ID: 1085273136

View in Genome Browser
Species Human (GRCh38)
Location 11:75282089-75282111
Sequence GATGGGTGTATGGGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085273136_1085273145 -4 Left 1085273136 11:75282089-75282111 CCAGACACTCCCATACACCCATC 0: 1
1: 0
2: 1
3: 29
4: 246
Right 1085273145 11:75282108-75282130 CATCAGACCAAGGGCCCCAGGGG 0: 1
1: 0
2: 0
3: 27
4: 187
1085273136_1085273142 -6 Left 1085273136 11:75282089-75282111 CCAGACACTCCCATACACCCATC 0: 1
1: 0
2: 1
3: 29
4: 246
Right 1085273142 11:75282106-75282128 CCCATCAGACCAAGGGCCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 207
1085273136_1085273144 -5 Left 1085273136 11:75282089-75282111 CCAGACACTCCCATACACCCATC 0: 1
1: 0
2: 1
3: 29
4: 246
Right 1085273144 11:75282107-75282129 CCATCAGACCAAGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 159
1085273136_1085273146 1 Left 1085273136 11:75282089-75282111 CCAGACACTCCCATACACCCATC 0: 1
1: 0
2: 1
3: 29
4: 246
Right 1085273146 11:75282113-75282135 GACCAAGGGCCCCAGGGGACAGG 0: 1
1: 0
2: 3
3: 35
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085273136 Original CRISPR GATGGGTGTATGGGAGTGTC TGG (reversed) Intronic
900226654 1:1536260-1536282 GAAGGGTGCATGGGAGTGGCTGG - Intronic
900836506 1:5009099-5009121 AGTGGGTGTATGGGTGTGTGTGG + Intergenic
900944212 1:5820629-5820651 GATGGGTCTTGGGGAGTGTCTGG + Intergenic
901282309 1:8048073-8048095 AGTGGGTGTTTGGCAGTGTCAGG - Intergenic
902699006 1:18158898-18158920 GTAGGGTGTGTGGGAGAGTCTGG + Intronic
903394583 1:22990031-22990053 GGTGGCTGAGTGGGAGTGTCTGG + Intergenic
903580178 1:24364964-24364986 AATGTGTGCCTGGGAGTGTCTGG - Intronic
904344959 1:29861685-29861707 GGTGGGTGCCTGGGAGTGTTTGG + Intergenic
904891489 1:33782947-33782969 GATGGGTAGATGGGAGTGAGAGG + Intronic
905204341 1:36334486-36334508 GATGGGTGTAAGGCTGAGTCAGG - Intergenic
905800138 1:40837947-40837969 GGCGGGTTTATGGGAATGTCTGG - Intronic
906510971 1:46410354-46410376 GATGTGGGGATGGGAGTGCCTGG + Intronic
906512960 1:46421863-46421885 GATGTGTGTATGTGTGTGTCAGG + Intergenic
907516400 1:54995984-54996006 GATGGGGTTATGGGAGGGGCAGG + Intergenic
907555603 1:55341405-55341427 GGTGTGTGTATGTGAGGGTCAGG + Intergenic
911761272 1:101620082-101620104 GATGTGTGTGTGGGAGAGTTGGG + Intergenic
912714601 1:111974089-111974111 GATGGGTGTATGGGAAGATGGGG - Intronic
912850449 1:113119624-113119646 GATGGGTATATAGGAGTAACTGG + Intronic
912981033 1:114372815-114372837 GATGGGTGTGTGAGATTGTCAGG + Intergenic
913233283 1:116759824-116759846 GGTGGGTATATGTGAGTGTGTGG - Intronic
913448357 1:118973752-118973774 TATGTGTGTAGGGGAGTGTTGGG - Intronic
915347398 1:155204677-155204699 GATGGGTGTATTGGAGATTGTGG + Intronic
915652673 1:157329268-157329290 GATGGGTGTGTGAGATTGTAGGG + Intergenic
916711659 1:167415957-167415979 TATGTGTGTATGGGTGTGTGTGG - Exonic
920038139 1:203078656-203078678 AATGGGTGTATGGGTGTGTGTGG + Exonic
