ID: 1085272828

View in Genome Browser
Species Human (GRCh38)
Location 11:75280465-75280487
Sequence AGCACAGCCCGACCCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085272822_1085272828 4 Left 1085272822 11:75280438-75280460 CCACCAGCTATTCCAGGAGGCAG 0: 1
1: 0
2: 3
3: 20
4: 220
Right 1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 188
1085272821_1085272828 5 Left 1085272821 11:75280437-75280459 CCCACCAGCTATTCCAGGAGGCA 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 188
1085272823_1085272828 1 Left 1085272823 11:75280441-75280463 CCAGCTATTCCAGGAGGCAGACA 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 188
1085272824_1085272828 -8 Left 1085272824 11:75280450-75280472 CCAGGAGGCAGACAGAGCACAGC 0: 1
1: 0
2: 4
3: 50
4: 434
Right 1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085272828 Original CRISPR AGCACAGCCCGACCCAGGAG GGG Intronic
900426950 1:2585332-2585354 TGCACAGCCCGAGACAGTAGAGG + Intergenic
902609214 1:17587500-17587522 GGCAGAGGACGACCCAGGAGAGG + Exonic
902702637 1:18183037-18183059 AGGGCAGCCAGGCCCAGGAGGGG - Intronic
902765541 1:18612326-18612348 AGAAAAACCCGACCCTGGAGAGG + Intergenic
902814578 1:18908851-18908873 AACACAGCCAGACCAAGTAGGGG - Intronic
903712852 1:25338615-25338637 GGCGCCGCCGGACCCAGGAGAGG - Intronic
904410194 1:30320461-30320483 AGAACACCCAGAGCCAGGAGTGG - Intergenic
904585712 1:31579524-31579546 AGCCCAGCCCAAGCCAGGAGGGG - Intronic
906805100 1:48773023-48773045 ATGACAGCACGACCCAGGGGTGG - Intronic
907537604 1:55179252-55179274 AGAACAGCCAGACCCATGGGAGG - Intronic
907929000 1:58981657-58981679 AGAGCATCCCAACCCAGGAGGGG - Intergenic
911509429 1:98792757-98792779 AGCACAGTGCTACCAAGGAGAGG - Intergenic
914916846 1:151824277-151824299 CACACAGCCCCACCCAGGCGGGG - Intronic
915484589 1:156211429-156211451 AGCAGAGCCAAACCTAGGAGAGG + Exonic
916278693 1:163024108-163024130 AGCAGAGCCCCACTCAGCAGTGG + Intergenic
918376720 1:183916708-183916730 AGCAAGCCCTGACCCAGGAGCGG + Intronic
919910277 1:202106798-202106820 AGCTCAGCCAGTTCCAGGAGGGG + Intergenic
920250164 1:204618020-204618042 GGCACAGGCCAACCCAGGAAGGG - Exonic
922112694 1:222577168-222577190 AACACAGCCAGACACAGCAGTGG - Intronic
923151859 1:231240936-231240958 AGCAGAGGCCAACCCAGGACGGG + Intronic
1064393256 10:14959539-14959561 AGTAGAGCCGGACCCAGGGGTGG + Exonic
1066049172 10:31619172-31619194 AGCCCAGCCCCACCCATGAGGGG - Intergenic
1067319739 10:45206111-45206133 AGCTCAGCCCTATCCAGGATGGG - Intergenic
1067569394 10:47360431-47360453 CGCACAGGCCTACACAGGAGAGG + Intergenic
1070157156 10:73842352-73842374 AGCCCAGCTCCAGCCAGGAGGGG + Intronic
1070564574 10:77593939-77593961 AGCACAGTCCTCGCCAGGAGGGG + Intronic
1072637514 10:97187191-97187213 AGCACCTCCCGTCTCAGGAGCGG + Intronic
1074581447 10:114723202-114723224 AGCACAGGAGTACCCAGGAGAGG + Intergenic
1075407640 10:122205233-122205255 AGCACAGCCCCACCCGGTGGGGG + Intronic
1076519562 10:131073230-131073252 AGCACGAGCCGACCCAGGACAGG - Intergenic
1076685937 10:132198531-132198553 AGCACAGCCCCAGGCAGCAGTGG - Intronic
