ID: 1085273143

View in Genome Browser
Species Human (GRCh38)
Location 11:75282107-75282129
Sequence CCCTGGGGCCCTTGGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085273143 Original CRISPR CCCTGGGGCCCTTGGTCTGA TGG (reversed) Intronic
900438029 1:2640735-2640757 TCCTGGGGCCCTTGGGGAGATGG - Intronic
900570409 1:3355478-3355500 CCCTGGGGAGCTAGGTCTCAGGG + Intronic
901186392 1:7376020-7376042 CTCAGGGGCTCTTAGTCTGAGGG - Intronic
901574628 1:10190972-10190994 ACCTGGGGCCCGTGGGCTGCAGG + Intergenic
903678958 1:25084184-25084206 CCCTGGGGCCCTGGGCCTTGAGG - Intergenic
904559196 1:31385458-31385480 CCCTGGGTCACTTGGGCTGGGGG + Intergenic
905233453 1:36529810-36529832 CCCTGGGAGCCCTAGTCTGAGGG - Intergenic
905956566 1:42002261-42002283 CACTGGGGCCTCTGTTCTGAAGG - Intronic
906746908 1:48228519-48228541 CCCTGAGGCCATGGGTCTGAGGG - Intronic
912452118 1:109773629-109773651 CCCAGGGGCTCTGGCTCTGATGG - Intronic
915145524 1:153794083-153794105 CCTGGGGGCCCTTGGGCTGTGGG - Intergenic
915487462 1:156231807-156231829 CCATGGGGGCCCTGGCCTGAGGG - Intronic
915507171 1:156365282-156365304 CACTGGGGCTGCTGGTCTGATGG + Intronic
916261988 1:162851394-162851416 CCCTGGTACTCTTGGTGTGAGGG + Intronic
916644682 1:166770938-166770960 CTCTGGAGCCCTTGGGCAGATGG - Intergenic
920202546 1:204268425-204268447 ACCTGGGCCCCTTGGTGTGAGGG - Intronic
920300077 1:204983153-204983175 CCCTGCGGCCCACGCTCTGATGG + Intronic
920366570 1:205451057-205451079 CCTTGGGCCCCTTGGGCTGCTGG - Intronic
922338804 1:224639126-224639148 CCCTGGGGTCCTTGCTGGGAGGG - Intronic
1062834767 10:628528-628550 CCCTGGGAGCCTCGCTCTGATGG + Intronic
1062878120 10:958186-958208 CCCCGCAGCCCTTGGGCTGAAGG + Intergenic
1067700496 10:48568108-48568130 CTCTGGGGACCTTGGGCTGCTGG + Intronic
1068338319 10:55667316-55667338 CCCTGGGGCTGGTGGTCTGGGGG + Intergenic
1072659848 10:97357077-97357099 CCCAGGGGCCCTGGGCCTCAGGG + Exonic
1073323542 10:102629720-102629742 CCCTGAGGCCCTGGGGCTGGAGG - Intronic
1073471418 10:103724812-103724834 CCCTGGAACCCTGGGTCTTAGGG + Intronic
1075542565 10:123327790-123327812 CCCTGGCTCTTTTGGTCTGAAGG + Intergenic
1075718417 10:124570369-124570391 CCCAGGGGCCTTTGGAATGAAGG + Intronic
1075907042 10:126090486-126090508 GCTTGGAGCCCTTGGTCTTAGGG - Intronic
1076246334 10:128950248-128950270 CCCTGGGGGCCCAGGTCTGCAGG - Intergenic
1076451941 10:130562043-130562065 TCCTGGGGTCCTTGTTCTGGAGG + Intergenic
1076480125 10:130779454-130779476 CCCCGTGGTCCTTGGGCTGAGGG + Intergenic
1076664118 10:132076579-132076601 CTGTGGGGCCCCAGGTCTGACGG + Intergenic
1076946015 10:133651113-133651135 ACCTGGGGCTCTTGGCCTCACGG - Intergenic
1077169718 11:1160756-1160778 CCCTAGGGCCACTGGTCTTAGGG + Intronic
1077323283 11:1952014-1952036 CCCTGTGGGTCTTGGTCTGTCGG + Intronic
1077351388 11:2094791-2094813 CCCTGGGGCCCCTGGGTGGATGG + Intergenic
1079884238 11:25966281-25966303 ACCTGGGGTTCTTGGTCTCACGG + Intergenic
