ID: 1085267016

View in Genome Browser
Species Human (GRCh38)
Location 11:75243024-75243046
Sequence GTGCCAGCATTGGGTATGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085267016_1085267026 10 Left 1085267016 11:75243024-75243046 CCCCCCATACCCAATGCTGGCAC 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1085267026 11:75243057-75243079 CCCCTGCCATTCACTAGTCAAGG 0: 1
1: 0
2: 1
3: 12
4: 133
1085267016_1085267030 20 Left 1085267016 11:75243024-75243046 CCCCCCATACCCAATGCTGGCAC 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1085267030 11:75243067-75243089 TCACTAGTCAAGGTCCAGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085267016 Original CRISPR GTGCCAGCATTGGGTATGGG GGG (reversed) Exonic
900396710 1:2456084-2456106 GGGGCAGCATTGGCTGTGGGTGG + Intronic
900517952 1:3092044-3092066 GAGCCAGCCGTGGGTAAGGGTGG + Intronic
900906809 1:5565061-5565083 GGGCATGCATGGGGTATGGGGGG - Intergenic
905684139 1:39896741-39896763 GTCGCAGCATTGGGAGTGGGAGG + Exonic
907493458 1:54825889-54825911 GTGCCAGCAGTGGTGATGGCAGG + Intronic
909260374 1:73481170-73481192 GTGCCAGAAGTGGGTCTGAGCGG + Intergenic
911675501 1:100654209-100654231 GTGCCAGTATTGGGTATAAAAGG + Intergenic
912712522 1:111960214-111960236 ATCCCAACATTGGGTATGGAGGG - Intronic
917267927 1:173241716-173241738 GAGCCAGCAGAGGCTATGGGAGG + Intergenic
917520243 1:175742434-175742456 ATGCCATCTTTGGCTATGGGTGG - Intronic
919890562 1:201970883-201970905 ATCCCAGCATGGGGTGTGGGAGG - Intergenic
921105998 1:211979181-211979203 GTGCCAACAGTGGATATTGGAGG - Intronic
922112008 1:222568592-222568614 GTGCCAACACTTGGTATTGGAGG - Intronic
922744308 1:228035699-228035721 GTGCCAGCGTTGGGTTGGGGCGG + Intronic
1063112638 10:3049961-3049983 GTCCCTGCATTGGTGATGGGTGG + Intergenic
1063323588 10:5075141-5075163 GTGGCAACATGGGTTATGGGAGG - Intronic
1064394794 10:14973279-14973301 ATGCCAGGAATGGGTATAGGTGG - Intronic
1067158160 10:43800000-43800022 TTGCACGCATTGGGGATGGGAGG + Intergenic
1070559105 10:77552508-77552530 GTGCCTTCACTGGGTATGTGTGG - Intronic
1073121272 10:101123722-101123744 GTGCCAGAAGTGGGTGTGGGTGG - Intronic
1075080326 10:119379163-119379185 GTGCCAGCATCTGGTCTGAGTGG + Intronic
1075690795 10:124392915-124392937 GTGCCAGCATTTGGAATGGCTGG - Intergenic
1077270685 11:1678208-1678230 GTGCCAGCCTGGGCCATGGGTGG + Intergenic
1077489536 11:2854229-2854251 GTGTCAGCATTGGCCAGGGGAGG - Intergenic
1077673500 11:4178852-4178874 GTGGCTGCATTGGGCTTGGGAGG + Intergenic
1080403911 11:31961583-31961605 GGGGCGGCAGTGGGTATGGGAGG + Intronic
1082163207 11:48907211-48907233 GTGGGAGCACTGGCTATGGGTGG - Intergenic
1083612997 11:64013283-64013305 GTGCCAGCATGGGGCAGGGGAGG + Intronic
1084780963 11:71407904-71407926 GGCCCAGCTCTGGGTATGGGGGG - Intergenic
1085267016 11:75243024-75243046 GTGCCAGCATTGGGTATGGGGGG - Exonic
1085833847 11:79931372-79931394 GTGGCAGCATTGGGTGGTGGGGG - Intergenic
1086045318 11:82525123-82525145 GTACCAGGATTGGGGATGGGTGG - Intergenic
1087837464 11:102889167-102889189 GTGCCAGATGTGGATATGGGTGG - Intergenic
1088314890 11:108497996-108498018 TTGCCCGCTTTGAGTATGGGCGG + Intronic
1089418405 11:118312981-118313003 GTCCCAGGATTGAGTGTGGGAGG - Intronic
