ID: 1085272475

View in Genome Browser
Species Human (GRCh38)
Location 11:75278471-75278493
Sequence TCCCTGACCCCTGTGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 326}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085272469_1085272475 4 Left 1085272469 11:75278444-75278466 CCAAATCCCCCATGAGAGGTCTC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272466_1085272475 18 Left 1085272466 11:75278430-75278452 CCCAAGAGGCTTCTCCAAATCCC 0: 1
1: 1
2: 1
3: 12
4: 213
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272472_1085272475 -4 Left 1085272472 11:75278452-75278474 CCCATGAGAGGTCTCAGATTCCC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272473_1085272475 -5 Left 1085272473 11:75278453-75278475 CCATGAGAGGTCTCAGATTCCCT 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272470_1085272475 -2 Left 1085272470 11:75278450-75278472 CCCCCATGAGAGGTCTCAGATTC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272465_1085272475 26 Left 1085272465 11:75278422-75278444 CCTTTAGGCCCAAGAGGCTTCTC 0: 2
1: 0
2: 1
3: 5
4: 122
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272471_1085272475 -3 Left 1085272471 11:75278451-75278473 CCCCATGAGAGGTCTCAGATTCC 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1085272467_1085272475 17 Left 1085272467 11:75278431-75278453 CCAAGAGGCTTCTCCAAATCCCC 0: 1
1: 1
2: 2
3: 21
4: 181
Right 1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085272475 Original CRISPR TCCCTGACCCCTGTGGTCCT TGG Intronic
900131839 1:1090570-1090592 CCTCTGTCCCCTGTGGGCCTGGG + Intronic
900224686 1:1527405-1527427 TGCCTGACCCCTGCTGTGCTGGG - Intronic
900338517 1:2176706-2176728 TCCCTGGCCCCTGTGGTCAGTGG + Intronic
900601008 1:3502609-3502631 TCCCTGGCCTCTGTGCTCCCTGG - Intronic
900989893 1:6093668-6093690 ACCCAGACCCCTGTGGCCCTGGG + Intronic
901212549 1:7534716-7534738 ACTCTGCCCCCTGTGGTCTTAGG - Intronic
901488136 1:9579614-9579636 TCCCTGAACCCTGTCCTCTTGGG + Intronic
901612708 1:10511749-10511771 TCTCTGACCTCTGTGGCCCGTGG + Intronic
901717651 1:11169384-11169406 TTCCTGATTCCTGTGGGCCTTGG - Intronic
902917113 1:19645516-19645538 GCCCTGACCTCTGTTTTCCTGGG - Intronic
904481955 1:30799603-30799625 TGCCTGACCCCTGTTGTCTGGGG - Intergenic
904562038 1:31405500-31405522 TCCCTGAGCCCAGAGGTCCTGGG + Intergenic
905247683 1:36626271-36626293 GTGCTGACCCCTGTTGTCCTAGG + Intergenic
905285244 1:36875139-36875161 TACTTAACCTCTGTGGTCCTTGG - Intronic
906266830 1:44437702-44437724 TCCCTTACCCCTGAGCTCCCAGG - Intronic
906274503 1:44506197-44506219 TCTCTGACCACTGTGATGCTGGG - Intronic
907470817 1:54672299-54672321 ACCCTGAAGCCAGTGGTCCTTGG - Intronic
907481236 1:54746825-54746847 TCCCTGCCCTCTCTGGGCCTTGG + Intergenic
907961828 1:59290837-59290859 TCACTGAGCCCTGTGCTCCCAGG - Intergenic
908564395 1:65339808-65339830 TCCCTCACCCCTGGGCTTCTGGG + Intronic
912737416 1:112162215-112162237 TCCCTTACTCCTTTGTTCCTGGG + Intergenic
912959217 1:114180659-114180681 CCCCTGACCCCTGGGCCCCTCGG + Intergenic
915342740 1:155185256-155185278 TCCCTGACCCCTTTGGGCCCAGG - Intronic
915608147 1:156968020-156968042 GCCCTGCCGCCTGTGGTGCTGGG + Exonic
915981090 1:160420347-160420369 TCCCTTTCCCCTGTGCCCCTTGG + Intronic
916012491 1:160718749-160718771 TCTCTTACCCCTGTGGCCTTGGG - Intergenic
917176382 1:172240049-172240071 TCCCAGACTCCTGTACTCCTTGG + Intronic
