ID: 1085272206

View in Genome Browser
Species Human (GRCh38)
Location 11:75277085-75277107
Sequence CTTTGGTTATGGAAGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085272206_1085272217 25 Left 1085272206 11:75277085-75277107 CCCATTTCCTTCCATAACCAAAG 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1085272217 11:75277133-75277155 CAGAACCCAAGAAACTGAAGAGG 0: 1
1: 0
2: 1
3: 20
4: 268
1085272206_1085272210 -9 Left 1085272206 11:75277085-75277107 CCCATTTCCTTCCATAACCAAAG 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1085272210 11:75277099-75277121 TAACCAAAGCCTTCCCCTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 186
1085272206_1085272218 28 Left 1085272206 11:75277085-75277107 CCCATTTCCTTCCATAACCAAAG 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1085272218 11:75277136-75277158 AACCCAAGAAACTGAAGAGGTGG 0: 1
1: 0
2: 4
3: 41
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085272206 Original CRISPR CTTTGGTTATGGAAGGAAAT GGG (reversed) Intronic
901478375 1:9506446-9506468 CCATGGGTGTGGAAGGAAATGGG - Intergenic
902129558 1:14247574-14247596 CTTTGGTGCAGAAAGGAAATGGG + Intergenic
902581702 1:17411824-17411846 GTTGGGTTATGGTAGGAAAAGGG - Intronic
904928948 1:34071091-34071113 CATTGCTTATGGAAGGACAAAGG + Intronic
906037319 1:42759487-42759509 CTCAGGTTATGGATGGAAAGGGG + Intronic
909672066 1:78200471-78200493 CTTTGGTTTAGGAAGGGGATGGG - Intergenic
909882489 1:80897828-80897850 ATTGGGTTATGGAACTAAATGGG - Intergenic
910131378 1:83911020-83911042 GTCTGGTTAGGGAAGGAAGTGGG + Intronic
911718443 1:101162946-101162968 TTTTGGTCATGGAAAGACATAGG - Intergenic
912424563 1:109575829-109575851 ATTTGATAATGGAAAGAAATGGG - Intronic
912509434 1:110178517-110178539 CTTTGGGAAGGGAAGGGAATGGG - Intronic
913336255 1:117711111-117711133 ATTTGGTTATAAAAGGAAATGGG + Intergenic
913432713 1:118812940-118812962 AGTTGGTTCTGGAAGGAAAATGG - Intergenic
915072414 1:153281562-153281584 CTTTGGATGTGGATGGAATTGGG - Intergenic
917955734 1:180095811-180095833 CTTTGGAAATGGAAAGAATTAGG + Exonic
918072501 1:181143164-181143186 CTTTGTTTATGGGATGAACTGGG + Intergenic
918778338 1:188666539-188666561 CTTTTATTAGGGAAGGAAGTTGG - Intergenic
919113693 1:193253753-193253775 GTTTGCTTATGAAAGGAAAGTGG + Exonic
920170773 1:204071263-204071285 ACTTGTTGATGGAAGGAAATGGG - Intergenic
921108794 1:212012245-212012267 ATGTGGTTATGGTAGGAGATTGG + Intronic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
921535496 1:216344662-216344684 CTTGGGTAAAGGATGGAAATGGG + Intronic
921951651 1:220936430-220936452 CTTCAGATATAGAAGGAAATTGG - Intergenic
922810092 1:228410483-228410505 CTCTGGACTTGGAAGGAAATGGG + Intronic
923747537 1:236716415-236716437 ATCTGGTTTTGGCAGGAAATAGG + Intronic
924687951 1:246315188-246315210 TTTTGCTTAAGGAAGAAAATGGG + Intronic
1063005075 10:1962481-1962503 CTGTGGTTTTGGATTGAAATAGG - Intergenic
1063977490 10:11429059-11429081 CTTTGTCTGTGGAAGGCAATAGG - Intergenic
1064051710 10:12065507-12065529 ATTTGATCATGGAAGGATATGGG - Intergenic