1077062955 11:625755-625777 AGCCCAGCCCCAGCCATGAGAGG - Intronic
1077178147 11:1199846-1199868 AGCACAGGTCGACTCTGGAGAGG - Intronic
1078250691 11:9614197-9614219 TGCACGGCCCTGCCCAGGAGCGG - Intergenic
1078853900 11:15190765-15190787 TGTTCAGCCTGACCCAGGAGGGG + Exonic
1078928087 11:15892235-15892257 CGCAGAGCCCGCCACAGGAGAGG + Intergenic
1079089770 11:17472712-17472734 AGTACAGCCACACACAGGAGGGG + Intronic
1081746176 11:45473949-45473971 AGTACAGCCCCTCCGAGGAGAGG - Intergenic
1084209492 11:67614509-67614531 AGGACAGCCTGCCCCAGGAGTGG + Intergenic
1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG + Intronic
1085318846 11:75562303-75562325 AGCCCAGCCCGACCCAGGTGAGG + Intronic
1089651937 11:119920278-119920300 AGAACAGCCCGTGGCAGGAGGGG - Intergenic
1091252402 11:134154620-134154642 GGTACAGCACCACCCAGGAGGGG - Intronic
1092182111 12:6453062-6453084 TGCAGAGCCCCACCCAGCAGAGG + Exonic
1092720510 12:11436027-11436049 ACCACACCCCGAAACAGGAGAGG + Intronic
1097041802 12:56160447-56160469 TGCCCAGCCCAGCCCAGGAGTGG + Intronic
1098424002 12:70338742-70338764 AGCAGAGACAGACCCAGGAATGG + Exonic
1098495967 12:71135826-71135848 TGCTCAGCCCCACCCAGCAGAGG + Intronic
1099410103 12:82314661-82314683 TGCAAAGCCAGACACAGGAGAGG + Intronic
1099447152 12:82766028-82766050 AGCAGAGCCCGGGCCAGGACTGG - Intronic
1099664493 12:85610412-85610434 AGCACAGCCTGACACAGGTCAGG - Intergenic
1101482994 12:105120267-105120289 ATCATAGCCCTACCCATGAGTGG + Intronic
1101843411 12:108343247-108343269 GGCACAGCCAGTACCAGGAGAGG - Intergenic
1101861650 12:108487052-108487074 AGAACAGCTGGACACAGGAGGGG - Intergenic
1103532476 12:121611933-121611955 AGCACAGCACATCCCATGAGAGG + Intergenic
1105978537 13:25495168-25495190 AGCCCAGCCCCACCCTGGAAGGG - Intronic
1107922176 13:45220578-45220600 GGCACAGCCCAACCAAGGAAGGG + Intronic
1113429819 13:110240388-110240410 AGCAGAGCCCGGGCCAGGACTGG - Intronic
1113947057 13:114050258-114050280 AGCACAGCAAGACCCTGAAGGGG + Intronic
1119163278 14:72471069-72471091 AGCACAGGCTGACCCAGATGGGG + Intronic
1119704359 14:76774681-76774703 TGCACAGCCCGGCCCTGCAGAGG - Intronic
1120787765 14:88552210-88552232 AGGAGAGCAGGACCCAGGAGAGG - Intronic
1121299660 14:92860587-92860609 TGCACAGCATGATCCAGGAGTGG + Intergenic
1121322698 14:93001798-93001820 AGCACAGCCAGGCCCAGCTGAGG + Intronic
1122724182 14:103739735-103739757 AGCACAGCCTGACCAAGGGAAGG + Intronic
1122824548 14:104363240-104363262 AGCTCTGCCTGGCCCAGGAGAGG + Intergenic
1126764944 15:52002424-52002446 ACCACAGTCAGAGCCAGGAGAGG - Intronic
1130890988 15:88133724-88133746 AGCACAGTGTGACCCAGGAGGGG + Intronic
1132228688 15:100165270-100165292 AGCACAGCTGGACACAGGACTGG + Intronic
1132701502 16:1224141-1224163 AGCTCAGGCAGACCCAGGTGTGG - Intronic
1133326082 16:4943235-4943257 AGCTGAGCCTGGCCCAGGAGTGG + Intronic
1134094593 16:11411182-11411204 TGCCCAGCCCGAGGCAGGAGGGG - Intronic
1135415431 16:22265094-22265116 AGCTCAGCCCCATCCTGGAGGGG + Intronic
1135539763 16:23320864-23320886 GGCCCAGCCTGACCCAAGAGAGG - Intronic
1135764322 16:25164452-25164474 AGCACAGCCCCAGTCAGGACAGG - Intronic
