:66278737-66278759 CTGTCTGTGTGTATGTCAGTCGG + Intronic
1085253489 11:75159222-75159244 CTGTGTGTCTGACTGTCAGTCGG - Intronic
1086938265 11:92767626-92767648 GTGTGTGTGTGACTGTCTGTAGG + Intronic
1087958532 11:104319685-104319707 CTGTGTGCCTGACTGCTTGTTGG - Intergenic
1092838212 12:12512139-12512161 CTCTGTTTCTGAGTCTCAGTTGG - Intronic
1095794843 12:46207323-46207345 CTTTGTGTCTTACTGACAGTTGG - Intronic
1095910442 12:47420713-47420735 GTGTGTGTGTGTGTGTCAGTGGG + Intergenic
1100826907 12:98483372-98483394 CTTTCTTTCTGGCTGTCAGTGGG - Intergenic
1101414342 12:104496194-104496216 CTGTGTGTGTGTGTGGCAGTGGG + Intronic
1101802701 12:108036072-108036094 CAGTGTGGCTGGCTGTCTGTGGG - Intergenic
1102539697 12:113609961-113609983 CCGTGTGTCTGTGTGTCTGTAGG + Intergenic
1102874225 12:116437195-116437217 CTATGTGTCTGACTCTGAGCTGG + Intergenic
1104382443 12:128319387-128319409 GTGTGTGTGTGTCTGTCTGTTGG + Intronic
1104905946 12:132213578-132213600 GTGTGTGTGTGACTGTGTGTAGG - Intronic
1105482887 13:20795366-20795388 CATTGTGTCTGACAATCAGTAGG - Intronic
1106585664 13:31054329-31054351 CTGTGTGCGTGACTGTGTGTAGG - Intergenic
1107047213 13:36006306-36006328 CTGTGTGTCTGTCTGCCCGCTGG - Intronic
1107394677 13:40003170-40003192 CTGTGTGTGTGTCTGTGTGTGGG - Intergenic
1109720114 13:66265189-66265211 CTCTCTGCGTGACTGTCAGTGGG + Intergenic
1110620805 13:77593304-77593326 GTGTGTGTGTGTGTGTCAGTGGG + Intronic
1111384092 13:87500842-87500864 CTCTGTGTCTGAATGTCTCTAGG - Intergenic
1111487762 13:88926702-88926724 CTGTGTGTCTGACTGAGTCTAGG + Intergenic
1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG + Intronic
1113925926 13:113941650-113941672 CTGTTTCTCTGCCTGTCAGATGG + Intergenic
1114071361 14:19110884-19110906 TTGTGTTTCTGACTTTCTGTAGG - Intergenic
1114090900 14:19289082-19289104 TTGTGTTTCTGACTTTCTGTAGG + Intergenic
1114119819 14:19658856-19658878 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
1114749817 14:25190496-25190518 CCTTGTTGCTGACTGTCAGTGGG + Intergenic
1114820150 14:26008634-26008656 CTGTGGTTCTGACTGTGACTTGG + Intergenic
1115841296 14:37473531-37473553 CTGTGTGTGTGAATGGGAGTAGG + Intronic
1116165479 14:41329607-41329629 CTGGGGGTCTGACTGTTAGAAGG - Intergenic
1116897968 14:50335579-50335601 CTGTTTGTCTGCCTGACATTCGG - Intronic
1117118086 14:52537059-52537081 GTGTGTGTGTGATTGTGAGTTGG - Intronic
1117161838 14:52997289-52997311 GTGTGTGTCTGTCTGTGTGTTGG + Intergenic
1119172526 14:72545909-72545931 CTGTGTGTGTGTGTGTCAGGTGG + Intronic
1119400982 14:74362195-74362217 CAGTGAGTCAGACTTTCAGTAGG - Intergenic
1119543579 14:75456374-75456396 CTGTCTGTCTGCCTGTTTGTCGG + Intronic
1120313139 14:82857089-82857111 CTGTGTGTGTCACTGGAAGTAGG + Intergenic
1121257626 14:92542815-92542837 CTTTGTGTCTGGCTTTCACTTGG - Intronic
1121797485 14:96747148-96747170 CTGGGTGACAGACTGTCTGTAGG + Intergenic
1122262505 14:100531352-100531374 CTGTGTGCCTGTCTGTGGGTGGG + Intergenic
1122370555 14:101226891-101226913 CTGTGGGTCTGCCTGTCCCTGGG - Intergenic