1066105489 10:32152817-32152839 ATGTAGTTATTGAAGGAAATTGG - Intergenic
1066119285 10:32268221-32268243 TTTTTGGTGTGGAAGGAAATGGG + Intronic
1067177902 10:43962948-43962970 TTGTGGTTATGTAAGGAATTTGG - Intergenic
1068420833 10:56790142-56790164 CTTTGTTTATCCAAGGAAATGGG - Intergenic
1068943049 10:62699964-62699986 CTTTGGTTCTGGAAGGTTCTTGG - Intergenic
1069549058 10:69349763-69349785 CTTTTGTTATGGAGGGCAAGTGG + Intronic
1070092322 10:73299984-73300006 CTGGGGTTTTGGAAAGAAATGGG + Intronic
1070534998 10:77370389-77370411 CTTTTTTTTTGGTAGGAAATAGG - Intronic
1072310490 10:94149713-94149735 CTTTCTCTATGGAAGGGAATTGG - Intronic
1073782747 10:106857275-106857297 TTTTGGGTAGGGAAGGAGATGGG - Intronic
1074497791 10:113995126-113995148 CATGGGTTATGGAGAGAAATAGG + Intergenic
1076033575 10:127179682-127179704 ATTTTGTTATGAAAGGAAATGGG + Intronic
1078389803 11:10927196-10927218 CTTTGTATATGGAAGCAAACAGG - Intergenic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1080201530 11:29677117-29677139 CTATGGTTATTAAAGGAAAGTGG + Intergenic
1080586818 11:33690079-33690101 CTTTGGTTTTGGGGGGAAACAGG - Intergenic
1081282483 11:41226803-41226825 GTTTGATTGTGGAGGGAAATAGG - Intronic
1082203156 11:49398394-49398416 GTTTGGCTATAGAAAGAAATAGG + Intergenic
1082999132 11:59275693-59275715 CTTTTGTTAGGGAATGAAGTGGG - Intergenic
1083374579 11:62209141-62209163 CCTTGAATATGGAACGAAATAGG + Intronic
1084078385 11:66800228-66800250 AGTGGGTTAAGGAAGGAAATAGG + Intronic
1084914973 11:72421791-72421813 CCCTGGTGATGGAAGGCAATTGG - Intronic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085668573 11:78439704-78439726 CTTTTGGTATGGAAGGAGATAGG - Intronic
1087424284 11:97968947-97968969 CTTTGGTTAGGAAAAGAAGTGGG + Intergenic
1087857928 11:103115009-103115031 CTTTGTTTATAGTATGAAATAGG + Intronic
1087978953 11:104586611-104586633 AATTGGTCATGGCAGGAAATAGG + Intergenic
1089842271 11:121428514-121428536 CTTTGGTTCTGAGAGGAAATAGG - Intergenic
1090153083 11:124405432-124405454 TTATGGGTTTGGAAGGAAATCGG + Intergenic
1090403542 11:126463933-126463955 CATTGGATAGGGGAGGAAATAGG + Intronic
1093730522 12:22560987-22561009 CTTGGGGTATAGAAGCAAATTGG + Intergenic
1096755233 12:53793937-53793959 CCGTGGTTATAGAAAGAAATAGG - Intergenic
1096813846 12:54189039-54189061 CATTGTTTAGGGAAGGAGATTGG + Intergenic
1096843534 12:54392842-54392864 CCTGGGTTCTGGAGGGAAATTGG + Intergenic
1098918754 12:76283702-76283724 CTTTACTCTTGGAAGGAAATTGG + Intergenic
1099136939 12:78917339-78917361 CTTTGGGTATGGAAACTAATTGG - Intronic
1099932059 12:89086300-89086322 GTTTGGAGATGGAAGGATATTGG - Intergenic
1100044020 12:90356656-90356678 ATTTTCTTATGGAATGAAATTGG - Intergenic
1102144846 12:110647233-110647255 CTTTGGTTATAGAAGTGAAGTGG + Exonic
1102734305 12:115144563-115144585 CTGGGGTTAGGGAAGGGAATGGG + Intergenic
1103707524 12:122886157-122886179 CTTGGGCTATGGAAGCAGATGGG + Intronic
1104357033 12:128095959-128095981 CTTTAGTTCTGGAAGAAAACAGG - Intergenic
1106772581 13:32976076-32976098 CTTTGGCTATGGAAAATAATAGG + Intergenic
1107401133 13:40070418-40070440 ATTTTGTTAAGGAAGGAACTTGG + Intergenic