920310639 1:205046361-205046383 GATGGGTGTGTGTGAGGGGCTGG - Intronic
922210167 1:223480186-223480208 GTCGGGTGTATGTGTGTGTCTGG + Intergenic
922761405 1:228134169-228134191 AACTGGTGTCTGGGAGTGTCAGG - Intergenic
922867392 1:228871841-228871863 GACTGGTGTCTGGCAGTGTCAGG - Intergenic
923059202 1:230455005-230455027 GAGGGGTGCTTGGGAGTGGCTGG + Intergenic
923136380 1:231123776-231123798 GCTGGGTGTGTGGGGGTGTGTGG + Intergenic
924380806 1:243462454-243462476 GATGTGTGTATGACAGTGTTAGG - Intronic
1063588991 10:7378084-7378106 GATGGGTGTGTGTGAGTGTATGG + Intronic
1063848909 10:10162344-10162366 GATGGGAGTATAGCAGTGTCTGG + Intergenic
1063942555 10:11145331-11145353 GATGGGTTTGCAGGAGTGTCAGG + Intronic
1065412500 10:25444573-25444595 GAGGAGTGTGTGGGAGTGTGCGG + Intronic
1067204983 10:44205290-44205312 GTTGGGCGTATTGGAGTGTCAGG - Intergenic
1069140310 10:64813814-64813836 TGTGAGTGTATGGGTGTGTCTGG - Intergenic
1069830164 10:71278097-71278119 GATGGGTAAATGGGAGGCTCAGG - Intronic
1073509842 10:104035923-104035945 TGTGTGTGTATGGGAGTGTATGG + Intronic
1074420455 10:113304269-113304291 GATGTGTGTATGGGTGAGACAGG + Intergenic
1075488204 10:122844864-122844886 GATGGGGTTATGGGAGTATATGG - Intronic
1075649968 10:124121032-124121054 GATGTGTGTATGGGTGTGTGTGG + Intergenic
1075649980 10:124121094-124121116 GGTGTGTGTATGGGGGTGTGTGG + Intergenic
1076901150 10:133338461-133338483 GGTGTGTGTTTGGGTGTGTCTGG - Intronic
1076901328 10:133339760-133339782 GAGGGGTGTTTGGAGGTGTCTGG - Intronic
1077340383 11:2023813-2023835 GAGGTGTGTATGTGTGTGTCTGG + Intergenic
1077891892 11:6424593-6424615 CATGGGGGTATGGGAGGGGCAGG + Intergenic
1078088941 11:8251886-8251908 TAGGTGTGTATGGGAGTGTGTGG + Intronic
1079855614 11:25599546-25599568 GATGGGGGGATTGGAGTGGCTGG + Intergenic
1084457925 11:69279068-69279090 GATGGATGGATGGGTGTGTGTGG - Intergenic
1084823415 11:71710648-71710670 GTTGGGTATACGGGATTGTCAGG - Intergenic
1085273136 11:75282089-75282111 GATGGGTGTATGGGAGTGTCTGG - Intronic
1087194343 11:95290168-95290190 GAAGACAGTATGGGAGTGTCAGG + Intergenic
1089196022 11:116694511-116694533 GATTGGGGTATGGGAGTGTGGGG - Intergenic
1089913414 11:122127000-122127022 GGTGTGTGTATGGGAGTGTGGGG + Intergenic
1090452685 11:126820637-126820659 GAAGGATGGATGGGAGGGTCTGG + Intronic
1091150797 11:133326624-133326646 GGTGGGTGTATGTGGGTGTTGGG + Intronic
1202823368 11_KI270721v1_random:79002-79024 GAGGTGTGTATGTGTGTGTCTGG + Intergenic
1091937593 12:4445858-4445880 GATGGGTGGAGGGGAGGGCCGGG - Intergenic
1093139142 12:15487562-15487584 GATGGGGGTATGGGGGTGACAGG - Intronic
1093569541 12:20651239-20651261 GATGGGTGTAGGGTAATGTCAGG - Intronic
1096756608 12:53804780-53804802 GAAGGGTGTAGGGGAATGTCTGG - Intergenic
1097159537 12:57036617-57036639 GGTGGGTGTCTGGGAGTGAGAGG - Intronic
1097266020 12:57745296-57745318 GAGGGGTGTATGGGGGTTCCGGG + Intronic
1098097685 12:66976902-66976924 GATGTGTGTATGTGAGTTTTAGG - Intergenic
1098666259 12:73167106-73167128 GATGGGTGTGTGAGATTGTGAGG + Intergenic