1122370629 14:101227178-101227200 CTGTGGGTCTGCCTGTCCCTGGG - Intergenic
1123094169 14:105757966-105757988 CAGTCTGTCTGCCTGGCAGTTGG + Intergenic
1123541608 15:21297653-21297675 CTGTGTTTCAGATTCTCAGTAGG + Intergenic
1124237774 15:28004478-28004500 CTGTGTGTGTGTCTGTGTGTGGG - Intronic
1124627427 15:31316378-31316400 CTGGATGTCTCACTGTCAGCAGG + Intergenic
1125471057 15:40004346-40004368 CTGTCTGTCTGTTTATCAGTAGG + Intronic
1125541533 15:40472396-40472418 CTGTGCTTCTGCCTGTCATTCGG + Exonic
1125678672 15:41516879-41516901 CTGTCTGTCTGTCGGTCGGTCGG - Intergenic
1125678673 15:41516883-41516905 ATGTCTGTCTGTCTGTCGGTCGG - Intergenic
1127795853 15:62437775-62437797 CTGTCTGTCTGTCTGCCAATTGG + Intronic
1127962057 15:63897273-63897295 GTGTGTATCTGACTGTCCGGGGG - Intergenic
1129182468 15:73885961-73885983 CTGTGTGTCTGTCTGTGCGCTGG - Intronic
1130149533 15:81300635-81300657 GTGTGTGTGTGTCTGTCTGTAGG + Intronic
1130706267 15:86236266-86236288 CTGTGTGCCTCACGGTCTGTGGG - Intronic
1130971793 15:88739516-88739538 CTGTGGGTCTAACAGGCAGTGGG + Intergenic
1130994488 15:88896314-88896336 CTATGTGCCTGACAGTGAGTTGG - Intergenic
1131015238 15:89052516-89052538 CTGTCTGTCTGTCTGTCTCTGGG - Intergenic
1134609206 16:15594339-15594361 TTGTCTGTCTGTCTGTCTGTGGG - Intronic
1134662448 16:15994293-15994315 CTCAGTGTCAGACTCTCAGTGGG + Intronic
1135324507 16:21517849-21517871 CTGAGTGTCTGACTTCCTGTTGG - Intergenic
1136030978 16:27502824-27502846 CTGTCTGTCTGTCTGTCTGCTGG - Intronic
1136172243 16:28496187-28496209 CTGTCTGTCTGACTCCCAGCAGG - Exonic
1136335990 16:29611114-29611136 CTGAGTGTCTGACTTCCTGTTGG - Intergenic
1137068519 16:35877104-35877126 CTCAGTGTCTGGCTGGCAGTGGG - Intergenic
1138054034 16:53813678-53813700 CTGTGTTTATGACTGGCAGCTGG - Intronic
1139025535 16:62813183-62813205 CTTTGTGCCTGACTTTCATTTGG - Intergenic
1140571357 16:76110044-76110066 CTGAGTTTCTGACTACCAGTAGG - Intergenic
1141336692 16:83162710-83162732 CTGTGTGTATGTGTGTCAGAGGG - Intronic
1142324273 16:89404139-89404161 CTGTGTCCATGACTGTCTGTTGG - Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1203121710 16_KI270728v1_random:1543699-1543721 CTGTGATTCAAACTGTCAGTGGG - Intergenic
1143089423 17:4440180-4440202 CTGGGTGTCAGGCTGTCTGTGGG - Intronic
1143592544 17:7894280-7894302 CTGTGTGTGATCCTGTCAGTGGG + Intronic
1143629964 17:8133391-8133413 CTGTGTCACAGAGTGTCAGTGGG + Intergenic
1144074872 17:11708342-11708364 CTGTGTGTCTGTCTGTGTCTTGG + Intronic
1144577937 17:16441309-16441331 CCCTGTGATTGACTGTCAGTTGG + Intergenic
1144759178 17:17697730-17697752 TTGTGTGTCTGTTTGTCACTGGG + Intronic
1145292956 17:21564306-21564328 CTGTGTGTCTGTGTGTCGGGAGG - Intronic
1146109923 17:30079875-30079897 CTGTAAGTCTGAGTTTCAGTGGG - Intronic
1147161199 17:38570401-38570423 GTGTGTCTCTCACTGTGAGTGGG - Intronic
1148331122 17:46814584-46814606 CTGTCTGTCTGTCTGTCTGTGGG + Intronic
1148699741 17:49580242-49580264 CTGTGTGTCTGTCTGTGGGTGGG + Exonic