917839573 1:178966719-178966741 TTCCTGACCTCTCTGGGCCTTGG + Intergenic
918538475 1:185602013-185602035 TCCCTGACTAATGTAGTCCTCGG + Intergenic
920842179 1:209564198-209564220 TCCCTGTCCACTGTGTGCCTTGG + Intergenic
922780301 1:228247072-228247094 TACCAGGCCCCTGTGGTCCAAGG + Intronic
922870350 1:228897664-228897686 GGCCTGACACCTGTGGTCCTCGG - Intergenic
923386853 1:233473287-233473309 TGCGTGAACCCTGTGGGCCTGGG + Intergenic
924638347 1:245809759-245809781 TCCCTGAGCAGTGTGGCCCTGGG - Intronic
1067097836 10:43314253-43314275 TCTGTGCCCGCTGTGGTCCTGGG - Intergenic
1068834938 10:61543168-61543190 TCCCTGAACCCTGTCCTCTTGGG + Intergenic
1070187391 10:74078245-74078267 TCTCTCCCCACTGTGGTCCTGGG + Intronic
1070664098 10:78331500-78331522 TGCCTGATACCTGGGGTCCTGGG + Intergenic
1070758201 10:79006449-79006471 TCCCTGACCCCTGGGGCCTCAGG + Intergenic
1071294826 10:84211886-84211908 TGCCTGGCTCCTGAGGTCCTGGG - Intronic
1071963865 10:90832782-90832804 TCCCTCCTCCCTGTGGGCCTGGG - Intronic
1072717249 10:97760218-97760240 CCCTTGACCCCTGGGGGCCTGGG + Exonic
1073444799 10:103574286-103574308 TCACTAACCGCTGTGGTCATGGG + Intronic
1076816356 10:132916887-132916909 TCCCTGACCCTTGTGCTAATGGG - Intronic
1076851133 10:133093669-133093691 TCCCAGCCCCCTTGGGTCCTCGG + Intronic
1077079805 11:720230-720252 TCCCTGTCCCCCGTGGCGCTGGG - Intronic
1077086189 11:752588-752610 TCCCTGAACCCTGTCCTCTTGGG - Intronic
1077323277 11:1952006-1952028 TCCCTGCCCCCTGTGGGTCTTGG + Intronic
1078004886 11:7525155-7525177 TCCCTAACTCCTGTGGGCCCTGG + Intronic
1078511706 11:11988970-11988992 TTCCTGGCCCCTGCTGTCCTTGG - Intronic
1078525213 11:12095680-12095702 TTCCACACCCCTCTGGTCCTTGG + Intronic
1079245414 11:18748905-18748927 GCACGGACCACTGTGGTCCTAGG + Intronic
1079659036 11:23017586-23017608 TCCCTGAAGACTGTGGTCCCAGG + Intergenic
1080758628 11:35226394-35226416 TCCCTGGCCCCTGTGTTCTTTGG - Intronic
1081990817 11:47336674-47336696 TCCCTGGGCCCAGGGGTCCTTGG + Intronic
1083363969 11:62130246-62130268 CCCTTGACCCTTGGGGTCCTGGG - Exonic
1084566632 11:69932376-69932398 CACCTGATCCCTGTGATCCTGGG + Intergenic
1084731435 11:71076110-71076132 TCCCTGGCCCCTGTGAGCTTGGG - Intronic
1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG + Intronic
1085313243 11:75528464-75528486 TCCATGACCCCTGAGGCGCTGGG + Intergenic
1087703723 11:101466168-101466190 TCCCTGACCCCTGTGTATCCTGG - Intronic
1087889706 11:103523244-103523266 TCCTTGTCCCATGTAGTCCTAGG + Intergenic
1087889722 11:103523470-103523492 TCCTTGTCCCATGTAGTCCTAGG + Intergenic
1088691460 11:112332023-112332045 CACCTGAGCCCTGTGCTCCTGGG - Intergenic
1090835237 11:130449107-130449129 TCCCTGATCCCCGGAGTCCTCGG - Exonic
1202806265 11_KI270721v1_random:7201-7223 TCCCTGCCCCCTGTGGGTCTTGG + Intergenic
1091395127 12:149712-149734 TCCCTGACCTCCGTTGTCCCCGG - Intronic
1091833480 12:3567649-3567671 CCCCTAACCCCTGTGGTAGTCGG - Intronic
1091920965 12:4304127-4304149 GCCCTGTCCCCTGTGGCCCATGG - Exonic
1092237593 12:6819717-6819739 TTCCTGCCCTCTGTGGTCCCAGG - Exonic
1092304429 12:7284232-7284254 TCCCTGACCCCTGTGCCTCCTGG + Intergenic
1094299488 12:28946310-28946332 TGCCTGACCCCTCTGCTCCAGGG + Intergenic
1097798438 12:63887566-63887588 TCCCTGACACCTGTGCCACTTGG + Intronic
1098109542 12:67107741-67107763 TGCCTGACCTCTGTCCTCCTGGG - Intergenic
