ID: 1085266591

View in Genome Browser
Species Human (GRCh38)
Location 11:75241163-75241185
Sequence GCTGCTGCTGCGCTGCGCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 154}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085266583_1085266591 9 Left 1085266583 11:75241131-75241153 CCCTTCCAGTGCTACTGCTTCGG 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266579_1085266591 23 Left 1085266579 11:75241117-75241139 CCGCGGCACCCTGCCCCTTCCAG 0: 1
1: 0
2: 6
3: 77
4: 800
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266587_1085266591 4 Left 1085266587 11:75241136-75241158 CCAGTGCTACTGCTTCGGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266578_1085266591 24 Left 1085266578 11:75241116-75241138 CCCGCGGCACCCTGCCCCTTCCA 0: 1
1: 0
2: 1
3: 48
4: 363
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266581_1085266591 14 Left 1085266581 11:75241126-75241148 CCTGCCCCTTCCAGTGCTACTGC 0: 1
1: 0
2: 3
3: 33
4: 295
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266577_1085266591 28 Left 1085266577 11:75241112-75241134 CCAGCCCGCGGCACCCTGCCCCT 0: 1
1: 0
2: 3
3: 53
4: 590
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266580_1085266591 15 Left 1085266580 11:75241125-75241147 CCCTGCCCCTTCCAGTGCTACTG 0: 1
1: 0
2: 0
3: 27
4: 276
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266582_1085266591 10 Left 1085266582 11:75241130-75241152 CCCCTTCCAGTGCTACTGCTTCG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154
1085266585_1085266591 8 Left 1085266585 11:75241132-75241154 CCTTCCAGTGCTACTGCTTCGGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085266591 Original CRISPR GCTGCTGCTGCGCTGCGCGT CGG Exonic
900203203 1:1420405-1420427 GCTGCTGCAGCGCGGGGCCTCGG - Exonic
900623975 1:3599815-3599837 GCTGGGGCTGTTCTGCGCGTGGG + Intronic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902841629 1:19077864-19077886 GCTGCTCCTCCGCTGGGCCTGGG - Intronic
904236713 1:29121672-29121694 GCTGCGGCTGCGCTCGCCGTCGG - Exonic
905004693 1:34700191-34700213 CCTGCTGCTGCTCTGCACTTTGG + Intergenic
910927248 1:92410078-92410100 GCTGCTGCTGCTTTGGGGGTGGG - Intergenic
916155386 1:161840389-161840411 GCTGCTGCTGCTCTGTGGCTTGG - Intronic
920458487 1:206118204-206118226 GCTGCTGCTGCGCTGTCAGAAGG - Intergenic
921358782 1:214311507-214311529 ACAGCTGCTTCGCTGCGAGTGGG + Intronic
922161326 1:223080926-223080948 GCTGCTGCAGGGCTGCAGGTAGG + Intergenic
922804118 1:228376973-228376995 GCTCCTGCTGCTCTGAGTGTTGG + Intronic
923016445 1:230130271-230130293 GCTGCGGCAGCGCTGTGGGTAGG - Intronic
1062932689 10:1363321-1363343 GCGGCTGCTGTGCCGCGCGCTGG - Exonic
1066480914 10:35794839-35794861 GCCGCTGCAGGGCTGCGCCTGGG + Intergenic
1066749206 10:38635638-38635660 GCTGCTTCGGAGCTGCGAGTGGG - Intergenic
1066967452 10:42282154-42282176 GCTGCTTCGGAGCTGCGAGTGGG + Intergenic
1070311390 10:75276255-75276277 GCGGCTGCTGCGCGGCGCAGGGG + Intergenic
1072071677 10:91924021-91924043 GCCTCAGCTGCGCGGCGCGTAGG + Exonic
1072654326 10:97319729-97319751 GCTGCTGCTGCCGCCCGCGTTGG + Exonic
1076726724 10:132417328-132417350 GCTGCTGCTGCCTCGCGCGCTGG + Exonic