1148759509 17:49992380-49992402 CTGTGTGTGAGGCTGTGAGTGGG - Intronic
1149289938 17:55208260-55208282 CTGTTTCTCTGCCTGTCACTTGG - Intergenic
1149451751 17:56755079-56755101 CTGTCTGTCTGTCTGTCCATTGG - Intergenic
1151078071 17:71297052-71297074 CTGTGTCTCTGAAAGTCAGAGGG + Intergenic
1151821092 17:76497312-76497334 GTGTGTGTGTCACTGACAGTGGG - Intronic
1152773366 17:82184672-82184694 CTCTGCTTCTCACTGTCAGTTGG - Intronic
1155779594 18:29814010-29814032 ATCTGTGTCTTACTGTCAGTGGG - Intergenic
1157189609 18:45569761-45569783 CTGTGTCTCCCACTGTCATTTGG - Intronic
1157948280 18:52005399-52005421 CTGTAGTTCTGACTGGCAGTGGG - Intergenic
1158117331 18:54010573-54010595 CTGTGTGTCTGACCAACAATTGG + Intergenic
1158205265 18:54985738-54985760 CTGTGTGTCTGACACTCTTTTGG - Intergenic
1159027529 18:63198389-63198411 ATGTGTGTCTGTGTGTCAATGGG - Intronic
1159968774 18:74623000-74623022 CTGTTAGTCTGAATGTGAGTTGG + Intronic
1160302012 18:77690444-77690466 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302014 18:77690448-77690470 CTGTCTGTCTGACTGTGGGGCGG + Intergenic
1160302020 18:77690492-77690514 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302022 18:77690496-77690518 CTGTCTGTCTGACTGTGGGGCGG + Intergenic
1160302028 18:77690540-77690562 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302042 18:77690642-77690664 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302055 18:77690742-77690764 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302062 18:77690789-77690811 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302075 18:77690887-77690909 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302089 18:77690983-77691005 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302091 18:77690987-77691009 CTGTCTGTCTGACTGTGGGGCGG + Intergenic
1160302109 18:77691125-77691147 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160302123 18:77691221-77691243 CTGTCTGTCTGTCTGACTGTGGG + Intergenic
1160528866 18:79552235-79552257 CTGTGTGTCTGTGTCTCTGTGGG + Intergenic
1160990065 19:1856847-1856869 CTGGGTGCCGGACAGTCAGTTGG + Intronic
1162157135 19:8685948-8685970 CTGTCTGTCTGTCTGTCTGGAGG + Intergenic
1162784912 19:13028636-13028658 CTGTGTGTCTGTCTGTGTTTAGG + Intronic
1162787421 19:13044402-13044424 GTGGGTGTCTGAGTGTCAGGAGG + Intronic
1163500974 19:17675953-17675975 CTGTCTGTCTGTCTGTCTCTTGG - Intronic
1163687027 19:18717537-18717559 CTGTGTTTCTGCCTGTGTGTGGG + Intronic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1164621211 19:29697036-29697058 CTGGGTGTCCGAGTGTCACTTGG - Intergenic
1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG + Intronic
1165507596 19:36244131-36244153 CTGTGTGTCTGAGTGGCTGGGGG + Intronic
1166105216 19:40594846-40594868 CTGTGTGTCTCACAGTGAGCGGG + Intronic
1166898755 19:46041637-46041659 CTGTGTGTCTCACTGTGTGATGG + Intronic
1167359315 19:49021585-49021607 GTGTGTGTCTGTCTGTGTGTTGG + Intergenic
1167565592 19:50254531-50254553 GTGTGTGCCTGACTCTCAGAGGG + Intronic