1099120569 12:78684970-78684992 GATGGGGGATTGGGAGTGTGAGG - Intergenic
1099784691 12:87246609-87246631 AATGTATGTTTGGGAGTGTCAGG + Intergenic
1102082732 12:110111580-110111602 GAACAGTGTATGGGAGTGTTGGG - Intergenic
1103088487 12:118080495-118080517 TATTTGTGTATGGGAGTGTTTGG + Intronic
1103885032 12:124193988-124194010 GCTGGGTGTGGGGGAGTTTCTGG + Intronic
1106057854 13:26254765-26254787 GATGGGTGAGTGTGTGTGTCTGG + Exonic
1106668973 13:31884661-31884683 GATGTGTGTAAGGGAGTCTGAGG - Intergenic
1107754976 13:43611244-43611266 GATGGGTATATGTGTATGTCTGG - Intronic
1108753114 13:53468909-53468931 GCTGGGTGACTGGCAGTGTCAGG - Intergenic
1110619918 13:77584068-77584090 GATGGGTGAAGGGGAGAGCCAGG + Intronic
1112404924 13:99110831-99110853 GATGGCTGAATGGGAGTGAGAGG - Intergenic
1117288638 14:54311212-54311234 GTTGGTTGCATGGGAGTGTATGG - Intergenic
1120619370 14:86745115-86745137 GATGGGTTGATGGGTGTGGCAGG - Intergenic
1121304705 14:92898810-92898832 GATGGGTGTATGGTGGGGTGGGG + Intergenic
1122433913 14:101679270-101679292 GGTGGGTGTATGAGATTGTAAGG - Intergenic
1122842306 14:104472445-104472467 GATGGGGGAATGGGTGTGTGAGG - Intergenic
1122924161 14:104892116-104892138 GATGGGTGGTTGGCAGTGACAGG + Intronic
1122954178 14:105062168-105062190 GATGGGTGGACGGGGGTGTCAGG - Intronic
1123109955 14:105862251-105862273 GATGGCTGCATGGGGGTCTCCGG - Intergenic
1125783148 15:42289643-42289665 GATGGGAGTATGAGATTGGCTGG + Intronic
1128144921 15:65327803-65327825 GATGGGTGTGTGGGAGGGTGAGG - Exonic
1129291421 15:74571007-74571029 GATGTGTGTATGGAAGTGCTTGG - Intronic
1129358980 15:75012611-75012633 GATGGGCGTCTTGGATTGTCGGG + Intronic
1130809824 15:87365187-87365209 GATGGCTGCATGGAAGTGTGAGG - Intergenic
1132793939 16:1709240-1709262 GCTGAGTGTATGAGAGTGACAGG + Intronic
1133828687 16:9301972-9301994 GTTGGGTGTAGGGGAGTCACAGG - Intergenic
1133972408 16:10577696-10577718 GAGGGGTGTGTGTGTGTGTCCGG - Intronic
1133994782 16:10740145-10740167 GATGGGTGGATCTGTGTGTCTGG + Intergenic
1134389818 16:13808948-13808970 GAAGGGTCAATGGCAGTGTCGGG + Intergenic
1135132164 16:19862057-19862079 GTTGGGTGGATGGGGGTGCCCGG - Intronic
1135933172 16:26756861-26756883 GATGGATGTATGTGTGTGTGGGG + Intergenic
1136068299 16:27773248-27773270 GAAGGGAGCATGGGAGGGTCGGG + Intronic
1136470217 16:30474564-30474586 CAGGGGAGTAAGGGAGTGTCAGG - Intronic
1136582487 16:31161521-31161543 GCTGGGTGTTTGGTAGTGGCAGG + Intergenic
1137918282 16:52456507-52456529 GGTGGGGGTAGGGGAGTGCCTGG + Intronic
1139949605 16:70662677-70662699 GGTGTGTGTCTGGGAGTGCCTGG - Exonic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1144281766 17:13733791-13733813 AAAGGGTGTATGGAAGTGCCTGG + Intergenic
1144693651 17:17286326-17286348 GATGGGGGTATAGGAAGGTCAGG + Intergenic
1145293411 17:21568507-21568529 GATGGGTGCATGAGATTGTAAGG - Intronic
1145386564 17:22417424-22417446 GATGGGTGCATGAGATTGTAAGG + Intergenic