1108801463 13:54101336-54101358 CAATGGTTGTGGAAGGTAATGGG - Intergenic
1109726605 13:66349268-66349290 CCTTGGTTGTTGAAGGAAAGGGG + Intronic
1110426102 13:75369185-75369207 CTTTGGTTTTGAAAGGGAATTGG - Intronic
1112406653 13:99126545-99126567 CTTTGGGGATGCAAGGAAAGAGG + Intergenic
1114203572 14:20546666-20546688 CTCTGGTTTTGGCTGGAAATGGG - Intergenic
1114654840 14:24309967-24309989 CCCTGGTGGTGGAAGGAAATAGG - Intronic
1116325606 14:43530542-43530564 CTTTGGTTTTGTTAGGAAACTGG + Intergenic
1116599820 14:46906396-46906418 CTTTCTTTTTGGAAGTAAATAGG + Intronic
1118751387 14:68810201-68810223 GTTTGATTAAGTAAGGAAATTGG - Intergenic
1119549083 14:75495017-75495039 CTTGGCTTTGGGAAGGAAATTGG + Intergenic
1120443006 14:84562308-84562330 CTCTGGTTAGGAAAGGAAGTGGG + Intergenic
1120443269 14:84564148-84564170 CTCTGGTTAGGAAAGGAAGTGGG + Intergenic
1121588417 14:95079925-95079947 CTTTTGTTTTGGATGGACATGGG + Intergenic
1121953912 14:98197095-98197117 CTTTGGTGGTGGAATGAAACAGG - Intergenic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1131792822 15:95983519-95983541 CTTTGGATGTGGAGGCAAATGGG + Intergenic
1132046602 15:98567983-98568005 CTTTGGGTCTGGAAAGAACTAGG - Intergenic
1133168142 16:3963601-3963623 TTGTGGTTGGGGAAGGAAATGGG + Exonic
1135345070 16:21681928-21681950 CTTTGCTTCTGCAAGGAAAAGGG + Intronic
1135523046 16:23191993-23192015 CTTTTGATATGATAGGAAATGGG + Intronic
1137537829 16:49340879-49340901 CTTTGGTAATTGAAGGAAAGGGG - Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137852838 16:51763372-51763394 CTTTGTGTATGGAAGGGACTAGG + Intergenic
1138059318 16:53873130-53873152 CTTTGATTATGGAGGGAAAGAGG + Intronic
1138488173 16:57360141-57360163 CTTTGGTCAGAGGAGGAAATTGG + Intronic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1139011980 16:62645612-62645634 CTCTGGTTAGGGAAGGACATAGG - Intergenic
1144028437 17:11299039-11299061 TCTTGGTCATGGAAGGAAAGGGG - Intronic
1147620178 17:41861259-41861281 CTGTGGTTATAGAAAGGAATAGG - Intronic
1149309785 17:55382771-55382793 CCTTGGTTATGAAGGGAAAGAGG - Intergenic
1150225538 17:63522895-63522917 CTTTGGTACTGGGAGGGAATCGG + Intergenic
1151111756 17:71686532-71686554 ATTTGATTTTGGAATGAAATTGG - Intergenic
1151136520 17:71951095-71951117 ATTTTGTTTTGGAAGGAAAAGGG + Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1155644103 18:28056484-28056506 CTTTGATTATGTAAGAAAACTGG + Intronic
1156136540 18:34046543-34046565 CTTTGGTTAAGGTAGTAAATTGG + Intronic
1156305500 18:35874871-35874893 CTTTGGTTAGGAAAAGAAGTGGG - Intergenic
1156359821 18:36375068-36375090 CTTTGGTTATGTATAGAAAATGG + Intronic
1156619537 18:38833032-38833054 CTGTGGTGAAGAAAGGAAATTGG + Intergenic
1157653454 18:49361203-49361225 CATTGCCTAGGGAAGGAAATGGG - Intronic
1158721851 18:59932071-59932093 CTTGGGTTATGGATGGGAAATGG + Intergenic
1158820502 18:61153326-61153348 CTTTTCTTATGGAAAGAAGTGGG + Intergenic
1158973203 18:62687379-62687401 CTTTGGGGATGGAAGGGAACAGG - Intergenic
1160264280 18:77325884-77325906 CTATGGCTATGGAAGGTGATGGG - Intergenic