925096875 2:1212199-1212221 CTGTGCTTCTGACAGTGAGTGGG + Intronic
926301279 2:11604912-11604934 CTGCTTGTAGGACTGTCAGTTGG + Intronic
926732187 2:16044140-16044162 GTGTGTGTCTGAATGTTAATAGG - Intergenic
927906534 2:26862680-26862702 CTGTGTGCCTGACTGTGACAAGG + Intronic
930371127 2:50502461-50502483 TTGTGTGTCTGAGTGTGTGTGGG - Intronic
932019272 2:68065996-68066018 GTGTGTCTCTGAATGTGAGTTGG - Intronic
932520433 2:72405956-72405978 CTGTGTCTCTGCCTGTGAGATGG - Intronic
933336954 2:80970418-80970440 CTCAGTGTCACACTGTCAGTGGG - Intergenic
933992863 2:87646281-87646303 CTGTGTGTCCCAGTGCCAGTAGG - Intergenic
934039771 2:88118169-88118191 CCGGGTGACTCACTGTCAGTGGG - Intergenic
934458570 2:94196655-94196677 CTGTGATTCGAACTGTCAGTGGG - Intergenic
935106417 2:100048873-100048895 TTGTGAGTGTGACTGTCAGTAGG - Intronic
935930500 2:108119212-108119234 GTGTGTGTGTGACTGTGTGTGGG + Intergenic
936300993 2:111304598-111304620 CTGTGTGTCCCAGTGCCAGTAGG + Intergenic
937192228 2:120113774-120113796 TTTTGTGTCTGACTTTCACTTGG + Intronic
937223892 2:120357196-120357218 GTGTGTGTGTGTGTGTCAGTGGG + Intergenic
937824102 2:126345705-126345727 CTTTCTGTCTGCCTGTCAGGTGG + Intergenic
938170023 2:129067555-129067577 ATGTGTGTGTGTCTGTGAGTGGG + Intergenic
938538617 2:132266922-132266944 CTGCCTGTCTGTCTGTCTGTCGG - Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
941106021 2:161354230-161354252 CTGTGTGTATGTGTGTCAGATGG + Intronic
942048255 2:172113909-172113931 CTGTGTGTGTGACAGCCTGTGGG + Intergenic
942800996 2:179875372-179875394 CAGTATTTCTTACTGTCAGTTGG + Intergenic
946160468 2:217832629-217832651 CTGTAGGTCTGACTGTCTTTTGG - Intronic
946217636 2:218197880-218197902 CTGTGTGTCTGCGTGTCAGGTGG - Intergenic
947061086 2:226166683-226166705 CAGTGTACCTGACAGTCAGTTGG - Intergenic
948589376 2:239039445-239039467 CTGTGAGCCTGAAGGTCAGTGGG - Intergenic
948885112 2:240878446-240878468 CTGTGTCTCTGAGTGGCAGTGGG + Intronic
1168978621 20:1986593-1986615 CTGTGTGTCTTATTGTAAGGGGG + Intronic
1169427068 20:5504664-5504686 CTGTGCGTTTGACAGGCAGTTGG - Intergenic
1169959973 20:11148832-11148854 CTGTGTGTCTGTGTGTCTGTGGG + Intergenic
1171486298 20:25488952-25488974 ATGCGTGTCCGTCTGTCAGTTGG - Intronic
1171486358 20:25489321-25489343 CTTTGTGTCTGCCTTTCAGCTGG - Exonic
1171768810 20:29305534-29305556 CTGTCTGTCTGTCTGTCTGTCGG - Intergenic
1171811945 20:29751855-29751877 CTGCCTGTCTGTCTGTCGGTAGG - Intergenic
1171907733 20:30913793-30913815 CTGCCTGTCTGTCTGTCTGTAGG + Intergenic
1172459081 20:35101765-35101787 GTGTGTGTCTGCCTGTGTGTCGG - Intergenic
1172783920 20:37453531-37453553 CTGGGTCTCTGCCTGTCTGTGGG + Intergenic
1172802843 20:37590300-37590322 CTGTGTGTATGGCTGTGAATGGG + Intergenic
1172887953 20:38244494-38244516 CTGTGTCCCTGACAGGCAGTGGG + Intronic
1173062630 20:39676609-39676631 GTGTGTGTGTGTGTGTCAGTTGG - Intergenic
1173208216 20:41011436-41011458 CAGTCTGTCTGTCTGTCTGTGGG - Intergenic