1099183832 12:79497120-79497142 TCCCTGACCCTTGTGCTTCCTGG + Intergenic
1099236040 12:80083734-80083756 TCCCTGACCCCTGTGCCTCCTGG - Intergenic
1101455424 12:104825987-104826009 TCCCTGAGCCCTGGTGACCTTGG - Intronic
1103043033 12:117711615-117711637 TCCCAGACTCCTGTCTTCCTAGG - Intronic
1103910278 12:124348357-124348379 TGCCTGCCCACCGTGGTCCTGGG - Intronic
1104682910 12:130763594-130763616 TCCCTGAACCCTGTCCTCTTGGG - Intergenic
1105303613 13:19154891-19154913 TCCCTGACCTCTCTGAACCTTGG - Intergenic
1105472475 13:20705157-20705179 TTCTTGACCTCTGTGGCCCTGGG - Intronic
1106319002 13:28620997-28621019 TCCCTGACTCCTGGGAGCCTGGG + Intergenic
1106876344 13:34078013-34078035 TCCATGACCTCTGTGATCTTGGG - Intergenic
1108478576 13:50844025-50844047 TCCCAGACCTCAGTGGTCATTGG - Intergenic
1111293247 13:86195296-86195318 TCACTGAAACCTGTGGTCCCAGG - Intergenic
1112497276 13:99915159-99915181 TGCCTGAGCCCTGTGGGGCTGGG - Intergenic
1113352970 13:109547613-109547635 TCTCTGAGCCCAGTGGACCTAGG - Intergenic
1113842400 13:113367637-113367659 TACCTGAGCCCTATGATCCTGGG + Intergenic
1116820343 14:49621107-49621129 TCCCGGGCCCCGGGGGTCCTGGG - Exonic
1118830458 14:69426581-69426603 TCCCTGAACCCTGTCCTCTTGGG + Intronic
1119788155 14:77327847-77327869 GCCCTGTCCCCTCTGGTCCAGGG + Intronic
1121506401 14:94480909-94480931 TCCCTGATCCCTGGAGACCTCGG - Intergenic
1121822784 14:96984842-96984864 TCCCTCACCTCTCTGGTCATGGG - Intergenic
1122599657 14:102914963-102914985 TCCCTGGCCCCTGTGGCACTTGG + Intergenic
1122825398 14:104368190-104368212 GCCCTGACCCCATTTGTCCTTGG - Intergenic
1202875981 14_KI270722v1_random:784-806 TCCCTCACCTCTGAGGTGCTGGG + Intergenic
1124914634 15:33957908-33957930 TCCCTGAACCCAGTGGCACTTGG + Intronic
1125189347 15:36971919-36971941 TCACTGATCCCTGTCATCCTCGG + Intronic
1125812092 15:42550156-42550178 TCCAGGACCCATGTGGTCCGCGG - Intronic
1126617192 15:50596338-50596360 TCCCTCAAATCTGTGGTCCTGGG - Exonic
1128250302 15:66159359-66159381 TCCCTGACCTCTGTGGCTCCTGG - Intronic
1128372402 15:67049916-67049938 TGCCTGGCCCCTGTGGTCACAGG + Intergenic
1128532525 15:68464476-68464498 TCCCTGACATCTGTGCTGCTGGG + Intergenic
1129115044 15:73360841-73360863 TGCCTGACCCCTGTAGGCTTTGG - Intronic
1129313007 15:74725482-74725504 TCCCTGATCCTTGTGATCCCAGG - Exonic
1129772516 15:78211845-78211867 CCTCTCACCCCTGTGGCCCTTGG + Intronic
1129774670 15:78228674-78228696 TGCCTGACCCCTTTGATCTTGGG + Intronic
1132734553 16:1379129-1379151 TCCCTGACCCCGGGGGACCGCGG - Intronic
1134152741 16:11817916-11817938 TCCCTGAACCCTGTGCTCTTAGG + Intergenic
1134221563 16:12358810-12358832 TCCCTGAATCCTGTCTTCCTGGG - Intronic
1135351187 16:21730520-21730542 TCCCTCAGCTCTGTGTTCCTTGG + Intronic
1135449668 16:22546647-22546669 TCCCTCAGCTCTGTGTTCCTTGG + Intergenic
1137060302 16:35787354-35787376 TCCCACACCCATGTGGTTCTGGG + Intergenic
1137945215 16:52727321-52727343 TCCTGGACCCCTGTGTTCTTTGG + Intergenic
1139545227 16:67646848-67646870 TCCCTGCCCCTTGTGGCCCCAGG + Intronic
1140206742 16:72939527-72939549 TCCCAGACCCCTTTTGCCCTTGG - Intronic
1141755735 16:85989475-85989497 TCCCTCAGCCCTGAGGTGCTGGG + Intergenic
1142788742 17:2246318-2246340 GCCCTGACCACTGGGATCCTGGG - Intronic
1143702619 17:8672527-8672549 TCCCTGAGCTCTGCGGGCCTTGG - Intergenic
1144510946 17:15875942-15875964 TCCCTGACCCCTGTGATATGTGG - Intergenic
