ID: 1085265604

View in Genome Browser
Species Human (GRCh38)
Location 11:75236294-75236316
Sequence GGGACGGGAGACTTCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085265604_1085265616 16 Left 1085265604 11:75236294-75236316 CCCACAGTGAAGTCTCCCGTCCC No data
Right 1085265616 11:75236333-75236355 AAGCAAGAGGAGAGAAGCTGGGG No data
1085265604_1085265612 3 Left 1085265604 11:75236294-75236316 CCCACAGTGAAGTCTCCCGTCCC No data
Right 1085265612 11:75236320-75236342 TGGCAAGGAAGCCAAGCAAGAGG No data
1085265604_1085265615 15 Left 1085265604 11:75236294-75236316 CCCACAGTGAAGTCTCCCGTCCC No data
Right 1085265615 11:75236332-75236354 CAAGCAAGAGGAGAGAAGCTGGG No data
1085265604_1085265614 14 Left 1085265604 11:75236294-75236316 CCCACAGTGAAGTCTCCCGTCCC No data
Right 1085265614 11:75236331-75236353 CCAAGCAAGAGGAGAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085265604 Original CRISPR GGGACGGGAGACTTCACTGT GGG (reversed) Intergenic
No off target data available for this crispr