1090153691 11:124413665-124413687 GTGGAAGCATTGAGTATTGGTGG - Intergenic
1090202683 11:124867495-124867517 GTTCCAAAATTGGGAATGGGAGG + Intronic
1090461056 11:126891970-126891992 CTGCCAGCATTGGGAATGGTTGG + Intronic
1093124628 12:15313591-15313613 GTGCCACCATGGGTTAGGGGAGG + Intronic
1094355889 12:29577064-29577086 GTGCCAACATTGGGCATTGCTGG - Intronic
1099480525 12:83160213-83160235 GTGACAGGGTTGGGGATGGGTGG + Intergenic
1099969774 12:89488904-89488926 GAGCCAGCTCTGGGTATGGTTGG - Intronic
1101682317 12:106981187-106981209 GAGCCAGGATTGGGTGTGGGTGG - Intronic
1102982824 12:117255978-117256000 GTGTCACCATTGGGGAGGGGAGG + Exonic
1103310189 12:120000100-120000122 GTGCCACCAATGGGGAAGGGAGG + Intronic
1104962952 12:132496873-132496895 GGTCCAGCATCGGGTAGGGGTGG + Intronic
1105711360 13:23012362-23012384 ATGAGAGTATTGGGTATGGGTGG - Intergenic
1107806124 13:44155615-44155637 GTTCCAGGATGTGGTATGGGAGG + Intronic
1108641013 13:52382338-52382360 GTGCCAGCAATGGTGATGGAGGG - Intronic
1109891133 13:68616738-68616760 GGGCCTCCATTGGCTATGGGAGG - Intergenic
1111611201 13:90609830-90609852 GTGCCAGCACAGGGTGTGGTAGG - Intergenic
1112599739 13:100843228-100843250 GGGCCCGCATTGAGCATGGGAGG + Intergenic
1122690483 14:103529844-103529866 ATCCCAGCAGTGGGCATGGGCGG - Intronic
1122821917 14:104351443-104351465 GGGGCAGGAGTGGGTATGGGGGG - Intergenic
1128477421 15:68009159-68009181 GGGCCAGCAATGGGAATGGAAGG + Intergenic
1130002796 15:80061447-80061469 GTTCCAGTTTTGGGTTTGGGGGG - Intronic
1130414511 15:83679794-83679816 CTGCCACCACTGGGTAAGGGTGG + Intronic
1130679708 15:85985749-85985771 GTCCCAGAATTGGGTGTGGAGGG + Intergenic
1132736484 16:1388500-1388522 GGGTCAGCATGGGGTCTGGGGGG - Intronic
1133103650 16:3493807-3493829 GTGCCAGGACTGGGTACAGGAGG - Exonic
1134562006 16:15219016-15219038 GTGCCAAGATTGGGTATGGCGGG - Intergenic
1134922544 16:18130642-18130664 GTGCCAAGATTGGGTATGGCGGG - Intergenic
1135404261 16:22186856-22186878 GTGGCAGCAGTGGGGATGGTGGG - Intronic
1138409520 16:56827603-56827625 GTGCCAGCATTAGCTATGTAGGG + Intronic
1141431244 16:83971257-83971279 GTGTCAACATTGGGCCTGGGAGG + Intronic
1144341014 17:14310324-14310346 GTGCCTGCTCTGGGTAGGGGCGG - Intronic
1148028577 17:44604969-44604991 GGGCCAGCATTGGGCCAGGGTGG - Intergenic
1150814647 17:68383530-68383552 GTGGAAGCTTGGGGTATGGGTGG - Intronic
1151219253 17:72600041-72600063 TTGGCAGGATTGGGTATGAGAGG - Intergenic
1152338159 17:79709670-79709692 GTGCCAGCATTAGGGAGGGGAGG - Intergenic
1152338174 17:79709714-79709736 GTGCCAGCATCAGGGAGGGGAGG - Intergenic
1152338201 17:79709801-79709823 GTGCCAGCATCAGGGAGGGGAGG - Intergenic
1152338242 17:79709932-79709954 GTGCCAGCATCAGGGAGGGGAGG - Intergenic
1152338257 17:79709976-79709998 GTGCCAGCATCAGGGAGGGGAGG - Intergenic
1152338286 17:79710064-79710086 GTGCCAGCATCAGGGAGGGGAGG - Intergenic
1152338329 17:79710195-79710217 GTGCCAGCATCAGGGAGGGGAGG - Intergenic
1154134823 18:11767117-11767139 GTGCAAGCATGGCATATGGGAGG - Intronic
1156392179 18:36660677-36660699 CTTCCAGCATGGGGCATGGGTGG + Intronic
1156861717 18:41844337-41844359 GGGCTAGCAGTGGGCATGGGTGG - Intergenic
1161865525 19:6829572-6829594 GGGCCAGCGAGGGGTATGGGTGG + Intronic