1144671011 17:17132576-17132598 TCCCTGACCTCTGTAGCCCGTGG - Intronic
1144998277 17:19285878-19285900 TCCCTGTCTCCTCTGGGCCTGGG + Intronic
1145175105 17:20693632-20693654 TCCCTGACCCCTGTGATGTGTGG - Intergenic
1145902978 17:28499989-28500011 ACCCTGTCCCCTGAGGTCCTGGG + Intronic
1146522589 17:33537725-33537747 CCCCTTTGCCCTGTGGTCCTTGG - Intronic
1146863294 17:36323525-36323547 TCCCTGCCCAGGGTGGTCCTGGG - Intronic
1147066154 17:37924113-37924135 TCCCTGCCCAGGGTGGTCCTGGG - Intergenic
1147093624 17:38127608-38127630 TCCCTGCCCAGGGTGGTCCTGGG - Intergenic
1147326540 17:39672405-39672427 TCCCTAAGGCCTGTGGTCCCTGG + Exonic
1147449558 17:40495641-40495663 TCCCTGACCCCCACTGTCCTAGG - Intronic
1147671355 17:42178645-42178667 TCCCTGACCTCTCTGGTCCTGGG - Intronic
1147675305 17:42201172-42201194 TCCCCCACCCCTGTGTTCTTGGG - Exonic
1148139677 17:45319145-45319167 CCCTTGACACCTCTGGTCCTGGG + Intergenic
1148209702 17:45800738-45800760 TCCCTGACCCCTGGGGGCTCTGG + Intronic
1148798787 17:50210454-50210476 TCCCTGCCCCCCAGGGTCCTGGG + Intergenic
1149848162 17:60019398-60019420 TCCCTGCCCAGGGTGGTCCTGGG + Intergenic
1150086514 17:62275980-62276002 TCCCTGCCCAGGGTGGTCCTGGG + Intronic
1150500529 17:65646795-65646817 GCCCTGGCCCCTGTTGTGCTGGG - Intronic
1151051726 17:70985685-70985707 TCCCTGACCCCTCTTGCACTTGG - Intergenic
1152288164 17:79424285-79424307 ACGCTCACCCCTGTGCTCCTGGG - Intronic
1152376557 17:79921594-79921616 TCCTTGACCTCTCTGGGCCTCGG + Intergenic
1152921730 17:83069288-83069310 GGCCTGACCCCTGTGCTCCTAGG + Intergenic
1153220153 18:2854061-2854083 TGCCTCACCTCTGGGGTCCTTGG - Intronic
1154961693 18:21315942-21315964 ACCCTCCCCCCTGTGGGCCTGGG + Intronic
1157896250 18:51471028-51471050 CCCATGACCCCTCTGGCCCTGGG + Intergenic
1158558230 18:58492689-58492711 TCCCTGAGTCCTCAGGTCCTGGG + Intronic
1160280988 18:77490358-77490380 TTCCTTATGCCTGTGGTCCTGGG + Intergenic
1160521476 18:79510762-79510784 TCCCTGCCCTGTGTGGCCCTGGG + Intronic
1160825862 19:1080365-1080387 ACACTCACCCCTGTGGTCCTTGG - Exonic
1160879681 19:1313713-1313735 TACCTGGCCCCTGTGTTCCCCGG + Intergenic
1161962367 19:7529810-7529832 CCACTGTCCCCTGTGGTCCTTGG + Intronic
1162737531 19:12754856-12754878 TCCCTGACCCCTTTCCTCCAGGG + Exonic
1163831660 19:19549977-19549999 TCCCTGTCCCCTGTAGTCAGGGG + Intergenic
1164804182 19:31103531-31103553 CCTCTGACCCCTCTGGTCCCAGG + Intergenic
1164880250 19:31726935-31726957 TCCCAGAAGCATGTGGTCCTGGG + Intergenic
1165372317 19:35416740-35416762 TCCTTTACCCCTGGAGTCCTGGG - Intergenic
1166102965 19:40582260-40582282 CCACTGAACCCTCTGGTCCTTGG + Intronic
1166995775 19:46719120-46719142 TCCCTGCTCCTTGTGGGCCTGGG + Intergenic
1167158567 19:47753911-47753933 TCCCTGTCTCGTGTGGTCTTGGG + Intronic
1167292479 19:48631775-48631797 TTTCTGAGCCCCGTGGTCCTTGG - Intronic
1167597567 19:50435558-50435580 TCCCTCACCCCTTTGGGCCTCGG - Intronic
925062640 2:905086-905108 TGCCTGTTCCCTGTGCTCCTGGG - Intergenic
925305969 2:2848665-2848687 TCTCTCCCCACTGTGGTCCTGGG + Intergenic
925637249 2:5952045-5952067 TCCCTGATTTCTGTGGTCTTAGG - Intergenic
926288246 2:11507802-11507824 TCCCTGAGTCCTGTGGTCTCAGG - Intergenic
927221192 2:20711594-20711616 CCCCTGACCCTTGTGTTTCTGGG - Intronic
927422978 2:22952439-22952461 TTCCTAACCTCTGTTGTCCTAGG + Intergenic
