ID: 1085268866

View in Genome Browser
Species Human (GRCh38)
Location 11:75257863-75257885
Sequence GATTTGATCTGAGATCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085268866_1085268870 8 Left 1085268866 11:75257863-75257885 CCTGTTTGATCTCAGATCAAATC No data
Right 1085268870 11:75257894-75257916 TTCTCTTGCTCTGTATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085268866 Original CRISPR GATTTGATCTGAGATCAAAC AGG (reversed) Intergenic