1160326240 18:77951282-77951304 CTGGGGTTATGGATGGAACTTGG + Intergenic
1162658633 19:12152180-12152202 GTTTAGTTATGGTAGGTAATTGG - Intronic
1164905553 19:31964629-31964651 CTTGGGTCAGGGAAGGAAAATGG - Intergenic
1166398684 19:42461819-42461841 CTTTGATTATAGAAAAAAATAGG - Intergenic
1167095075 19:47370977-47370999 TTTTTGTTTTGGAAGGAAACAGG + Intronic
925459511 2:4048286-4048308 CTTTTGTAATGGATGGAAATTGG + Intergenic
927452121 2:23217632-23217654 CTTTGGTTCAGGAAGATAATGGG + Intergenic
927872051 2:26629928-26629950 CTTGGGTTGAGGATGGAAATTGG - Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
930857618 2:56035866-56035888 CATTGGTATTGGAAGGAAATTGG + Intergenic
931980431 2:67688344-67688366 CATTTGTTATGCAAGAAAATTGG - Intergenic
932090706 2:68803810-68803832 ATTTGATAATGGAAGGAAAGAGG + Intronic
933309486 2:80642786-80642808 CTTTGGTGATATAAGGAATTAGG + Intronic
935098243 2:99967799-99967821 CATTGGTTCTGGAAAGAAAGTGG - Intronic
936283523 2:111163005-111163027 ATCTTGTTATGGAAGGAAAAGGG + Intronic
936654832 2:114472911-114472933 CTATGGTGATGGGAGGAGATTGG - Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937926122 2:127168780-127168802 CTTTGGCTATGGATCAAAATTGG - Intergenic
938881178 2:135591075-135591097 TTTTGGTGTAGGAAGGAAATGGG + Intronic
939729779 2:145768436-145768458 CTTTTGTTAAGGAGGGGAATTGG - Intergenic
941700867 2:168603221-168603243 CATTGGTGATGGGAAGAAATGGG + Intronic
941770185 2:169336828-169336850 CTTGGTTTCTGGAAGGAGATGGG - Intronic
942458806 2:176155638-176155660 CTTAGGGCAGGGAAGGAAATGGG + Intronic
942882453 2:180877879-180877901 TTTTGTATATGGAAAGAAATAGG - Intergenic
943526409 2:189021971-189021993 ATTAGGTTAAGGAGGGAAATGGG + Intergenic
945582905 2:211618793-211618815 CTTTGGTTATTAAATGCAATTGG + Intronic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
947649822 2:231776720-231776742 CTTTGTTGAAGGAACGAAATGGG + Intronic
947675342 2:231974067-231974089 CTTTGCATATGAAAGGAAAAAGG - Intronic
1169525395 20:6419162-6419184 ATTTGGACATGAAAGGAAATAGG + Intergenic
1170200639 20:13739996-13740018 CTTTGGTTATGGGCAGAAAGAGG + Intronic
1170345978 20:15387575-15387597 CTTCCTTTATGGAAGGAAGTGGG - Intronic
1170784242 20:19453677-19453699 CTATGGCAATGGAAGGACATTGG - Intronic
1170801263 20:19592380-19592402 ATTTGGCTATGGAAATAAATTGG - Intronic
1171079482 20:22163929-22163951 CTTTGGTTTGGAAAGTAAATAGG + Intergenic
1171157637 20:22890918-22890940 CTTTGTTTATGGAAGTCACTTGG - Intergenic
1173275741 20:41580081-41580103 CTTAAGTTTTGAAAGGAAATTGG - Intronic
1174047280 20:47742395-47742417 GTTTGGTCATGGAAAGAAACCGG - Intronic
1174164104 20:48572421-48572443 GTTTAGTCATGGAAAGAAATTGG + Intergenic
1178681518 21:34676136-34676158 CTTTAGATATTCAAGGAAATGGG - Intronic
1179915566 21:44475898-44475920 CCTTGGCTATGGGAGGAAGTGGG - Intergenic
1181207053 22:21260883-21260905 GTTTGGTTACAGAAGGAAACAGG + Intergenic
1181886428 22:26025617-26025639 CTTTGGTGAGGGGAGGGAATGGG + Intronic
1183001515 22:34863461-34863483 CTATGGTTCTGGCAGGAAAGAGG + Intergenic