1078062226 11:8055628-8055650 GCTGCTGATGGGCTGGGGGTGGG + Intronic
1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG + Intergenic
1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG + Exonic
1091053470 11:132396323-132396345 TCTGCTGCTGCTCAGCGCATGGG - Intergenic
1092131996 12:6119248-6119270 GCTGCTGCTGCTCTTAGGGTGGG - Intronic
1096094493 12:48925365-48925387 GCTGCTGCTGCTCAGTGCGGCGG - Exonic
1101344481 12:103873414-103873436 GCTCCTGCTTCCCTGCCCGTAGG - Intergenic
1105502837 13:20988195-20988217 CCTGCTGCTGCGCAGCAAGTCGG - Exonic
1105571996 13:21611562-21611584 GTCGCTGCGGTGCTGCGCGTGGG + Intergenic
1107058522 13:36131258-36131280 GCTGCTGGAGCGCGGCGCCTCGG + Exonic
1113540124 13:111100732-111100754 GCTGCTGCTGCGCTGAGTTCAGG - Intergenic
1113928245 13:113952840-113952862 CCTGCTGCTGCCCGGCCCGTTGG - Intergenic
1117315353 14:54566827-54566849 GCTGGTGCGGCGCGGCGCGGGGG + Intergenic
1119234180 14:73005771-73005793 GCTGCTGCTGCTGTGCACCTGGG - Intronic
1121033861 14:90682809-90682831 GCAGCTGCTGCGCTGAGAATGGG + Intronic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122732183 14:103808909-103808931 GGTGCTGCTGCGCTCAGCCTGGG - Intronic
1124433878 15:29631907-29631929 GCTGCTGCTGGGCGGGGCATAGG + Intergenic
1124945576 15:34262546-34262568 GCTGCTGCTTCCCGTCGCGTGGG - Intronic
1127648478 15:60982656-60982678 GCTGCTGCTGAGCTGGGGATTGG + Intronic
1128140919 15:65300536-65300558 GCTGCTACTGCTCCGTGCGTGGG - Intronic
1129871582 15:78944948-78944970 GCTGCCGCTGCTCTGCGCCGGGG - Exonic
1130526981 15:84715953-84715975 GCTGCTGCTGCGGGGCCCGGCGG - Intronic
1132466164 16:78250-78272 GCGGCTGCTGGGCTCCGCGCCGG + Exonic
1132560570 16:591412-591434 GGTGCTGCTGGGCTGCTCTTGGG + Intronic
1133172828 16:3992456-3992478 GGCGCTGCTGCACTGGGCGTGGG + Intronic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1140186160 16:72774220-72774242 GCTGCTGCTGCCCTGTGTTTCGG + Intergenic
1142221687 16:88857946-88857968 GCTGCTGCTAAGCTGCTCATGGG + Intronic
1142409847 16:89910454-89910476 GCTGCTGCTGCTCTGCCCCCTGG + Intronic
1142586889 17:979523-979545 GCTGGCGCTGAGCTGCGCGCAGG + Exonic
1142864955 17:2785118-2785140 GCTGCTCCTGAGCAGAGCGTTGG + Intronic
1143583921 17:7842124-7842146 GCGGCTGCGGCGCTGCGCGGAGG + Intronic
1143656067 17:8294482-8294504 CCAGCTGCTGCGCTGCGGGCAGG + Exonic
1145885746 17:28381395-28381417 GCTGCTGCGCCACTGCGCGCTGG + Exonic
1146214908 17:30971262-30971284 GCGGCTGCTGCGCGGCGCCCTGG - Exonic
1147171232 17:38620222-38620244 CCTGATGCTGCCCTGAGCGTCGG + Intergenic
1152273172 17:79337357-79337379 GATGCAGCTGTGCTGTGCGTGGG - Intronic
1158695163 18:59697255-59697277 GCTGCTGCTGCTCCTGGCGTTGG - Exonic
1160901772 19:1432426-1432448 GCTCCTGCTGGGCTGGGTGTGGG + Intronic
1160909924 19:1469666-1469688 GCTGCTGCGGCGCGCGGCGTCGG - Exonic
1161152636 19:2717719-2717741 GCTGGTGCTGCGCTTCGTGAAGG - Exonic
1161735657 19:5990769-5990791 GCTGCTGCCCCTCTGCGCCTGGG - Intergenic
1163051013 19:14683514-14683536 GCTGTGGCTGCCCTGGGCGTGGG + Intronic
1165923895 19:39315255-39315277 TCTGCTGCTGCTCTGGGCGGGGG - Exonic
926205541 2:10832539-10832561 GCTGCTGCGGGGATGCGTGTGGG + Intronic
927708610 2:25311956-25311978 GCTGCTGCTGCTCTGGGCTGCGG - Intronic