1137774210 16:51041984-51042006 AGCACAGCCTGTCCTAGAAGGGG - Intergenic
1141408267 16:83813504-83813526 AACACAGCAAGACCCAGGTGCGG - Exonic
1141668870 16:85480964-85480986 AGCACACGCTGTCCCAGGAGGGG - Intergenic
1141798414 16:86290185-86290207 AGCACAGCCCTGGCCATGAGGGG - Intergenic
1141810394 16:86371919-86371941 AGCACATCCTGCCTCAGGAGGGG - Intergenic
1142031021 16:87838688-87838710 AGCACAGCCCGACCCACCACAGG - Intronic
1142253652 16:89003638-89003660 AACACAGCCCGCCCCAGTCGAGG - Intergenic
1143553875 17:7648930-7648952 AGCACAGTCTACCCCAGGAGTGG - Intronic
1143628740 17:8125333-8125355 ATCATAGCCCGAGCCGGGAGAGG + Intergenic
1144638550 17:16925590-16925612 TGCACAGCTCGACCCCGGGGTGG - Intergenic
1144835328 17:18153903-18153925 AGCACAGCCGTAGCCAGGGGAGG + Intronic
1146512140 17:33459238-33459260 AGCACAGACCGACCCCGTCGTGG - Intronic
1146515673 17:33487309-33487331 AGGAAAGCCAGAGCCAGGAGGGG + Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1151329578 17:73398935-73398957 GGCACCCCCCGACCCAGGAGGGG + Intronic
1151657569 17:75502884-75502906 ATCCCAGCCCCCCCCAGGAGAGG - Exonic
1151850553 17:76687228-76687250 AGCACAGCCTGAAGCAGGAGGGG - Intronic
1152554923 17:81048406-81048428 ACCCCAGCACGGCCCAGGAGTGG + Intronic
1155531030 18:26766707-26766729 AGCACAGTCTTACCCAGAAGAGG - Intergenic
1156893535 18:42216831-42216853 ATGACAGCCCCACTCAGGAGTGG - Intergenic
1157291563 18:46413268-46413290 AGCCCAGCCCTATCCAGAAGTGG + Intronic
1159915242 18:74182530-74182552 AGCCCAGCCCGGCCCCGGGGAGG - Intergenic
1161013319 19:1970484-1970506 ATCAGACCCCGACCCGGGAGAGG - Intronic
1161249937 19:3275243-3275265 AGCCCAGCCCCACCCAGCAGGGG + Intronic
1161296293 19:3522244-3522266 TGCACAGCCCGAGGCAGGAAGGG - Intronic
1161853984 19:6753366-6753388 AACCCAGCCTGTCCCAGGAGGGG - Intronic
1165155381 19:33783943-33783965 ACCACAGCTCCACCCAGGAGTGG + Intergenic
1167217460 19:48174031-48174053 AGCAAAGCCCCATCCAAGAGGGG - Intronic
1167619100 19:50551371-50551393 AGGACAGCCCCCCCCAGGGGTGG - Intronic
925119071 2:1403459-1403481 AGCACAGCCCTCCTCAGCAGTGG + Intronic
925276027 2:2649083-2649105 AGCACAGCCTGCAGCAGGAGAGG - Intergenic
927929091 2:27032855-27032877 AGGAGAGCCCGGCCCAGGAGAGG + Intergenic
928246303 2:29631462-29631484 TGCACAACCCGTCCCAGGATGGG - Intronic
932648855 2:73533151-73533173 AGCACAGCTTGCTCCAGGAGAGG - Intronic
932672864 2:73753389-73753411 AGCAAATCCCAGCCCAGGAGGGG - Intergenic
935047699 2:99497208-99497230 ACCAGAGACCGTCCCAGGAGGGG - Intergenic
938237844 2:129721122-129721144 AGCACACCCCCACACAGCAGAGG + Intergenic
946168539 2:217879866-217879888 GGCACAGCCCCACCCAGGACTGG + Intronic
947388894 2:229620170-229620192 ATCACATTCCGGCCCAGGAGGGG - Intronic
948887203 2:240890244-240890266 AGCACAGCACGACCCTGGCCAGG - Intronic
948949080 2:241237192-241237214 CACGCAGCCCCACCCAGGAGAGG + Intronic
1168771194 20:417947-417969 AGCACCGCCGGACCCAGCGGGGG + Intronic
1171524288 20:25797204-25797226 GCCACAGCCCCACCCATGAGAGG + Intronic
1171552539 20:26058679-26058701 GCCACAGCCCCACCCATGAGAGG - Intergenic
1172680284 20:36708741-36708763 AGCACAGCCCAAGCCGGGCGCGG + Intronic