949307447 3:2658603-2658625 GTTTGGGTATTTAAGGAAATGGG - Intronic
950983794 3:17338276-17338298 CTTTAGTTAAGGAATGCAATAGG + Intronic
952746824 3:36789477-36789499 TTTTGCTTATGTAAAGAAATGGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953746662 3:45579540-45579562 CTTTGGTGCTGGAAGGAGTTGGG + Intronic
954116203 3:48468176-48468198 CCTGGGTTGTGGAGGGAAATTGG - Exonic
954849519 3:53588517-53588539 CAGAGGTTATGGAAGGAAATTGG + Intronic
955354841 3:58222762-58222784 ATCTGGTTCTGGAATGAAATTGG - Intergenic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955707061 3:61738430-61738452 CTTTGGTATTTGAAAGAAATAGG - Intronic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
958957956 3:100481559-100481581 CTTTAGTTGTGGAAAGAAAGAGG + Intergenic
959043690 3:101448065-101448087 TTTTGGGTATGGAATGAAATAGG - Intronic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959137145 3:102437461-102437483 CTTGGGTTTTGGAAGGAAAATGG - Intronic
960680792 3:120245415-120245437 CTTTGATTGTGGAGGAAAATTGG + Intronic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
964153202 3:153553490-153553512 CTTTGGATGTGGGAGGAAACTGG + Intergenic
966593138 3:181703352-181703374 GTTTGCTTATTGACGGAAATCGG + Intergenic
967798264 3:193623148-193623170 CTTTTGCTATGTAAGGATATAGG - Intronic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970525023 4:16923031-16923053 ATTTGTTTATTGAAGAAAATGGG - Intergenic
970910584 4:21270273-21270295 CTTTGGTTAAGGAAGGTATGAGG + Intronic
971016275 4:22492377-22492399 ATTGGGTTATTGAAGGAAAACGG - Intronic
971445537 4:26742851-26742873 CTTTCGTTATGAATAGAAATTGG - Intronic
971859775 4:32088497-32088519 CTCTGGTTAGGAAAGGAGATGGG + Intergenic
973225381 4:47777949-47777971 CTCTGGTTCTGAAAGAAAATTGG - Intronic
974291086 4:59931886-59931908 CTTTGGTGGTGGGAGGAACTAGG + Intergenic
974383693 4:61176899-61176921 CTTTCTTTATGGAAGGTTATAGG + Intergenic
975102720 4:70532755-70532777 CTTTGGAGATGGAAGAAAGTTGG + Intergenic
975327903 4:73080758-73080780 CTTTGGTTCTAGAAGGATACAGG - Intronic
975970621 4:80030624-80030646 TTTTGGTCATGCAAGTAAATTGG - Intronic
976698785 4:87946714-87946736 CTTTAGTTCTGGAAGGATTTAGG - Intergenic
977285142 4:95095345-95095367 TTTTGGTTAAGAAAGAAAATGGG + Intronic
977800438 4:101223674-101223696 TTTGGTTTATGGAAGGAGATTGG - Intronic
981155467 4:141429712-141429734 ATTGGGATATGGGAGGAAATTGG - Intergenic
982034091 4:151328307-151328329 TTTTGCATATGGAATGAAATAGG - Intergenic
982131589 4:152233765-152233787 TTTGGGCTATGGAAGGAGATGGG - Intergenic
982637725 4:157917805-157917827 TTTTGATTAAGGAAGGAAAGAGG - Intergenic
983161224 4:164417363-164417385 CTTTGCATTTGGAAGGGAATGGG - Intergenic
984771819 4:183443400-183443422 CTTTTGGTATGGCAGGAAAATGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
986627959 5:9740602-9740624 CTGGGGTTTTGGAAGGCAATTGG - Intergenic
987155055 5:15081017-15081039 CTTTGGTTATGGAAAGGACTCGG - Intergenic
987307490 5:16651045-16651067 TGTTGGCAATGGAAGGAAATAGG - Intergenic
987621357 5:20341085-20341107 CTCTGGTTAGGGAAGGATGTGGG - Intronic