1173620568 20:44432696-44432718 CTGTGGGTGTGAATGTCATTAGG + Exonic
1173847025 20:46194584-46194606 CTGTGTGCCTGACACACAGTAGG - Intronic
1174118552 20:48245003-48245025 GTGTCTGTCTGTCTGTCTGTCGG + Intergenic
1174661139 20:52214282-52214304 GAGGGTGTCTTACTGTCAGTGGG + Intergenic
1175211196 20:57357035-57357057 CAGTGTGTCTGCCTGTCACCAGG - Intronic
1175619652 20:60432822-60432844 CTTTGAGTCTGACAGTCATTTGG + Intergenic
1175779345 20:61672431-61672453 CTGTGTGTCTGACTTTGCGGAGG - Intronic
1176111987 20:63415142-63415164 CTGTTTTTCTGTCTGTCTGTCGG - Intronic
1177714922 21:24827043-24827065 CTGTATGTGTGACTGTGTGTGGG + Intergenic
1178342975 21:31801654-31801676 CTGTGTGTCTGGCTATCTGCTGG + Intergenic
1180462926 22:15583229-15583251 GTGTGTGTCTGTGTGTAAGTGGG + Intergenic
1180489807 22:15833220-15833242 TTGTGTTTCTGACTTTCTGTAGG - Intergenic
1181357633 22:22309779-22309801 CTGTGATTCGAACTGTCAGTGGG + Intergenic
1183119591 22:35720082-35720104 GTGTGTGTCTGCCTGTTAGGTGG + Intronic
1183375008 22:37458236-37458258 CTGTGTCTCTGAATCTCAGGGGG + Intergenic
1183654765 22:39178001-39178023 CTGTCTGTCTGAGGGACAGTAGG + Intergenic
1184130382 22:42513686-42513708 GTGTGTGTGTGTCTGTCAGGTGG - Intronic
1184140560 22:42575514-42575536 GTGTGTGTGTGTCTGTCAGGTGG - Intergenic
1184183053 22:42844070-42844092 ATGTGTGTGTGTCTGGCAGTGGG + Intronic
1185192963 22:49450398-49450420 AGTTGTGTCTGACTGGCAGTTGG - Intronic
949949289 3:9215985-9216007 CTGTGTGTCTATCTGTCTGAGGG - Intronic
950673595 3:14541250-14541272 CTTGGTGTCTGACCCTCAGTTGG - Intronic
951038321 3:17959822-17959844 CTCTGTCTCTGTCTGTCTGTCGG + Intronic
956228590 3:66987491-66987513 CTGTGTGTTTGACTGCAACTTGG - Intergenic
956508534 3:69969296-69969318 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
958141798 3:89571428-89571450 CTGTGAGTCTGACTGTGTCTGGG + Intergenic
961570900 3:127798114-127798136 CTGTGTCTTTGACTGTTAGTAGG - Intronic
963599393 3:147364739-147364761 TTGTGTGCCTGACTGGGAGTAGG + Intergenic
964054013 3:152429814-152429836 CTGTCTGTCTGTCTGTCTTTTGG + Intronic
964176802 3:153833320-153833342 CTGTCTGTCTGTCTGTCTTTGGG - Intergenic
965116677 3:164499399-164499421 CTGTGTGTCTGTGTGTATGTTGG + Intergenic
965486994 3:169290556-169290578 CTGTGTATGTGGCTGTCACTGGG - Intronic
965651439 3:170938143-170938165 CTGAGGGTCTGACTGTTAGAAGG - Intergenic
966125755 3:176574483-176574505 CTGTGTGCCTGGCTGTCGGGTGG - Intergenic
969824428 4:9746373-9746395 CTGTGTGTCTAAGTGTGTGTTGG + Intergenic
970223360 4:13832773-13832795 ATGTGTGACTGACTTTCAGGAGG - Intergenic
970840462 4:20462606-20462628 CAGTGTGTCAGAGAGTCAGTGGG - Intronic
972924874 4:43991395-43991417 CTGTCTGTGTGACTGTCAGCAGG + Intergenic
972999013 4:44922133-44922155 TTGAGTGTCAGACTGTCAATCGG + Intergenic
973066167 4:45795892-45795914 CTGTCTGTGTGGCTGTCAGCAGG + Intergenic
974409444 4:61520686-61520708 CTGTCTGTCTGTCTGTCTGAGGG + Intronic
976795442 4:88926978-88927000 GTGTGTGTGTGTCTGTCGGTGGG - Intronic
976934876 4:90617955-90617977 TTGTGTGTGTGGCTGTGAGTGGG + Intronic
