ID: 1085263131

View in Genome Browser
Species Human (GRCh38)
Location 11:75219728-75219750
Sequence GTTTAGGGGGTGAACTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085263124_1085263131 11 Left 1085263124 11:75219694-75219716 CCTGAGGATAGGGGCAAGACATG No data
Right 1085263131 11:75219728-75219750 GTTTAGGGGGTGAACTGACCAGG No data
1085263123_1085263131 12 Left 1085263123 11:75219693-75219715 CCCTGAGGATAGGGGCAAGACAT No data
Right 1085263131 11:75219728-75219750 GTTTAGGGGGTGAACTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085263131 Original CRISPR GTTTAGGGGGTGAACTGACC AGG Intergenic
No off target data available for this crispr