930698190 2:54432584-54432606 GCTTCTGCAGCCCTGCGCATTGG + Intergenic
931653397 2:64488808-64488830 GCTGCTGCTGCGATGAGTCTGGG - Intergenic
932852347 2:75199608-75199630 GCAGCTGCCGCGCTGCGCACCGG - Exonic
933666711 2:84970824-84970846 GCCGCCGCCGCGCCGCGCGTAGG - Intergenic
935672044 2:105564278-105564300 GCTGCTGCTGCGCTGGGCTTCGG - Intergenic
936038307 2:109129583-109129605 GCCGCTGCTGCGCAGAGCGAGGG + Exonic
936192759 2:110344845-110344867 GCTGAGGCTGTGCTGAGCGTAGG - Intergenic
937232550 2:120406580-120406602 GCTGTGGCTGTGCTGCACGTGGG - Intergenic
939791762 2:146587238-146587260 GCTGCTGCAGGGCCGCGGGTGGG - Intergenic
940851287 2:158690233-158690255 GCTGGTGCTGCACTGCACGGAGG + Intergenic
948213853 2:236214607-236214629 GCTGCTGCGGCGCGGGGCGGAGG - Exonic
948213854 2:236214610-236214632 GCTGCTGCTGCGGCGCGGGGCGG - Exonic
1169562108 20:6812713-6812735 GGTGCTGCTGTGCTGCGGGGTGG + Intergenic
1172118508 20:32584854-32584876 GCTGCTGCTGCGCGGGGGCTGGG - Intronic
1172446092 20:34994233-34994255 GCCGCTGCTGCGCTCGGCGCAGG + Exonic
1174565479 20:51461596-51461618 GCTGCTGCTGTGCTGCAGGTGGG - Intronic
1176382082 21:6118592-6118614 GCTGGTGCTGCGCTGCCAGAAGG - Intronic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1179741390 21:43419647-43419669 GCTGGTGCTGCGCTGCCAGAAGG + Intronic
1181010685 22:20038730-20038752 GCTGCTTCTGCTCTGCCTGTGGG + Intronic
1181986127 22:26800898-26800920 GCTGCTGCTGCTCTGTGGCTGGG + Intergenic
1183423755 22:37726422-37726444 CCCGCTGCTGCACTGCGCCTGGG - Exonic
1184851538 22:47124175-47124197 CCTGCTGCTGCGGTGGGGGTGGG + Intronic
950093453 3:10313804-10313826 GCTGCTGCAGTGCAGCGTGTTGG - Intronic
950429921 3:12944822-12944844 GCTGCTGCTGAGCTGCTGGGAGG + Intronic
951110815 3:18801859-18801881 GCTGCTGCTGCACTATGCTTCGG - Intergenic
954121750 3:48503929-48503951 GCTGGTGCTGCCCGGCTCGTTGG + Intronic
960696295 3:120399972-120399994 GCTGCTACTGCTCTGAGCTTTGG - Intronic
966230147 3:177642603-177642625 GCTGCTGCTGTGCTGGGTGCTGG + Intergenic
966372886 3:179266820-179266842 GCTGCAGCTGCGCTGGGGGCTGG - Intronic
967205943 3:187121459-187121481 GCTGCTCCTGAGCTGCCTGTGGG - Intronic
968764098 4:2459135-2459157 GCTGCTGCAGCGCAGGGCGCAGG + Exonic
968934804 4:3604437-3604459 GGAGCTGCTGCTCTGCGGGTGGG + Intergenic
968976338 4:3824131-3824153 GCCGCTGCTTCGCTGCGCCTTGG - Intergenic
969491489 4:7501652-7501674 GCTGTTGCTGCCCTTTGCGTTGG + Intronic
969669386 4:8581354-8581376 CCTGCTGCTGGGCTGTGCCTGGG + Exonic
972484267 4:39527342-39527364 GCTGCGGCGGCGCGGCCCGTAGG - Exonic
972960563 4:44447974-44447996 GCTGCTGCTGCGCGGGGCGGCGG - Exonic
974539792 4:63219269-63219291 GCTGCTGCTGTGCTGCTGGCTGG + Intergenic
980536212 4:134127104-134127126 GCTGCTGCTGCTGTGTGGGTGGG - Intergenic
986181147 5:5393916-5393938 GCTGCTGCTGAGCTGCTGCTGGG + Intergenic
987706985 5:21470594-21470616 GCTGCTGCTGAGCTGCTGCTGGG - Intergenic
990061745 5:51658719-51658741 GCTGCTGCTGCCCTTCCCCTGGG - Intergenic
991270023 5:64768614-64768636 GGTGCTGCTGCGCTGGGGGAAGG - Exonic
992690701 5:79237361-79237383 GCTGCTGGTGCACGGCGCGCAGG - Exonic
995650438 5:114362480-114362502 GCTGCTGCTGCTCGTCGCGCCGG + Exonic