929119118 2:38469343-38469365 TCCCTGACTCCTGGGTCCCTGGG + Intergenic
931231069 2:60375365-60375387 CCCCTGACCCCTGTGGTTGGGGG + Intergenic
932746418 2:74337322-74337344 TCCTTGTCCCATCTGGTCCTGGG - Intronic
933833720 2:86230010-86230032 TCTTTGCCCCCTGTGGTCATAGG + Intronic
934939910 2:98493186-98493208 TCCCTGAGCCCTGTGTTTTTTGG + Intronic
935684051 2:105668186-105668208 TCCATTACCCCCATGGTCCTGGG + Intergenic
936032217 2:109081579-109081601 TGCCTGTCGCTTGTGGTCCTGGG + Intergenic
936161366 2:110086284-110086306 AGCCTGACCCCTGTGGCCCCTGG + Intronic
936183297 2:110285070-110285092 AGCCTGACCCCTGTGGCCCCTGG - Intergenic
936891749 2:117378636-117378658 TCCCTATCCCCAGTGATCCTGGG + Intergenic
937223666 2:120356285-120356307 TCCCTGAACCCTGGGGGACTTGG + Intergenic
937343753 2:121109679-121109701 TCCCTGAGCTCTGAGGACCTGGG + Intergenic
937356101 2:121199122-121199144 TCCCTGAACCCTGTCCTCTTGGG - Intergenic
937363087 2:121242551-121242573 TCCCTGCGCCCTGGGGCCCTGGG - Intronic
937937175 2:127255646-127255668 TACCTGAGCACTGTGATCCTAGG - Intergenic
938021453 2:127908954-127908976 TCCCTGCCCAGTGTGCTCCTTGG - Intergenic
939191481 2:138921617-138921639 TGCCTGATCCCTGTTGGCCTTGG - Intergenic
940437366 2:153670248-153670270 TCCCTGACCCCTGTGTAGCCTGG + Intergenic
941472275 2:165902935-165902957 ACCCTTACCCCTGAGGTGCTAGG - Intronic
942384976 2:175432938-175432960 GCCCTCACCACTGTGGTCATCGG - Intergenic
943479839 2:188404665-188404687 AGGCTGACCCCTGTGGCCCTAGG + Intronic
946228389 2:218276973-218276995 TCCCTGACCCCAGCTCTCCTGGG + Intronic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
947487992 2:230570104-230570126 TCCCTGAACCCTGTTGTTCAGGG + Intergenic
947719803 2:232363516-232363538 TCGCTGACCCCTCTCCTCCTGGG - Intergenic
947731375 2:232433381-232433403 TCGCTGACCCCTCTCCTCCTGGG - Intergenic
948178328 2:235961197-235961219 TCCCGGCCCCCTGTGCTCCGTGG - Intronic
948393272 2:237627425-237627447 TCCCTGGCCCCTGCAGTCCCTGG + Intergenic
948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG + Intronic
948862652 2:240760373-240760395 GTCCTGACCCCTGTGGGCCTAGG + Intronic
1170852510 20:20017602-20017624 TCCCTGGACCCTGTGGCCCCAGG - Intronic
1171013076 20:21518971-21518993 TACCTGCCCCCTGTCCTCCTGGG + Intergenic
1172045613 20:32077991-32078013 TCCCTGACAATTCTGGTCCTAGG - Intronic
1172530672 20:35629201-35629223 GCCCTGACCCCTGAGTTCCAAGG + Intronic
1173958269 20:47051618-47051640 ACCCGGACCCCAGTGTTCCTGGG + Intronic
1174600345 20:51719212-51719234 TACCTCACCCCTGTGCTTCTGGG - Intronic
1175142842 20:56873539-56873561 TCCCTGCCCTCTGGGGCCCTAGG + Intergenic
1175271045 20:57734431-57734453 TCCCTGCCCCCGTTGGTCCCTGG + Intergenic
1175468176 20:59207152-59207174 GGCCTGACCCCTGTGGCACTTGG - Intronic
1176201086 20:63860907-63860929 TCTCTGACCCCGGCCGTCCTGGG + Intergenic
1176388437 21:6151283-6151305 TCCCAGACCCCGGAGGTCCACGG + Intergenic
1179735035 21:43386965-43386987 TCCCAGACCCCGGAGGTCCACGG - Intergenic
1179917699 21:44488392-44488414 TCCCTGAGCCCTGGCGACCTTGG - Intergenic
1180098819 21:45574831-45574853 TCCCTGAACTCTGTGCTCCCTGG + Intergenic
1180989705 22:19927840-19927862 TTCCTGAACCCAGTCGTCCTCGG + Intronic
1181987544 22:26810959-26810981 CCACTGCCCTCTGTGGTCCTTGG + Intergenic
1182062257 22:27406712-27406734 TCCCTGATCCCTGGAGGCCTAGG - Intergenic
1182149888 22:28020467-28020489 CCCCTGACCCCTCTGCCCCTTGG - Intronic
