ID: 1085269254

View in Genome Browser
Species Human (GRCh38)
Location 11:75260583-75260605
Sequence TGCAATTGTCCCAGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085269248_1085269254 -7 Left 1085269248 11:75260567-75260589 CCTCTCCTATGACCCTTGCAATT No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data
1085269244_1085269254 9 Left 1085269244 11:75260551-75260573 CCACCTATCATACCCACCTCTCC No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data
1085269246_1085269254 -3 Left 1085269246 11:75260563-75260585 CCCACCTCTCCTATGACCCTTGC No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data
1085269242_1085269254 22 Left 1085269242 11:75260538-75260560 CCACCTCATATGACCACCTATCA No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data
1085269247_1085269254 -4 Left 1085269247 11:75260564-75260586 CCACCTCTCCTATGACCCTTGCA No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data
1085269245_1085269254 6 Left 1085269245 11:75260554-75260576 CCTATCATACCCACCTCTCCTAT No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data
1085269243_1085269254 19 Left 1085269243 11:75260541-75260563 CCTCATATGACCACCTATCATAC No data
Right 1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085269254 Original CRISPR TGCAATTGTCCCAGTGAGGT GGG Intergenic
No off target data available for this crispr