1146673213 17:34756236-34756258 GATGTGGGTGTGGGGGTGTCTGG - Intergenic
1146946904 17:36879640-36879662 GCAGGGTGTATGGGAGTGTGCGG + Intergenic
1148603746 17:48912909-48912931 GGTGGGTGGATGGGATAGTCGGG - Exonic
1149109139 17:53005873-53005895 GATGGATGTATGGCAGTGTTTGG + Intergenic
1150323782 17:64238985-64239007 GAGGGGTGTCTTGAAGTGTCTGG - Intronic
1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG + Intronic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152615587 17:81336406-81336428 GATGGGTGGATGGGTGGGTGGGG - Intergenic
1152882725 17:82828969-82828991 GGTGGGTATATGGGATTGTGTGG - Intronic
1158293502 18:55968682-55968704 GGTGTGTGTATGGGAGTGGTGGG + Intergenic
1159552653 18:69911541-69911563 GATGGGTGAAGTGGAGTGCCTGG - Intronic
1160042932 18:75361899-75361921 GATGAGTGTCTGAGTGTGTCTGG + Intergenic
1160118144 18:76101063-76101085 TATGTGTGTATGTGAGTGTGTGG + Intergenic
1160534720 18:79585832-79585854 GCTGGGTGTGTGGGAGTGTACGG - Intergenic
1160970108 19:1764257-1764279 GGTGGGGGCATGGGGGTGTCAGG - Intronic
1161396079 19:4045607-4045629 GAAGGGGGTATGGGGGGGTCGGG + Exonic
1161473720 19:4473406-4473428 GCAGGGTGTCTGGGAGGGTCTGG + Intronic
1161764399 19:6198606-6198628 GCTGGGTGTATGGGGGTTTGGGG + Intronic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1164482117 19:28619802-28619824 GATGGGAGTATGGGAGGATAAGG - Intergenic
1166760995 19:45224480-45224502 GATGGGTGTATGGGGCTCTGGGG + Intronic
1166907054 19:46118712-46118734 CAGGGGTGCATGGGAGTGCCTGG - Intergenic
1167472345 19:49682276-49682298 GATGGGTTTGTGGGAGTGGAGGG + Intronic
1167719151 19:51166949-51166971 GTAGGGTCTATGGGAGTGTCTGG - Intergenic
1167772956 19:51532071-51532093 GTAGGGTCTGTGGGAGTGTCTGG + Intergenic
924991864 2:319352-319374 GATGTGTGTGTGGGTGTGTGTGG + Intergenic
925009434 2:471037-471059 CCTGGGTGAATGGGAGTTTCAGG - Intergenic
925714562 2:6772470-6772492 GATGGGAGGATGGGCGTGTGTGG + Intergenic
925999331 2:9317624-9317646 AATGTGTGTATGGGTGTGTGTGG - Intronic
926084949 2:10014433-10014455 GGTGTGTGTATGGGTGAGTCAGG + Intergenic
926085053 2:10014945-10014967 GGTGTGTGTATGGGTGAGTCAGG + Intergenic
926085064 2:10015015-10015037 GGTGTGTGTATGGGTGAGTCAGG + Intergenic
926845631 2:17134965-17134987 GATGTCTGTGTGGGAGTGTTGGG + Intergenic
927665543 2:25029731-25029753 AATGAGTGTCTGGTAGTGTCTGG + Intergenic
929253056 2:39780153-39780175 GGGGTGTGTGTGGGAGTGTCGGG - Intergenic
931608529 2:64075688-64075710 GAATGGTGAATAGGAGTGTCAGG + Intergenic
932478248 2:72022583-72022605 GATGGGTATATGGGATTGGGGGG + Intergenic
934584067 2:95474208-95474230 GTGGGGTGTATGGGTGTGTTAGG - Intergenic
934595385 2:95602506-95602528 GTGGGGTGTATGGGTGTGTTAGG + Intergenic
934787386 2:97023028-97023050 GTGGGGTGTATGGGTGTGTTAGG - Intergenic
934856892 2:97735173-97735195 GATGGGTGGGTGGGGGTGTGGGG + Intronic
935111221 2:100096072-100096094 GTTGGGGGGATGGGAGTGTTGGG - Intronic
936720777 2:115250434-115250456 GATGTGTGAATGGAAGGGTCTGG + Intronic