1182151057 22:28027520-28027542 TCCTTGGCCCCTTTGTTCCTTGG - Intronic
1183491833 22:38120909-38120931 CCTCTGACCCCTTTGTTCCTAGG - Exonic
1183953592 22:41366557-41366579 ACGCTGGCCCCTGTGGTCCTTGG - Intergenic
1184688747 22:46108077-46108099 TCCCTGACCACTGCAGGCCTGGG + Intronic
1184693996 22:46129829-46129851 TCCCTGACTGCTCTGGTCCCTGG + Intergenic
1184715463 22:46279458-46279480 TCTCTGAGCCATGTGGTCTTAGG - Intronic
1185370763 22:50459878-50459900 TCCCTGCCCGCTGTGGGCCTGGG - Intronic
950121008 3:10482609-10482631 TCCCTGACCTGTGTGTCCCTGGG + Intronic
950143722 3:10633085-10633107 GCCCTGAGCCATGTGGGCCTGGG + Intronic
950194025 3:10996319-10996341 CCCCTGACCCCAGAGGTCTTAGG - Intronic
952284965 3:31959476-31959498 TCCTTGAACCCAGTGATCCTGGG - Intronic
954385487 3:50241800-50241822 TCCGGGACCCCTTTGGCCCTGGG + Intronic
954389865 3:50263000-50263022 TTCCAGACCCCTGTGGTGCCAGG - Intergenic
954581289 3:51704187-51704209 TCCCTGGCTCCTCTGGCCCTGGG - Exonic
954793272 3:53148214-53148236 TCCCTGCAGCCTGTGGCCCTGGG + Intergenic
955219320 3:57010737-57010759 TCCATGAACACTGGGGTCCTTGG - Intronic
957508305 3:81154951-81154973 TCCCTGACCCCTATGACCCACGG + Intergenic
958632538 3:96701464-96701486 TCCCTGAGCCCTGGTGACCTTGG - Intergenic
959479422 3:106853565-106853587 TCCCTGACCCCTGTGCCTCTTGG + Intergenic
961246673 3:125459839-125459861 TCCCTTACCTCTGTGGTGATTGG - Intronic
961264814 3:125633343-125633365 GCCCTGACCTCTGAGTTCCTGGG + Intergenic
961326355 3:126111682-126111704 TCCCTCACCCCTCTGCTCATAGG + Intronic
961639678 3:128357446-128357468 TCCCTGGCCCCTGTTGGCCATGG - Intronic
963976254 3:151483693-151483715 TCCCTGACCCTTGTGCTTCCTGG - Intergenic
965944190 3:174219794-174219816 TCCCTGACCATTTTGGTCTTTGG - Intronic
967163572 3:186760389-186760411 TCCCTGAACCCTGTCCTCTTGGG + Intergenic
967962946 3:194940021-194940043 TCCCTAACGCCTGTGGTGCCTGG - Intergenic
968057727 3:195705508-195705530 CCTCTGAGCCCTGTGGGCCTGGG - Intergenic
968451545 4:678393-678415 TCCCTGACCACTGTGCTCTGTGG + Intronic
968890001 4:3363800-3363822 TCCCTGACCCCTGGGTCCCAGGG - Intronic
968904859 4:3446432-3446454 TCTCTGACCCCTCTGGGTCTTGG + Intronic
968972299 4:3802394-3802416 TCCCTGACCCCTGGCTTTCTGGG + Intergenic
969631551 4:8341642-8341664 GCCCTAACCCCTGTGTGCCTGGG + Intergenic
970479070 4:16454623-16454645 TCTCTGCACCATGTGGTCCTAGG - Intergenic
972239874 4:37178790-37178812 TCCCTGCCCTCTGTTGTGCTTGG - Intergenic
977171489 4:93768009-93768031 CCCCAGAGCCCTGTGCTCCTGGG - Intronic
977561271 4:98536459-98536481 TCCCTGACCCCTGTGTATCTGGG - Intronic
978200639 4:106020392-106020414 TCCCAGACACCAGTGGTCCAGGG - Intergenic
978757884 4:112323993-112324015 TCCCTAAGCCCAGTGTTCCTTGG - Intronic
978994418 4:115131744-115131766 TCCCTGCCTCCTGTGGTGCTGGG - Intergenic
979674776 4:123398680-123398702 TCCCTGCCCCCTGGGGGCCGCGG + Intronic
981727680 4:147864373-147864395 TCCCTGAGCGCTGAGGTGCTGGG + Intronic
982634033 4:157869382-157869404 GCCCTGAGTCCTGTGGTTCTGGG - Intergenic
984069626 4:175094605-175094627 GCCCTGACCCCTGTAGACCAGGG + Intergenic
985655463 5:1129414-1129436 TCTCTGGCCCTTGTGGGCCTGGG - Intergenic
986434929 5:7720095-7720117 TTCCTGACCCCAGTGGTCTATGG - Intronic
987424400 5:17756384-17756406 ACCCTGACACCTCTGCTCCTGGG + Intergenic
992615179 5:78540623-78540645 TTCCTGGCACCTGTGGTCCAAGG + Intronic