977175153 4:93810701-93810723 CTGAGTGTCTGTCTCTCACTGGG - Intergenic
977482004 4:97590616-97590638 CTGTGTGTCTGTGTGTATGTAGG - Intronic
978229784 4:106385074-106385096 CAGTGTGTCTGACTGTGCGGTGG - Intergenic
978880471 4:113696165-113696187 CTGTGTGTCTGTCTGTCAAGTGG - Intronic
981247529 4:142557444-142557466 CTGTGTGTCTGTGTGTGAGTGGG - Intronic
983475297 4:168205478-168205500 TGGTGTGTTTGAATGTCAGTAGG - Intergenic
985010701 4:185579652-185579674 CTGTGTGTCTGTGTGTGTGTAGG + Intergenic
985097512 4:186427798-186427820 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097523 4:186427871-186427893 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097530 4:186427920-186427942 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097544 4:186428017-186428039 CTGTCTGTGTGACTGTCAGGAGG - Intronic
985097554 4:186428091-186428113 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097575 4:186428236-186428258 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097579 4:186428260-186428282 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097587 4:186428308-186428330 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985097591 4:186428332-186428354 CTGTCTGTGTGACCGTCAGGAGG - Intronic
985608299 5:871100-871122 GTGTGTCTCTGACAGTCAGCAGG - Intronic
989210123 5:38850868-38850890 CAGTGTGTCTGTCTGTCAGCCGG + Intronic
992225032 5:74611934-74611956 CTGTGTGTCTGTGTGTGAGCGGG + Intergenic
992556425 5:77907678-77907700 CAGTGTGTCTGAATTTCACTTGG - Intergenic
992833631 5:80619285-80619307 CTGTGTGTCTGTGTGTCACATGG + Intergenic
993480385 5:88417296-88417318 CTGTGTGTCTGACACACAGTAGG + Intergenic
993664423 5:90678173-90678195 CTGTGTTTTTGCCTGTCAATAGG - Intronic
993903485 5:93599542-93599564 CTGTCTGTGTGCTTGTCAGTCGG + Intergenic
995178233 5:109203969-109203991 CTGTGTGTTTGAATGCCTGTTGG - Intergenic
995400075 5:111731063-111731085 ATGTGTGTCTGTCTGTGTGTGGG - Intronic
995681963 5:114730281-114730303 CAGTGTGTCTGCCTGTCCCTGGG - Intergenic
996548882 5:124709253-124709275 CTTCGTGTCTGACTGCCAGAAGG + Intronic
996569133 5:124913183-124913205 CTGTGTGTCATTCTGCCAGTCGG + Intergenic
997024024 5:130036781-130036803 CTGTGTGTGTGGCTGTGGGTGGG + Intronic
997097757 5:130932581-130932603 CTGTGTATCTGTCTGTCCCTGGG - Intergenic
997657610 5:135566990-135567012 CTGTTGGTCTGACTGCCAGACGG - Intergenic
998042068 5:138957077-138957099 TTGTGTGTGTGTCTGTCAGTAGG - Intronic
999414410 5:151382088-151382110 CCATGTGGATGACTGTCAGTAGG - Intergenic
1000592547 5:163176061-163176083 GTGTGTGTGTGAGTGACAGTGGG - Intergenic
1001783774 5:174393911-174393933 CTGTCTCTCTGTCTGTCTGTTGG - Intergenic
1003792003 6:9556416-9556438 CATTGTGTCTGAATGTCCGTGGG - Intergenic
1003833990 6:10047800-10047822 GTGTGTGTGTGACTGACTGTGGG - Intronic
1003844480 6:10158836-10158858 CTGTGGGTCTGACAGGCACTGGG - Intronic
1003998026 6:11563547-11563569 ATTTGTGACTGACTGTAAGTCGG + Intronic
1005347402 6:24904114-24904136 CTGTGTGTATGAGTTTCAGATGG + Intronic