987916508 5:24221617-24221639 CTTTGGATATGGTAAGAGATAGG + Intergenic
988080135 5:26403855-26403877 CTTTAGTTCTAGAAGCAAATAGG + Intergenic
991408943 5:66328132-66328154 CTTCAGGTATGTAAGGAAATTGG - Intergenic
991953638 5:71971121-71971143 CTTTGGTTAAGGAAGAAACTAGG + Intergenic
992219773 5:74560301-74560323 CATTGGTTCTGGCAGGAAACTGG + Intergenic
994367454 5:98931647-98931669 CTCTGGTTTTGCAAGGACATGGG - Intergenic
995417198 5:111924742-111924764 CTTTGGTTAGGAAAAGAAGTGGG + Intronic
997185682 5:131879666-131879688 CTTTGGATTTGGAAGTAAATAGG - Intronic
997420702 5:133764510-133764532 CTTTGGATTTGCAAGGAATTGGG - Intergenic
998871038 5:146551969-146551991 ATGTGGTGATGGGAGGAAATGGG - Intergenic
999207405 5:149859467-149859489 CTTGGGGAAGGGAAGGAAATAGG + Exonic
999362468 5:150997637-150997659 CTTTGGAAATTGAGGGAAATTGG - Intergenic
1000394280 5:160757112-160757134 TTTTGTTTATGGTATGAAATAGG + Intronic
1001433574 5:171682392-171682414 CTTGGTTTAAGGAAGGAAAAAGG + Intergenic
1001828460 5:174765405-174765427 CTCTATTTTTGGAAGGAAATTGG + Intergenic
1001916511 5:175565778-175565800 CTTTGGTTATCTTTGGAAATGGG + Intergenic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003578084 6:7315523-7315545 CTTGGGTGGTGGAAGGAACTGGG - Intronic
1003614793 6:7645246-7645268 CATGGGCTATGGAAGAAAATGGG + Intergenic
1004832396 6:19491004-19491026 CTTTGGTTCTGAAAAGGAATTGG + Intergenic
1006742786 6:36321266-36321288 CTTTGTTTTTGGAAGGGAACTGG - Intronic
1009332803 6:62445278-62445300 CTTTGTTTATGGAAGATTATAGG + Intergenic
1010387410 6:75297797-75297819 CTTTCTTAAGGGAAGGAAATTGG - Intronic
1010761676 6:79730935-79730957 CTTTGGGTATGGGAGGCACTAGG + Intergenic
1011868852 6:91866958-91866980 CTTTGGTCAGTGAGGGAAATGGG + Intergenic
1013452790 6:110301437-110301459 CTTGCTTTATGGAAGGAAGTGGG + Intronic
1014828345 6:126072374-126072396 CTTGTATTATGAAAGGAAATCGG + Intergenic
1015632371 6:135244615-135244637 CTTAGGTATTGAAAGGAAATAGG - Intergenic
1017209966 6:151844703-151844725 CTTTATTTATGGAAGGGAATAGG + Intronic
1024245272 7:47464991-47465013 TTTTGTGCATGGAAGGAAATAGG - Intronic
1024485988 7:49920129-49920151 ATTTGGATATGGAAGCAAAATGG + Exonic
1024986760 7:55200790-55200812 CCTGTGTTATGGAAGGAGATAGG - Intronic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026298849 7:69079712-69079734 CTTTCGATGTGGAAGGAACTAGG - Intergenic
1026662348 7:72313352-72313374 ATTTGGCTATGGTAGGATATAGG - Intronic
1027986589 7:85299327-85299349 CTTTGGCTAAGGGAGGAGATTGG - Intergenic
1028034578 7:85965495-85965517 CTTTGGTAGTGGCAGAAAATGGG - Intergenic
1028271720 7:88799461-88799483 CTATGGTCATGGATAGAAATAGG - Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1029852417 7:103477008-103477030 CTTTGGTTGTGGATAGAACTAGG + Intronic
1031492463 7:122405805-122405827 CTTTGGAAATGAAATGAAATTGG + Intronic
1031550922 7:123110468-123110490 CTTTGATTCAGGAAGGAAAATGG - Intergenic
1032693452 7:134312743-134312765 CTTTAGAAATGGAATGAAATGGG - Intronic
1033113306 7:138602721-138602743 CTGTGGTTAGGGGTGGAAATGGG - Intronic
1033537140 7:142322369-142322391 ATTTGGTCATAGAAGGTAATTGG - Intergenic
