ID: 1085265649

View in Genome Browser
Species Human (GRCh38)
Location 11:75236462-75236484
Sequence CTGCTGGGACAGAGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085265634_1085265649 29 Left 1085265634 11:75236410-75236432 CCATTTGCCTTGGAGGAGGGGGG No data
Right 1085265649 11:75236462-75236484 CTGCTGGGACAGAGGACAAAGGG No data
1085265636_1085265649 22 Left 1085265636 11:75236417-75236439 CCTTGGAGGAGGGGGGAACAGAG No data
Right 1085265649 11:75236462-75236484 CTGCTGGGACAGAGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085265649 Original CRISPR CTGCTGGGACAGAGGACAAA GGG Intergenic
No off target data available for this crispr