993457857 5:88145386-88145408 TCCCTGACCCCCGGGGTCCCGGG - Intergenic
993475470 5:88358799-88358821 TCCCTCACTACTGTGTTCCTGGG + Intergenic
995467953 5:112470145-112470167 TCACTGGCCCCAGTGGACCTCGG + Intergenic
997212168 5:132083246-132083268 TCCCTGCCCTCTCTGGGCCTTGG - Intergenic
997655222 5:135549467-135549489 TACCTGACCCCTGCTGACCTGGG + Intergenic
998010800 5:138694225-138694247 TCTCTGAACCCTGTCCTCCTGGG + Intronic
998172302 5:139879845-139879867 TCCCAGCCCCTTGTGCTCCTTGG - Intronic
1001770068 5:174288411-174288433 TCCCTGACCCCGTTGGTCTACGG + Intergenic
1001930005 5:175666128-175666150 TGCCTGAGCCCTGAGGCCCTGGG + Intronic
1002640675 5:180629215-180629237 TCCTTGTGCCCTGTGGGCCTGGG - Intronic
1005092920 6:22078107-22078129 TCTCTGACCCCTGTTCTCCATGG - Intergenic
1005310418 6:24553771-24553793 TCCCTGAACCCTGTCGTCTTGGG - Intronic
1005500536 6:26425487-26425509 TCACTGTACCCTGTAGTCCTGGG - Intergenic
1005879611 6:30045819-30045841 TCCCTGAACCCAGTTCTCCTGGG + Intergenic
1005972589 6:30773077-30773099 TTCCTGACCCCTGAGGTGTTTGG + Intergenic
1006015606 6:31078421-31078443 CCCCTTACTCCTGTGTTCCTAGG - Intergenic
1006085599 6:31592867-31592889 TCCCTGGCAGTTGTGGTCCTTGG - Exonic
1007227730 6:40326772-40326794 TCCCAGTCCCCTATGATCCTGGG - Intergenic
1007288042 6:40762271-40762293 TCCCTGACCCCTCTTGACCTTGG - Intergenic
1007386297 6:41522487-41522509 TGCCTGACCCCTGTGTCCTTTGG + Intergenic
1007706043 6:43792033-43792055 TCCCGGCCCCCTCTTGTCCTGGG - Intergenic
1008470714 6:51881038-51881060 TTCCTGACCTCTGTGGTTATGGG - Intronic
1009623054 6:66100422-66100444 TCCCTGAGCCCTGTCCTCTTGGG + Intergenic
1010830041 6:80516132-80516154 TCCCTTACTCCTTTGGGCCTAGG - Intergenic
1010926534 6:81752288-81752310 TCCCTGACCCCGGGCCTCCTCGG + Intronic
1014452241 6:121594887-121594909 TCAGTGTCCACTGTGGTCCTTGG - Intergenic
1014487300 6:122015405-122015427 TCACTGGGCCCTGTGGTCCCGGG + Intergenic
1014974722 6:127865049-127865071 TACCTGAGCCTTGGGGTCCTGGG + Intronic
1015833755 6:137397329-137397351 TGCCTGAACTCTGTGCTCCTCGG - Intergenic
1016419074 6:143865736-143865758 TCCCTAACCCCAGTGATTCTAGG - Intronic
1017027660 6:150195836-150195858 TCCCATAGCTCTGTGGTCCTAGG - Intronic
1018101151 6:160441558-160441580 TTCCTTACACCTGTGCTCCTGGG + Intronic
1018465003 6:164035824-164035846 ACCCTGACCACTGTGGCTCTGGG - Intergenic
1018522718 6:164669096-164669118 TACTTGAGCCCTGTGGCCCTGGG - Intergenic
1019137286 6:169918219-169918241 TCTCTGAGCCCTGTGGTCTGTGG + Intergenic
1019700803 7:2474369-2474391 AGCCTGAGCCCAGTGGTCCTGGG + Intergenic
1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG + Intronic
1020461760 7:8435360-8435382 TCCTTGCCCCCTGCGCTCCTCGG - Intronic
1020874698 7:13678097-13678119 TCCCTGACCCCTGTGCTTCCTGG + Intergenic
1022477792 7:30723111-30723133 TCCCTGCCCTGTCTGGTCCTAGG - Intronic
1024564435 7:50669779-50669801 TTCCTGAACTCTGTGGCCCTGGG - Exonic
1024584251 7:50827418-50827440 TCCCCATCCCTTGTGGTCCTAGG + Intergenic
1027156184 7:75769915-75769937 TCCCTGTCCCCTCTTCTCCTGGG + Intronic
1027230553 7:76269301-76269323 TCCCTCACCCTTGGGGCCCTGGG + Intronic
1027564652 7:79776477-79776499 TCCCTGAACCCTGTCCTCTTGGG + Intergenic
1029402279 7:100353645-100353667 TCCCTGACCCTTGGGGCCCAGGG + Intronic
1029817041 7:103106930-103106952 TCCCTGACCCCTGTGTATCCTGG + Intronic