1006370533 6:33641262-33641284 CTGTCTGTCTGACTGTCAGTCGG - Intronic
1006454213 6:34122744-34122766 CTGTCTGTCTGTCTGTCTCTGGG + Intronic
1007088950 6:39169928-39169950 CTGTGTGTCTGTCTGCCCATGGG - Intergenic
1009576878 6:65475730-65475752 CTGTCTGTCTGTCTGTCAGGGGG - Intronic
1009818687 6:68771548-68771570 ATGTGTGTATGACTCACAGTAGG - Intronic
1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG + Intergenic
1010999347 6:82570339-82570361 CTGCCTGTCTGTCTGTGAGTGGG + Intergenic
1011827691 6:91330026-91330048 CTGTCTGTCTGTCTGTCAGGTGG + Intergenic
1012087897 6:94853247-94853269 ATGTGTGTCTGCCTGTGAGATGG - Intergenic
1012221044 6:96649755-96649777 CTGTCTGTCTGTCTGTCTATTGG - Intergenic
1014630116 6:123778624-123778646 GTGTGTGTCTGTCTGTCTGTCGG + Intergenic
1014630117 6:123778658-123778680 GTCTGTGTCTGTCTGTCTGTCGG + Intergenic
1014951830 6:127565018-127565040 CTGGTTGTCTGGCTGTCACTTGG + Intronic
1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG + Intergenic
1015290575 6:131534107-131534129 GTGTGTGTCTGTGTGTCTGTTGG + Intergenic
1015594650 6:134854850-134854872 TTGAGTGTCAGAGTGTCAGTGGG - Intergenic
1017222427 6:151981826-151981848 CAGTTTGTCTGTCTGTCATTAGG + Intronic
1017402871 6:154084408-154084430 GTGTGTGTCTGTCTGTCTGTTGG - Intronic
1017418002 6:154242463-154242485 CTCTGTGTCTGACAGTTAATAGG - Intronic
1018424210 6:163665315-163665337 CTGTGTGTATGAGTGTCTCTGGG - Intergenic
1018980636 6:168599097-168599119 GTGTGTGTGTGACTGTGTGTCGG - Intronic
1018980687 6:168599497-168599519 GTGTGTGTGTGAGTGTCAGTGGG - Intronic
1018986370 6:168640306-168640328 CTGTCAGCCTGACTGTCAGCTGG + Intronic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019142185 6:169955974-169955996 CTGTGTGTTTGGCTTTCACTTGG + Intergenic
1022478892 7:30730100-30730122 CTGTCTGTCTGTCTGTCCATGGG + Intronic
1024391822 7:48822518-48822540 GTGTGTGTGTGTCTGTCTGTAGG + Intergenic
1024721613 7:52143067-52143089 CTGAGTGGCTGACTGGCTGTGGG - Intergenic
1026610442 7:71854762-71854784 GTGAGTGTCTGTCAGTCAGTGGG + Intronic
1027750816 7:82143025-82143047 GTGTGTGTATGGCTGTCTGTGGG + Intronic
1029197657 7:98817291-98817313 GTGTGTGTCTGTCTGTCTGTGGG + Intergenic
1029289878 7:99494274-99494296 CCGTGTTCCTCACTGTCAGTGGG + Exonic
1029423884 7:100485055-100485077 GTCTGTGTCTGTCTGTCTGTGGG + Intronic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034313753 7:150111555-150111577 CAGTGTGTGTCACTGTGAGTGGG - Intergenic
1038708277 8:29917108-29917130 CTGTGATTTTGACTGTGAGTTGG - Intergenic
1039552367 8:38452178-38452200 CTGTGTGTCTGTGTGTCTGTCGG - Intronic
1041130124 8:54689830-54689852 CTGTATAACTGACTGTCATTAGG - Intergenic
1041820319 8:62024617-62024639 CTGTGTGTTAGACAGTCACTTGG - Intergenic
1042052337 8:64724914-64724936 CTGTCTTTCTGTCTGTCAGCTGG + Intronic
1047244504 8:123128356-123128378 CTGTCTGGATGAATGTCAGTAGG - Exonic
1047308278 8:123670895-123670917 CTGTGTGTATTTCTGTCAGTAGG - Intergenic