1173155433 20:40604576-40604598 AGCCCAGCCCAACCCAGGCAAGG + Intergenic
1173852698 20:46228761-46228783 AGCCCAGCCCAGCCCAGGAGGGG - Intronic
1174390553 20:50216152-50216174 AGCTCAGCCCCACCCTGGACCGG - Intergenic
1175215013 20:57387608-57387630 AGCACAGCCCCATCCAGGCAGGG - Intergenic
1175215549 20:57390241-57390263 AGCACAGGGCGACGCAGGTGGGG - Intergenic
1175935312 20:62511288-62511310 ACCACAACCTGACCCAGGAAGGG + Intergenic
1178257194 21:31065037-31065059 ACCACAGCCCCACCCAGGTGTGG + Intergenic
1179552970 21:42154963-42154985 ATCAGAGCCAGACACAGGAGGGG - Intergenic
1181484255 22:23220506-23220528 AGCCCAGCCCCACCCAGGCTTGG + Intronic
1181728950 22:24830931-24830953 ATCACAGCCCTGTCCAGGAGGGG - Intronic
1182572174 22:31247837-31247859 AACACAGCCCTGCCCTGGAGTGG + Intronic
1182681216 22:32081393-32081415 ACCCCACCCCCACCCAGGAGCGG - Intronic
1183010208 22:34940086-34940108 AGCACATCCCCAGCCAGGCGCGG - Intergenic
1183219678 22:36504543-36504565 AGGACAGACGGACCCGGGAGCGG + Exonic
1183646966 22:39132586-39132608 AGCACAGCCTGACCTCAGAGAGG + Exonic
1185269665 22:49923179-49923201 AGGACAGCCCGGCCAGGGAGCGG - Intronic
1185336124 22:50271607-50271629 AACCCAGCCCGAGCGAGGAGAGG - Intergenic
950274785 3:11650608-11650630 AGCACAGCGGAACCCAGTAGGGG - Intronic
950473934 3:13204048-13204070 CGGACAGCCCCACCCTGGAGGGG - Intergenic
950764233 3:15261454-15261476 GTCACAGCCCCAGCCAGGAGGGG - Intronic
952482972 3:33780990-33781012 AGGACTGCCTGACCCTGGAGAGG - Intergenic
953648026 3:44773416-44773438 ACCCCAGCCCCACCCAGAAGGGG + Intronic
954034021 3:47840868-47840890 AGCAGACCCCAACCCTGGAGGGG - Exonic
954380449 3:50216287-50216309 AGCCCAGCCCGAGCAAGCAGAGG + Intronic
954430430 3:50467951-50467973 ACCACAGCCGGCCCCAGGGGCGG - Intronic
955846396 3:63167621-63167643 AGCACAGCCCAGCCCAGAAGAGG - Intergenic
960668845 3:120137447-120137469 AGCCCAGCCAGACTCAGGTGGGG - Intergenic
961434421 3:126906765-126906787 AGCACAGCAGGAACCAAGAGAGG - Intronic
961518248 3:127451786-127451808 ACCACAGCAAGACCCAGAAGGGG - Intergenic
961645425 3:128390355-128390377 AGCACAGCCAGGCTCAGGAGGGG + Intronic
963253098 3:143120082-143120104 GGCACAGCGCGACCCCGCAGCGG - Exonic
964442196 3:156723482-156723504 AGCACAACCTGACCAAGAAGGGG - Intergenic
975811207 4:78171726-78171748 AGCACAGCCAGCAGCAGGAGAGG - Intronic
985060981 4:186079189-186079211 AGCTCAGGCAGCCCCAGGAGAGG + Intronic
985776918 5:1849154-1849176 AGCACACCCCAGCCCAGCAGGGG - Intergenic
987118633 5:14746102-14746124 AGCACAGGACGGCCCAGGACGGG + Intronic
990947393 5:61263265-61263287 AGGACAGTGGGACCCAGGAGCGG - Intergenic
995610933 5:113909604-113909626 GGCAGAGCCTGACCCAGGACAGG + Intergenic
996902323 5:128556569-128556591 AGAACAGCTGGACCCAGGAAGGG + Intronic
998151540 5:139760173-139760195 TGCACAGCCAGGCCCAGGACTGG - Intergenic
1000019158 5:157303841-157303863 AGCAAAACCCCACCCAGGGGAGG - Intronic
1001656706 5:173356273-173356295 AGCACAGACCGGCCCAGGCAGGG - Intergenic
1002079301 5:176728031-176728053 AGCACAGCCCCACCGAACAGAGG - Intergenic
1002928594 6:1619088-1619110 AGCCGGGCCCGACCCACGAGTGG - Intergenic