1163564407 19:18041673-18041695 GTCCCAGCAGTGGGGAGGGGAGG + Intergenic
1164573728 19:29392844-29392866 GTGGCAGCCTTGAGTCTGGGTGG + Intergenic
1164608790 19:29618431-29618453 GGGCCAGCATTGGGGCTGGCTGG - Intergenic
1165441247 19:35829279-35829301 GTGTCAGCATTGGGCATTTGGGG + Intronic
1166774370 19:45303358-45303380 GGGTCAGCATTGGGGAGGGGGGG - Exonic
1167284773 19:48592848-48592870 GTGTGAGCAGAGGGTATGGGGGG - Intronic
925325073 2:3012437-3012459 GTGGCAGCAATGGGTGGGGGAGG - Intergenic
929950247 2:46404493-46404515 GTGACAGCAGTGGGGATAGGAGG + Intergenic
932564498 2:72896986-72897008 GTGCCAGCCTGTGGGATGGGTGG - Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
935331945 2:101983528-101983550 GTGCCAGCATGGGGTTCTGGTGG - Intergenic
936659611 2:114528152-114528174 GTGCTTGCAGTGTGTATGGGAGG - Intronic
938902076 2:135806989-135807011 GGGGCAGCATGGGGTCTGGGAGG - Intronic
940270314 2:151882969-151882991 CTGCCAACACTGGGCATGGGAGG + Intronic
942805263 2:179923538-179923560 TTGCCAACATTTGGTATGGTTGG + Intergenic
947187890 2:227471600-227471622 TTGCCAGCAATGGGAATTGGGGG + Intergenic
948565157 2:238881639-238881661 GTGCCAGCATTAGTTCTGGCTGG + Intronic
1169662742 20:7998427-7998449 GTGGCAGCAGTGGGGATGTGGGG - Intronic
1171259391 20:23718384-23718406 TTGCCAGCAATGGGTAGAGGTGG - Intergenic
1172161293 20:32870253-32870275 GTGCCACCACTGTGTCTGGGAGG + Intronic
1172617036 20:36295750-36295772 GTCTCAGCTTTGGGTCTGGGTGG - Intergenic
1174009775 20:47440263-47440285 GTACCAGCTTTAGGTATGGATGG - Intergenic
1179613393 21:42566490-42566512 GAGCCAGCAGTGGGGATGTGTGG + Intronic
1182667967 22:31972920-31972942 GTGGCAGGTTTGGGTTTGGGGGG - Intergenic
1184260267 22:43311126-43311148 GTGACAGCATTGGGTAGGGTAGG - Intronic
1185164998 22:49255954-49255976 GTGACAGCAGTGGCCATGGGTGG - Intergenic
949505364 3:4722678-4722700 GTGCTAGTATAGGCTATGGGTGG + Intronic
950454195 3:13082932-13082954 GAGCCAGCAGTGAGTGTGGGAGG - Intergenic
950474937 3:13209224-13209246 GTACCTGAATTGGGAATGGGAGG - Intergenic
952002607 3:28803841-28803863 TTGCCAGCATTTGGTATTGTAGG + Intergenic
954294435 3:49666252-49666274 GGGCCAGCACTGGTTGTGGGAGG + Intronic
955118549 3:56031369-56031391 GGGCCAGCCATGGGTATGTGGGG - Intronic
960988631 3:123296280-123296302 GGGCCAGCAGTGGGTGGGGGTGG - Intronic
961090586 3:124107782-124107804 GTGTCATCATTAGGTATGGAAGG + Intronic
961514044 3:127421998-127422020 GCACCAGCATTGGCTTTGGGAGG - Intergenic
961789614 3:129366235-129366257 GTGCCTGAATTGGGAACGGGAGG + Intergenic
966587188 3:181639772-181639794 GTATCAGTATTGGATATGGGGGG + Intergenic
969447138 4:7251875-7251897 GGGACAGAATTGGGTTTGGGTGG + Intronic
973671242 4:53219977-53219999 GTGTAAGCATTGGGTAGTGGAGG + Intronic
974766154 4:66348934-66348956 GTGGCAGTATTGGGCATGGCGGG - Intergenic
975373679 4:73617401-73617423 TTGCCACCACTGGGTCTGGGAGG + Intronic
975633200 4:76421684-76421706 ATGCCAGGAGTGGGAATGGGAGG - Intronic
984266125 4:177499716-177499738 GGGCCAGCATGGGTTCTGGGTGG + Intergenic
985806263 5:2045748-2045770 GTGCCAGCAGTTTGCATGGGAGG - Intergenic
986024150 5:3834541-3834563 GTGCCAGCCATTGTTATGGGAGG - Intergenic
987188904 5:15453011-15453033 CTGCCAGCATTTGTTGTGGGAGG - Intergenic
987851545 5:23361767-23361789 GGGCCAGCATTGAGTATCTGTGG + Intergenic