1034238547 7:149591903-149591925 ACCCTGTCCCCGGTGGGCCTGGG + Intergenic
1035110627 7:156478717-156478739 TCCCTGCCCGCTGCGGGCCTTGG + Intergenic
1035487412 7:159236931-159236953 TCCCTGCGCCCTGAGGTCCTTGG - Intergenic
1035831303 8:2697264-2697286 TTCCTGACCCCCATGGTCCCTGG + Intergenic
1036010453 8:4716001-4716023 GCCCTGGCCCCTGTGCTCTTTGG - Intronic
1039612856 8:38932918-38932940 GCCCTTACCCCTGGGGTCCCTGG + Intronic
1039662709 8:39484292-39484314 TCCCTGATCACTGTGGAACTTGG - Intergenic
1040462627 8:47663351-47663373 TCCCTGCCCTCTGTGTTTCTTGG - Intronic
1041370029 8:57149756-57149778 TCCCTGACCCCTTTGCTGGTGGG + Intergenic
1042024271 8:64405835-64405857 CCCCTGACCCCTGTGCTTCCTGG + Intergenic
1042533844 8:69839794-69839816 TCTCTGAACCCTGTCCTCCTGGG + Intergenic
1042632569 8:70835389-70835411 ACTCTGAAGCCTGTGGTCCTAGG - Intergenic
1042739479 8:72027347-72027369 TCCCTGAGCCCAGTGGTGCCAGG - Intronic
1044286752 8:90419376-90419398 TCCCTGACCCCTTTGCTGGTGGG + Intergenic
1044445026 8:92265462-92265484 TCTCTGAGCCCTGTCCTCCTGGG + Intergenic
1047635884 8:126761829-126761851 TCCCTGACTCCTCTGTTCATGGG + Intergenic
1048046794 8:130780553-130780575 TCCCTGGCCGCGGTTGTCCTGGG - Exonic
1049069447 8:140345438-140345460 TCTCTGGGCCCTGAGGTCCTGGG + Intronic
1049612674 8:143562713-143562735 TCCCTGCCCCCCGGGCTCCTGGG + Exonic
1050026060 9:1335485-1335507 CCCCTGGCCCCTGTAGTCCCTGG + Intergenic
1053463491 9:38288564-38288586 CCCCTGCACCCTGTGGGCCTGGG - Intergenic
1054347373 9:63980457-63980479 TCCCTGACCCCTGACCCCCTGGG + Intergenic
1054445101 9:65306800-65306822 TCCCTGACCCCTGACCCCCTGGG + Intergenic
1054485173 9:65714706-65714728 TCCCTGACCCCTGACCCCCTGGG - Intronic
1058281256 9:103117719-103117741 TCCCAAACCCCTGTAGGCCTAGG + Intergenic
1059726803 9:117016323-117016345 GCCCTGACACCTGTGGCTCTTGG - Intronic
1060424628 9:123494004-123494026 GCCCAGACCCCTGTTTTCCTGGG - Intronic
1060551290 9:124486588-124486610 TCCCCCACCCCTGGGGTTCTAGG + Intronic
1060656176 9:125374218-125374240 TCCCTGGAGCCTGTGCTCCTAGG + Intergenic
1061783168 9:133007733-133007755 TCCCTGACCCCTTGATTCCTTGG - Intergenic
1061913858 9:133738896-133738918 TCCCAGACCCCTCTGGTGTTTGG + Intronic
1061975585 9:134066907-134066929 TCCCTGCCCCCGGTGGGTCTCGG + Intronic
1062045768 9:134423811-134423833 TGCCTGACCCCAGTGGTCCTTGG + Intronic
1062633736 9:137478945-137478967 TCCCTGACACCTGCGCTCCTGGG - Intronic
1185617767 X:1433701-1433723 TCCCTGAACCCTGTCCTTCTGGG - Intronic
1187648605 X:21375348-21375370 TTCCTGGCCCCTTTGTTCCTGGG + Intronic
1191974561 X:66858118-66858140 TCCCTGACCCCTGTGCCTCCTGG + Intergenic
1195570282 X:106392719-106392741 TCCCTAAACCCTGAAGTCCTTGG + Intergenic
1197614602 X:128677251-128677273 TCACTGACCCCTGCGTTCCTAGG - Intergenic
1198083946 X:133265548-133265570 TCCTTGACCCCAGTGGCCCCAGG - Intergenic
1198301108 X:135334886-135334908 TCCCTCATAACTGTGGTCCTGGG - Intronic
1199950091 X:152699923-152699945 TCCCTGACATCAGTGATCCTAGG - Intronic
1199959583 X:152768538-152768560 TCCCTGACATCAGTGATCCTAGG + Intronic
1201611811 Y:15851560-15851582 TCCCTGACCCCTGTGCTTCCTGG - Intergenic
1201891689 Y:18949424-18949446 TCCCTGAACCCTGTCCTCTTGGG + Intergenic
1202125642 Y:21566758-21566780 TCCATGATCCCTGTTGGCCTAGG + Intergenic
1202153366 Y:21862634-21862656 TCCATGATCCCTGTTGGCCTAGG - Intergenic