1009762818 6:68029578-68029600 AGCACAGCGCTGCCCAGGAGAGG - Intergenic
1010508519 6:76689001-76689023 ACTACAGCCCTACCCAGAAGTGG + Intergenic
1011721215 6:90158440-90158462 GGCACAGGTAGACCCAGGAGCGG + Intronic
1013012686 6:106134534-106134556 AGCCCAGGCAGAACCAGGAGAGG + Intergenic
1014223804 6:118825135-118825157 AGCAAAGCCAAGCCCAGGAGCGG + Intronic
1014599704 6:123395489-123395511 CACACAGCCCAACCCAGGACAGG - Intronic
1017756265 6:157531978-157532000 AGCACAGCTTTACCCAGGACTGG - Intronic
1018443543 6:163834691-163834713 ACCAAAGCCCGTGCCAGGAGTGG + Intergenic
1018966569 6:168494939-168494961 AGCACACCCCGGCCCAAGGGAGG - Intronic
1019864514 7:3694292-3694314 TGCACTGCCCAACCTAGGAGGGG - Intronic
1023108038 7:36782340-36782362 AGAGCAGGCAGACCCAGGAGTGG - Intergenic
1023248544 7:38233059-38233081 TGCACAGCCCCAACCAGTAGGGG + Intergenic
1023968961 7:44977824-44977846 AGGACAGGCCCACCCAGGACAGG - Intronic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1025818926 7:64945516-64945538 AGCACAGCCAGAACCAGAGGGGG - Intergenic
1026947940 7:74328124-74328146 AGCCCACCCCGACCAGGGAGGGG - Intronic
1033586899 7:142780760-142780782 AGCAGAGCCAGACCCAAGGGAGG - Intergenic
1035100136 7:156389538-156389560 AGCACCGCCCTAGCCAGCAGTGG + Intergenic
1035752997 8:2008813-2008835 AACCCAGCTCGACACAGGAGGGG + Intergenic
1036771196 8:11579278-11579300 AACACAGCCCCTCCCAGCAGTGG - Intergenic
1036808800 8:11853276-11853298 TGCACAGACCGACCTGGGAGGGG + Intronic
1037605752 8:20435790-20435812 AGCACAGCAGGAACCAGGTGTGG - Intergenic
1038319713 8:26514944-26514966 ACCACCGCCCGCCCCAGCAGGGG - Intronic
1044508672 8:93049783-93049805 AGCAATGGCCCACCCAGGAGTGG - Intergenic
1049390808 8:142369507-142369529 AGCAGAGCCAGACTGAGGAGAGG + Intronic
1049475410 8:142794911-142794933 AGCACTCACCAACCCAGGAGTGG + Intergenic
1051434693 9:17018415-17018437 AGCACATGCTGTCCCAGGAGAGG - Intergenic
1052397027 9:27950619-27950641 ACCACAGCCAGACCCAGGAATGG + Exonic
1052834276 9:33238764-33238786 AGGACAGCCCCAGCCAGGTGCGG - Intronic
1053740161 9:41128428-41128450 AGCTCAGCCCGCCCCAGGCTAGG - Exonic
1054443127 9:65284422-65284444 AGCTCAGCCCGCCCCAGGCCAGG - Exonic
1054487154 9:65737079-65737101 AGCTCAGCCCGCCCCAGGCCAGG + Exonic
1054688187 9:68302885-68302907 AGCTCAGCCCGCCCCAGGCCAGG + Exonic
1056604840 9:88077419-88077441 ATCCCAGCCAGGCCCAGGAGGGG - Intergenic
1057200451 9:93137042-93137064 AGCACATCCCAAGCCAGAAGGGG - Intergenic
1060784270 9:126437153-126437175 AGTCCAGCCCAGCCCAGGAGTGG + Intronic
1061991255 9:134159834-134159856 AGCACACCCCCTCCCCGGAGTGG - Exonic
1062452796 9:136622582-136622604 AGCACAGCCCAAGGCAGGTGAGG + Intergenic
1062570009 9:137180650-137180672 AGCACACCCCCAGCCAGGAGTGG + Intronic
1186480945 X:9895668-9895690 TGCACTCCCTGACCCAGGAGGGG + Exonic
1187376899 X:18763771-18763793 AGGACAGGCCAAACCAGGAGTGG + Intronic
1189032895 X:37467869-37467891 AGCAAATCCTGGCCCAGGAGGGG - Intronic
1190055405 X:47178536-47178558 AGCAGGGCCTGGCCCAGGAGTGG + Intronic
1199201463 X:145094935-145094957 AGCACAACACATCCCAGGAGAGG - Intergenic
1201304952 Y:12542201-12542223 TGCACTCCCTGACCCAGGAGAGG + Intergenic