992486425 5:77201479-77201501 GTGTCAGCACTGGCTTTGGGTGG + Intergenic
994144584 5:96379902-96379924 GTGCCAGGATTGGATAGAGGGGG + Intergenic
994821241 5:104653173-104653195 GTGACAGCAGTGGGTAGGGGTGG - Intergenic
997186350 5:131885265-131885287 GTCCCAGTATTGGGAATTGGAGG + Intronic
998519776 5:142789715-142789737 GTGGCAGGAGTGTGTATGGGTGG - Intronic
998535599 5:142927814-142927836 TTGCCAGTATTGGTTATTGGTGG + Intronic
1000420541 5:161033660-161033682 GTGCGCGCATTGGGTGGGGGGGG + Intergenic
1005783734 6:29220483-29220505 GTGACTGCATTGGGTAAGAGAGG + Intergenic
1008034630 6:46733476-46733498 GTGCCAGCCTTGGGTATGAAGGG + Intronic
1008495123 6:52125333-52125355 CTGCCAGCCTTGGGTTTGGAGGG + Intergenic
1010731238 6:79393853-79393875 GTGCCAGCAGTGGAGATGGAGGG - Intergenic
1012929659 6:105303571-105303593 GTGTCTGCATTGGATAGGGGAGG - Intronic
1016172957 6:141041877-141041899 GTGCCAGCACTAGTTCTGGGTGG - Intergenic
1016325132 6:142892354-142892376 ATGCCAGCAGAGGGTATGTGTGG - Intronic
1016425827 6:143934941-143934963 GTGCCAGCAGTGGCGATGGTGGG + Intronic
1017001391 6:149999964-149999986 GTCCCAGCCATGGGGATGGGTGG + Intergenic
1017717976 6:157225269-157225291 GTGCAAGGATTGGGGATGTGGGG - Intergenic
1017948704 6:159117672-159117694 GTTCCTGCATTGAGTCTGGGTGG + Intergenic
1019285829 7:222485-222507 GTGCCAGCCCTGGGCCTGGGGGG - Intronic
1019788702 7:2996456-2996478 GTGGCAGCTTTTGGTGTGGGTGG - Intronic
1020708089 7:11570782-11570804 GAGACAGCAGTGGGTAGGGGTGG + Intronic
1021840397 7:24717511-24717533 CAGCCAGCATGGGGGATGGGGGG + Intronic
1024248411 7:47488266-47488288 GTGTCAGCACTGGGAATGAGGGG - Intronic
1027372521 7:77521189-77521211 GTGGTAGCATTGAGTATGTGGGG - Intergenic
1029157355 7:98526576-98526598 GTGCCAGAATGAGGTAGGGGTGG - Intergenic
1034272339 7:149809295-149809317 GCACCAGCTCTGGGTATGGGTGG - Intergenic
1035263827 7:157677871-157677893 GTGCCGCCATGGAGTATGGGAGG + Intronic
1035748088 8:1975662-1975684 AAGCCAGCATTGGGCTTGGGAGG + Intronic
1036104353 8:5824288-5824310 GTCCTATCATTGGGTATGGAAGG + Intergenic
1040635677 8:49270466-49270488 GTGGCTGCTCTGGGTATGGGGGG + Intergenic
1045124918 8:99078901-99078923 GTGCCAGCAGTGGCCATGGTGGG + Intronic
1048522201 8:135167049-135167071 ATGCAAACATTGTGTATGGGAGG + Intergenic
1052857914 9:33418440-33418462 GTGTCAGCCATGGGGATGGGTGG - Intergenic
1056416916 9:86385847-86385869 GTGGCAGCAATGGGGATAGGTGG + Intergenic
1057217139 9:93235318-93235340 GTGTGAGCACTGGGGATGGGTGG - Intronic
1057899899 9:98940468-98940490 GTCCCAGCTGTGGGTGTGGGAGG - Intergenic
1059309853 9:113380782-113380804 CTGCCTGCATGGGGCATGGGAGG + Intergenic
1060724742 9:125999380-125999402 GCGGCAGCAAGGGGTATGGGGGG + Intergenic
1061431378 9:130533413-130533435 GAGCCAGCACTGGGGCTGGGTGG + Intergenic
1061872206 9:133527070-133527092 GTGCCAGGCTTGGGCATCGGGGG - Intronic
1062390356 9:136331372-136331394 GTGCCAGCATGGGGCAGCGGGGG - Intronic
1190310428 X:49113587-49113609 GTACCAGCCTGGGGGATGGGAGG + Exonic
1190397870 X:50003204-50003226 CTGCAAGCCTTGGGTGTGGGAGG - Intronic
1196753137 X:119135466-119135488 GTTCCAGCATTGGGGAGGAGGGG + Intronic
1201948748 Y:19540491-19540513 GGGCCAGCACTGGGTGTGGGCGG - Intergenic