1001246029 5:170106236-170106258 GCCGCTGCTGCCCAGCGTGTCGG + Exonic
1002487813 5:179551261-179551283 GCCGCTGGTCCGCTGCGCGCAGG - Intronic
1003334401 6:5156835-5156857 GCAGCTGCAGAGCTGCGCCTGGG - Intronic
1008556610 6:52678806-52678828 GCTGCTACTGCCCTGCCAGTGGG + Intronic
1008921126 6:56844347-56844369 TCTGCTGCTGGGCTCCGCGGCGG + Intronic
1009021240 6:57949905-57949927 GCTGCTGCTGAGCTGCTGCTGGG + Intergenic
1016422831 6:143902565-143902587 GCTGCTGCTGCTCTGCAGGGAGG + Intronic
1018009407 6:159655761-159655783 GCTGCTGCTGCTGTGGGGGTTGG - Intergenic
1019195756 6:170281750-170281772 GCTGCTCCTCCGCTTCCCGTCGG - Intergenic
1019282491 7:207521-207543 GCTGCTCCTGAGCTGCGCCCAGG + Intronic
1019359410 7:596938-596960 GCTGCGGCCGAGCTGCGCCTGGG + Intronic
1019937814 7:4267831-4267853 GCTGCTGCTGGACTGTGCTTAGG + Exonic
1023995708 7:45157870-45157892 GCTGCTGCTGCTCTGCGGTAAGG + Exonic
1024965354 7:55019032-55019054 GCTGCGGCCGCGCTGCGCCGGGG - Intronic
1026797652 7:73376748-73376770 GCTGCTTCTGCGCTGGAGGTAGG + Intergenic
1026822172 7:73557242-73557264 GCTGCTGCCGCGCGCCGCCTGGG - Intronic
1032011662 7:128351515-128351537 GCTGCTGCAGCTGTGCGCGCTGG - Exonic
1032440696 7:131940931-131940953 GCTGCTCCTGCTCTGGGCATGGG + Intergenic
1033220537 7:139524056-139524078 GCTGCTGCGGCGATCCGGGTCGG + Exonic
1033477163 7:141702108-141702130 GCCGCTGCTGCGCTGGGCCGAGG - Exonic
1035646181 8:1222792-1222814 GCTGTTGCTGTGCTGCAAGTGGG + Intergenic
1037946126 8:22990744-22990766 GCTGCTGCTGTACTGCCCATTGG - Intronic
1039204875 8:35141104-35141126 GATGCTTCTGAGCTGCGAGTTGG - Intergenic
1040039038 8:42897448-42897470 GCTGGGGCTGCGCTGCGCTCTGG + Intronic
1042175260 8:66032283-66032305 CCTGCTGCTGCCCTGAGTGTTGG - Intronic
1045112527 8:98948337-98948359 GCGGCGGCAGCGCAGCGCGTGGG + Exonic
1045779823 8:105849796-105849818 GCTGCTGCTGCTATGGGGGTTGG - Intergenic
1048833418 8:138497223-138497245 GCAGCCGCTGCGCACCGCGTGGG + Intergenic
1049337830 8:142095945-142095967 GCTGCTGCTGCGGAGAGGGTGGG + Intergenic
1049638955 8:143705683-143705705 GCGGCTGCGGCTCTGCGGGTTGG - Intronic
1053624923 9:39859731-39859753 GCTGCTGCTGGGGTGGGGGTGGG + Intergenic
1053715614 9:40884819-40884841 GCTGCAGCTGCAGTGCCCGTGGG + Intergenic
1053879947 9:42583497-42583519 GCTGCTGCTGGGGTGGGGGTGGG - Intergenic
1053892716 9:42710814-42710836 GCTGCTGCTGGGGTGGGGGTGGG + Intergenic
1054218974 9:62390967-62390989 GCTGCTGCTGGGGTGGGGGTGGG - Intergenic
1054231743 9:62518202-62518224 GCTGCTGCTGGGGTGGGGGTGGG + Intergenic
1054455369 9:65427541-65427563 GGAGCTGCTGCTCTGCGGGTGGG - Intergenic
1056565555 9:87769849-87769871 ACTGCTGCAGGGCTGGGCGTGGG - Intergenic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1059354842 9:113690599-113690621 GCTGCTGCTGTGCCGCGCAGTGG + Intergenic
1062617237 9:137403410-137403432 GCTGCTGCTGGGCTGGGGGTGGG - Intronic
1188943429 X:36266680-36266702 GCTGAGGCTGCACTGCGTGTAGG + Intronic
1192180888 X:68914848-68914870 GCTGCTGAGGAGCTGCGAGTGGG + Intergenic
1198750560 X:139933054-139933076 GTTGCTGCTGCGCAGCGGGGCGG + Intronic
1199573848 X:149293743-149293765 GCTGCTTCTGCTCTGCTGGTAGG + Intergenic
1200240489 X:154490603-154490625 GCTGCAGCTAAGCTGCGCGGTGG - Exonic