937310083 2:120896675-120896697 TATGGGTGTGTGTGAGTGTGTGG - Intronic
937380353 2:121371056-121371078 TATGTGTGTAGGGGAGTGTGTGG - Intronic
937977083 2:127588830-127588852 GATGGGTGGATGGGTGTGTGAGG + Intronic
938553747 2:132404199-132404221 GATGGGGGGGTGGGAGTGGCAGG + Intergenic
939141244 2:138357306-138357328 GATGGATGAATGGGTGAGTCAGG + Intergenic
941337946 2:164268229-164268251 CAAGGGTGTATGGAAATGTCTGG + Intergenic
944736970 2:202575853-202575875 GATGGGTGTGGTGGTGTGTCCGG - Intergenic
945047742 2:205796907-205796929 GAAGGGTGAATGGGACTGGCTGG + Exonic
948046517 2:234950444-234950466 GATTGGTGTAGGGATGTGTCTGG - Intergenic
1169188655 20:3642622-3642644 GATGGGTGAATGGCAGAGGCAGG - Intronic
1170644855 20:18188857-18188879 GATTGTTGTATGTGAATGTCAGG + Intergenic
1171131205 20:22654401-22654423 TATGTGTGTATGGGTGTGTGTGG - Intergenic
1172878553 20:38181520-38181542 GATGGGTGCACGGGAGGGGCAGG + Intergenic
1173865427 20:46309479-46309501 GGTGGGTCTATGGGAGTCACTGG - Intergenic
1174265612 20:49329528-49329550 AATGGCTGGATGGGAGTGGCTGG - Intergenic
1175121375 20:56718538-56718560 GATGGGTGTTTGTGGGTGTGAGG + Intergenic
1176389691 21:6157174-6157196 GGTGGGTGTTTGGGGGTTTCCGG - Intergenic
1177293360 21:19143931-19143953 GAGGAGTGTATGTGTGTGTCTGG + Intergenic
1179270800 21:39849611-39849633 CATGGATGTATCGGGGTGTCTGG - Intergenic
1179274239 21:39877315-39877337 GATGGGAGGCTGGGGGTGTCAGG - Intronic
1179733777 21:43381064-43381086 GGTGGGTGTTTGGGGGTTTCCGG + Intergenic
1179998315 21:44984137-44984159 GGGGGGTGTATGGGGGTGTATGG - Intergenic
1181788788 22:25246977-25246999 CATGCGTGTATGCGAGTGTATGG - Intergenic
1182116487 22:27759472-27759494 GATGCGTGTCTGGGAGGGTTGGG - Intronic
1182564600 22:31188113-31188135 GATGAGGGTCTGGGAGTGTTAGG + Intronic
1184011000 22:41748356-41748378 GATGAGTGAAAGGAAGTGTCAGG + Intronic
1184410428 22:44323064-44323086 GATGGGTGGATGGGTGGGTGAGG - Intergenic
1184852283 22:47127918-47127940 GATGGGTGGGTGGGAGAGGCCGG - Intronic
1185119341 22:48956549-48956571 GATGTGTGTATGTGTGTGTGTGG - Intergenic
950137102 3:10589183-10589205 GATGGGCAAATGGGAGTGGCTGG - Intronic
950443741 3:13024343-13024365 GATGGGTGTATGTGCGGGTGAGG - Intronic
950756178 3:15174674-15174696 GCTGGGTGTATGGGAGGGAAAGG - Intergenic
956657535 3:71566899-71566921 GATGGGTGTGTGTGTGTTTCAGG - Intronic
957063629 3:75502800-75502822 GTTGAGTATATGGGATTGTCAGG + Intergenic
957423443 3:80003040-80003062 GATGGTTACATGGGAGTATCGGG + Intergenic
957994877 3:87676792-87676814 GCTGGGAATAAGGGAGTGTCAGG - Intergenic
959157648 3:102685991-102686013 GAGGGGAGTCTGGCAGTGTCAGG - Intergenic
960814614 3:121659890-121659912 AATGGGTGAATGGGAGAGTCAGG - Intronic
961789841 3:129367752-129367774 GATGGGGGACTGAGAGTGTCAGG - Intergenic
961808112 3:129503569-129503591 GATGGGTGGGTGGGTGAGTCGGG - Intronic
961827084 3:129604880-129604902 GATGGGTGCATGGGTGTGGCAGG - Intronic
962302455 3:134254210-134254232 GATGGGTAGATGGGAGCGTGGGG + Intergenic