1036703527 8:11029891-11029913 CTTCTGTTATGGATGGAAAATGG - Intronic
1037716706 8:21407314-21407336 CTGTGGCTCTGGGAGGAAATTGG - Intergenic
1038053133 8:23832083-23832105 GGTTGGTTAGGGAAGGAGATAGG + Intergenic
1038396040 8:27246181-27246203 CTTTCTACATGGAAGGAAATGGG + Intronic
1039287427 8:36057359-36057381 CCTTGGTGATGAAAGGAAAAAGG - Intergenic
1041543626 8:59014848-59014870 CTATGGTTATCAAAGGAAACAGG + Intronic
1042371188 8:67992248-67992270 CTGTGGTTCTGCAAGGATATGGG + Intronic
1043585333 8:81761955-81761977 CTTTTGTTATTGAAGGATACAGG - Intergenic
1045520163 8:102896523-102896545 CTTTGGTACTGGAGGGGAATTGG - Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046401118 8:113704410-113704432 CTTTTGTTACAGAAGGAAAATGG + Intergenic
1046767447 8:118084997-118085019 AGATGTTTATGGAAGGAAATGGG + Intronic
1049339885 8:142106446-142106468 CTTTGGTGATGGAAGGTTGTGGG - Intergenic
1050715306 9:8517821-8517843 GTTTGGTTGAGGAGGGAAATAGG - Intronic
1050949978 9:11576822-11576844 CTTTACCTATGGAAGGACATAGG + Intergenic
1054994290 9:71367118-71367140 CTTATTTTAAGGAAGGAAATTGG - Intronic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1056013810 9:82360795-82360817 CTTGGGATATGGGAGGAAACTGG - Intergenic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058770510 9:108226755-108226777 CTTTGGATTTGGATGGATATGGG + Intergenic
1059121496 9:111643004-111643026 TTTTGGTTTTGGAAAGAAGTTGG + Intronic
1060070532 9:120543139-120543161 CTTTGGTGATGGATGGGAAGGGG - Intronic
1185844839 X:3428045-3428067 CTCAGGAGATGGAAGGAAATTGG + Intergenic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1187204620 X:17170281-17170303 CTTTGGCTATGAAAGCAAAAAGG + Intergenic
1187981938 X:24766670-24766692 TTTTGGTTATTGAAGGAGCTGGG + Intronic
1188370992 X:29369422-29369444 CTTTGATTCTCGAAGGAAATGGG + Intronic
1189471972 X:41321748-41321770 CCTGGGTTGTGGAGGGAAATTGG - Intergenic
1189497922 X:41526297-41526319 CTTTGGGGATAGAAGCAAATAGG - Intronic
1192758146 X:74067138-74067160 CCTGGGTTGTGGAGGGAAATTGG + Intergenic
1193172981 X:78358130-78358152 CTTTGGAAATGGGAGGAAAGAGG - Intergenic
1193861036 X:86667638-86667660 CTTTTATTGTGGAAGGAAAGTGG - Intronic
1194240670 X:91443478-91443500 CTTTGTGTTTGTAAGGAAATTGG + Intergenic
1194352531 X:92838804-92838826 TTTTGGTTATGGCAAGAGATAGG - Intergenic
1194795152 X:98202052-98202074 CTCTGGTTAAAGAAGGAATTGGG - Intergenic
1195321450 X:103724805-103724827 CTTTCCTTAGGGAAGGCAATAGG + Intronic
1195621708 X:106962835-106962857 CTCGGGTTATGGAATTAAATAGG - Intronic
1195992610 X:110697581-110697603 CAATGGTTTGGGAAGGAAATTGG - Intronic
1197017030 X:121637097-121637119 CATTGATCATAGAAGGAAATTGG + Intergenic
1197559244 X:127997582-127997604 TTTTGTATATGGCAGGAAATAGG - Intergenic
1198640431 X:138750106-138750128 CGTTGGTTATGGACTGCAATGGG + Intronic
1198838308 X:140828829-140828851 CCTTGGTTATTGAAGGCAAATGG + Intergenic
1198862053 X:141081569-141081591 TTTTGCTAATGGCAGGAAATGGG - Intergenic
1198900637 X:141505803-141505825 TTTTGCTAATGGCAGGAAATGGG + Intergenic