ID: 1085266082

View in Genome Browser
Species Human (GRCh38)
Location 11:75238851-75238873
Sequence AGGAGTTCCAGCCTTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085266068_1085266082 12 Left 1085266068 11:75238816-75238838 CCAATCTGAGGCCAGCCACCACC No data
Right 1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG No data
1085266074_1085266082 1 Left 1085266074 11:75238827-75238849 CCAGCCACCACCGGGGCCTGGGG No data
Right 1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG No data
1085266079_1085266082 -9 Left 1085266079 11:75238837-75238859 CCGGGGCCTGGGGAAGGAGTTCC No data
Right 1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG No data
1085266076_1085266082 -3 Left 1085266076 11:75238831-75238853 CCACCACCGGGGCCTGGGGAAGG No data
Right 1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG No data
1085266078_1085266082 -6 Left 1085266078 11:75238834-75238856 CCACCGGGGCCTGGGGAAGGAGT No data
Right 1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085266082 Original CRISPR AGGAGTTCCAGCCTTGGTAG TGG Intergenic
No off target data available for this crispr