963019982 3:140863631-140863653 AATGGGTGTGTGGGAGAGTGTGG + Intergenic
963441175 3:145342567-145342589 GATGGATTTATGGGAGTTTTAGG - Intergenic
967889105 3:194352328-194352350 AGTGGGTGTAGGGGAGTGTTTGG + Intergenic
967889126 3:194352469-194352491 AGTGGGTGTAGGGGAGTGTTTGG + Intergenic
967889141 3:194352539-194352561 AATGGGTGTAGGGGTGTGTGTGG + Intergenic
969007535 4:4033000-4033022 GTTGAGTGTACGGGATTGTCAGG + Intergenic
969448070 4:7256740-7256762 GTTGGGACTATGGGGGTGTCGGG + Intronic
969575578 4:8034358-8034380 GATGGGTGCAGGGGGGTGTGTGG + Intronic
969599217 4:8166228-8166250 GATGGATGGATGGGAGTGGATGG - Intergenic
970904025 4:21194315-21194337 GTAGGGTGTATGGAAGTGGCAGG - Intronic
972839874 4:42918138-42918160 GTTTGGTGTCTGGTAGTGTCTGG + Intronic
973529342 4:51819252-51819274 GATGGAAGCAGGGGAGTGTCCGG + Intergenic
974444448 4:61961278-61961300 GATCGGTGTTTGCAAGTGTCTGG - Intronic
976795812 4:88931147-88931169 CATGGGTGCATGGGAGTGCTTGG + Intronic
977234239 4:94487809-94487831 AAAGGGTGTATAGGAGTCTCTGG + Intronic
984593077 4:181637920-181637942 GATGGGTGCATAGGAATGACAGG + Intergenic
985635269 5:1032816-1032838 GATAGGAGTGTGGGACTGTCCGG - Intronic
987018315 5:13843806-13843828 CCTGGTTGTATGGGGGTGTCCGG - Intronic
987040803 5:14060605-14060627 GATGGGCCTATGGGAGAGGCAGG + Intergenic
987310387 5:16676085-16676107 GATGGGTGTATCGAAGGATCGGG + Exonic
988932897 5:36054366-36054388 GAGGGGTGTATATGAATGTCTGG - Intronic
990799073 5:59579046-59579068 GAGTGGTTTAAGGGAGTGTCTGG - Intronic
995465099 5:112443465-112443487 GATGGGTGTGTGTGTGTTTCAGG - Intergenic
996183369 5:120448283-120448305 GAGGGGTGGATATGAGTGTCTGG + Intergenic
996705474 5:126493310-126493332 GAGGGGTGTAAGGGAGAGGCAGG - Exonic
1000367417 5:160504672-160504694 GAGGGGTGTATGTGTGTGTGAGG + Intergenic
1001214728 5:169845200-169845222 GGTGGGTGAATGGAAGTGGCAGG - Intronic
1001778071 5:174344055-174344077 AGTGAGTGTCTGGGAGTGTCCGG - Intergenic
1001960275 5:175876137-175876159 TATGTGTGTATGTGAGTGTGGGG - Intronic
1002346040 5:178547890-178547912 GATGTGTGTATGGGTGGGTGTGG - Intronic
1004188359 6:13441957-13441979 GGTGTGTGTGTGGGTGTGTCTGG - Intronic
1007644988 6:43372822-43372844 GATGGGGGAATGGGAGTACCTGG + Intergenic
1013489252 6:110629340-110629362 GGTGTGTTTATGGGTGTGTCAGG - Intronic
1013963542 6:115928730-115928752 GATGGGAGTGTGGGAGTGAGGGG - Intergenic
1015115881 6:129649068-129649090 GATGGTTGCATGGGTGTGTGTGG - Intronic
1016632846 6:146252020-146252042 GAGGGATGTAAGGAAGTGTCAGG - Intronic
1019160711 6:170065879-170065901 GATGGGGGTATGGGGGTGGATGG - Intergenic
1019206413 6:170365689-170365711 GAGGGGTGTGTGTGTGTGTCAGG - Intronic
1019903257 7:4041158-4041180 GAGGGGTCCATGGGGGTGTCAGG + Intronic
1020593427 7:10172019-10172041 AATGGTTTTATGGGAGTGTGGGG - Intergenic
1021024256 7:15644076-15644098 CTTGGGTGCATGAGAGTGTCTGG + Intronic
1022985741 7:35651549-35651571 GATGGGTCTATGGTGGTGTTCGG - Intronic
