ID: 1085266293

View in Genome Browser
Species Human (GRCh38)
Location 11:75240034-75240056
Sequence GTCTTAAGAGGTTTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085266284_1085266293 -6 Left 1085266284 11:75240017-75240039 CCAACGGAACCCCAGGAGTCTTA No data
Right 1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG No data
1085266281_1085266293 18 Left 1085266281 11:75239993-75240015 CCTGGAGGGACTAGTTGACAGTG No data
Right 1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085266293 Original CRISPR GTCTTAAGAGGTTTGGGGGC AGG Intergenic
No off target data available for this crispr