1049609342 8:143546501-143546523 CTGTGTGTCTGTGTGTCACAGGG + Intergenic
1049880324 8:145057588-145057610 CTGTGTCTCTGAGTCTGAGTAGG - Intergenic
1053084012 9:35202737-35202759 ATGTGTCTCTGCCTGTCAGATGG + Intronic
1053564757 9:39237241-39237263 CTGTGTGTATAACTGTCTCTGGG + Intronic
1053689070 9:40572471-40572493 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054132394 9:61381793-61381815 CTGTGTGTATAACTGTCTCTGGG - Intergenic
1054274964 9:63058595-63058617 CTGTGATTCGAACTGTCAGTGGG + Intergenic
1054300314 9:63373403-63373425 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054399862 9:64706334-64706356 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054433450 9:65190595-65190617 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054496935 9:65831074-65831096 CTGTGATTCGAACTGTCAGTGGG + Intergenic
1056707363 9:88963099-88963121 CTGTGTGTCTGTCTTTAGGTCGG - Intergenic
1056775059 9:89505819-89505841 CTCTGTCTATGACTGTCAGGTGG + Intergenic
1058201212 9:102043263-102043285 CTGTCTGTCTGTCTGTCTGTTGG + Intergenic
1058562411 9:106243968-106243990 CTGTGTGCCTGACTGTATATTGG + Intergenic
1059710510 9:116863600-116863622 GTGTGTGTCTGACCGGCAGGTGG - Exonic
1060892434 9:127197378-127197400 CTGTGTGTCTGTGTGTCTGTCGG + Intronic
1062369793 9:136231998-136232020 TTATGTGTCTGAGGGTCAGTGGG - Intronic
1185615089 X:1416276-1416298 CTGTGTGCGTGCCTGTCTGTTGG - Intronic
1186245946 X:7617074-7617096 CTCTGTGCCTGTCTGTCAGTAGG + Intergenic
1187129079 X:16483646-16483668 AGTTGTATCTGACTGTCAGTGGG - Intergenic
1187270151 X:17772931-17772953 GTGTGTGTATGAGTGTCAGGAGG - Intergenic
1187686534 X:21821068-21821090 CTTTGTTTCTGACTGACACTAGG + Intergenic
1188376154 X:29430401-29430423 CTGTGTTTCTGACTGTGTATAGG + Intronic
1190917963 X:54824259-54824281 CTGTGTGTCTGTCTGTCTCCTGG + Intergenic
1192437802 X:71153614-71153636 CTGTCTGTCTGTCTGTCCGTTGG + Intronic
1196919592 X:120571977-120571999 CTGTGTGACTGATGTTCAGTAGG + Intronic
1197095485 X:122589598-122589620 TTGTGTGACTGACTGGGAGTTGG - Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198047682 X:132918717-132918739 CTGTTTGGCTGGCTGTCAGTAGG - Intronic
1199563818 X:149193154-149193176 ATGTGTCTCTGCATGTCAGTGGG - Intergenic
1199695051 X:150337931-150337953 GTGTGTGTATGCCTGTCTGTTGG + Intergenic
1199966143 X:152822816-152822838 CAGGATGTCTGACTGTCATTGGG - Intergenic
1200706483 Y:6447209-6447231 CTGTGTGTCTGTGTGGCATTGGG - Intergenic
1200961713 Y:9001938-9001960 GTGTGTGTGTGCCTGTAAGTGGG + Intergenic
1201027629 Y:9717499-9717521 CTGTGTGTCTGTGTGGCATTGGG + Intergenic
1201075744 Y:10186506-10186528 CTGTCTGTCTGTCTGTCTGTTGG + Intergenic
1201498599 Y:14617412-14617434 CTGTGTGCCTGAGTATCACTAGG + Intronic
1201988091 Y:19991753-19991775 CTGTGTCTCTGAAGGTGAGTTGG + Intergenic
1202128220 Y:21587156-21587178 GTGTGTGTGTGCCTGTAAGTGGG + Intergenic
1202180074 Y:22132328-22132350 CTGTGTGTCTGTGTGGCATTGGG - Intergenic
1202211286 Y:22454071-22454093 CTGTGTGTCTGTGTGGCATTGGG + Intergenic