1023706454 7:42946455-42946477 CATGGGTGTATGTGTGTGTTGGG + Intronic
1024182396 7:46909225-46909247 GAAGACTGTATGGGGGTGTCAGG + Intergenic
1024821880 7:53340940-53340962 GATGGGTGCATGAGATTGTAAGG + Intergenic
1027359492 7:77393522-77393544 TATGTGTGTATGGGAGGGGCAGG - Intronic
1031816092 7:126437820-126437842 GATGGATGTCTGGGATTGTATGG + Intergenic
1032242793 7:130177983-130178005 AGAGGGTGTATGGGGGTGTCAGG + Intronic
1033081378 7:138301596-138301618 GATGGGAGAATAGGAGTTTCTGG - Intergenic
1035111400 7:156485233-156485255 GAGGGCTGTAAGTGAGTGTCAGG + Intergenic
1036614393 8:10377493-10377515 GATGGGTGGATGGGAGAGCCGGG + Intronic
1036753073 8:11455421-11455443 GCTGGGTGTGTGTGAGTGTGGGG + Intronic
1037319414 8:17629590-17629612 GATGAATGCATGGGAGTGACAGG - Intronic
1037589582 8:20302023-20302045 GCTGGGTGGATGTGAGTGTGGGG - Intronic
1038295404 8:26287539-26287561 GCGGGGTGTGTGGGAGTGTTGGG + Intergenic
1038479538 8:27892396-27892418 GATGGGTGCATGGGATTCACAGG - Intronic
1043882622 8:85562491-85562513 GTTGGGTGGATGAGAGGGTCAGG + Intergenic
1044070702 8:87756513-87756535 GCATGGTGTAAGGGAGTGTCTGG - Intergenic
1048201867 8:132381352-132381374 GGTGAGTGTATGGAAGTGTCTGG - Intronic
1048882524 8:138882602-138882624 GAAGAGTGTGTGGGAGTGTGAGG - Intronic
1049166651 8:141129819-141129841 GATGAATGTCTGTGAGTGTCCGG + Intronic
1049270431 8:141692870-141692892 GATGCGTGTTTGGGAGGCTCAGG + Intergenic
1049828433 8:144685192-144685214 GAGGGGAGTGTGGGTGTGTCCGG - Intergenic
1057334205 9:94143141-94143163 GAAGGGTATGTGGGAGTGTCTGG - Intergenic
1059224142 9:112655973-112655995 GCATGGTGTAAGGGAGTGTCTGG + Intronic
1059802457 9:117763982-117764004 GATGGGGGTAGGGGAGTGTCAGG - Intergenic
1060389569 9:123267535-123267557 GAGGGGTGTGAGGGAGTGTGTGG - Intronic
1060907542 9:127320941-127320963 GATGGGTCTATGGTAGGGCCTGG + Intronic
1061259651 9:129472807-129472829 GATGGGGGGATGGGGGTGACAGG + Intergenic
1061383736 9:130276118-130276140 GGTGGGTGGGTGGGTGTGTCAGG + Intergenic
1062286312 9:135774142-135774164 GATGTGTGTCTGGGTGTGTGTGG + Intronic
1185755554 X:2650432-2650454 GATGGGTGGATGTGGGTGGCTGG + Intergenic
1187858120 X:23656584-23656606 GATGGGTGAGTGGGAGTGTAGGG - Intergenic
1188373059 X:29392609-29392631 GATGAGTGTCTGGTAATGTCTGG - Intronic
1189497912 X:41526236-41526258 GATGGGTATATGTGTGTGACCGG - Intronic
1189958038 X:46296271-46296293 GAGAGGTGAATGGGAGTGGCAGG + Intergenic
1190332895 X:49246948-49246970 GATGTGTGGATGGGCGTGGCAGG + Intronic
1190482286 X:50889557-50889579 GGTGGGTGTAGGGGGATGTCAGG - Intergenic
1190709237 X:53054530-53054552 CATGGGTGTATGGGTGTTTCTGG + Intronic
1192178951 X:68903377-68903399 GGTGGGTGTGTGTGAGTGTAGGG + Intergenic
1192602452 X:72479152-72479174 GCTAGGTGTATGGCAATGTCAGG + Intronic
1193218476 X:78894116-78894138 GATGGTTGTATGTGTGTGTGTGG + Intergenic
1198317825 X:135487211-135487233 GGTGTGTGTGTGGGAGTGTGTGG - Intergenic
1199401472 X:147404489-147404511 GATGGGTGGAAGGGAGTGCTGGG - Intergenic