1081692570 11:45088267-45088289 CCCTGGGCCACTTGGTGGGAAGG - Intergenic
1083614836 11:64021249-64021271 CCCTGGGGCCCTTGGGAGGCAGG + Intronic
1084416129 11:69033886-69033908 GCCTGGGGCTCATCGTCTGAGGG + Intergenic
1085273143 11:75282107-75282129 CCCTGGGGCCCTTGGTCTGATGG - Intronic
1085274988 11:75292633-75292655 CTCGGGAGCCCATGGTCTGAAGG + Intronic
1085308371 11:75501183-75501205 CCTGGGGGCCTGTGGTCTGAGGG - Intronic
1086319579 11:85630745-85630767 CACTGGGCTCCTTGGTCGGAAGG - Intronic
1090508492 11:127345680-127345702 CCCTGGAGAGCTTGTTCTGACGG + Intergenic
1091134561 11:133177065-133177087 CCCTTGGACCATTGCTCTGAAGG - Intronic
1091221312 11:133931421-133931443 CCCTGGAGCCCTGGGTCTGCAGG - Intronic
1202806271 11_KI270721v1_random:7209-7231 CCCTGTGGGTCTTGGTCTGTCGG + Intergenic
1092247624 12:6872457-6872479 CTCCGGGCCCCTTGCTCTGATGG + Exonic
1095983277 12:47984545-47984567 GCCTGGTGCTCCTGGTCTGAGGG - Exonic
1096847920 12:54418268-54418290 CACTGGGGCCCTGGGGCTGGGGG - Intronic
1100827820 12:98491255-98491277 CCCTGAGTCCCTTTGTCTCAAGG - Intronic
1101986357 12:109450553-109450575 CCCTGGGGCTGGTGGTGTGAGGG + Exonic
1101998608 12:109542687-109542709 CCCTGCGTTCCTTGGCCTGAAGG - Intergenic
1103191921 12:119008859-119008881 GCCTGGGGCCCTTGTTCCTAGGG + Intronic
1103524914 12:121561133-121561155 CCCTGTGGCCCCTGCTTTGAAGG + Intronic
1103896749 12:124278183-124278205 CCCTGGGGCCCTGAGTCTAGGGG - Intronic
1104371668 12:128228898-128228920 TCCTGGTTCACTTGGTCTGAGGG - Intergenic
1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG + Intronic
1105899018 13:24741043-24741065 GCCTGGGTCCCTGGGCCTGAAGG + Intergenic
1111497517 13:89071425-89071447 CCCTGGGGCTCTTTTCCTGAGGG - Intergenic
1114449869 14:22818461-22818483 CCCTGAGACCCTGGGTCTTAGGG + Intronic
1118586619 14:67359578-67359600 CACTGTGGCCCAGGGTCTGAAGG + Intronic
1119728253 14:76935351-76935373 CCCTTGGGCCACTGGGCTGAGGG - Intergenic
1119745047 14:77038205-77038227 CCTTGGGGCGCGTGGTCTGGGGG - Intergenic
1121098465 14:91233892-91233914 CCCTGAGGCCCGTGGGCTGAAGG + Exonic
1121201460 14:92121666-92121688 CCCTGTTGCCCTTGGTCTCGGGG - Exonic
1121651362 14:95561321-95561343 CCCTCGGGCCCTTGAAATGATGG - Intergenic
1121803500 14:96795083-96795105 CCCTGGCACCCTTGATCTGATGG - Intergenic
1122005302 14:98698533-98698555 GCATGGGGTCCTTGCTCTGATGG + Intergenic
1122410630 14:101524237-101524259 TCATGGGGCTCTGGGTCTGATGG - Intergenic
1202924803 14_KI270724v1_random:13934-13956 ACCTGGGGCTCTTGGCCTCACGG + Intergenic
1124363533 15:29055328-29055350 GCCCGGGGGCCTTGGCCTGATGG + Intronic
1128055662 15:64698121-64698143 CCCAGGGGCCCTTTCTCAGATGG - Intronic
1128084685 15:64877704-64877726 GCCTGTGGCCTTGGGTCTGAAGG + Intronic
1129607767 15:77033131-77033153 GTCTGGGTCCCTTGGGCTGAGGG - Intronic
1131265627 15:90913577-90913599 CCCGGGTGCCCTTGATCTGCTGG + Intronic
1132375743 15:101327156-101327178 CCTTGGAGCCCTTGGTGGGACGG + Intronic
1132621075 16:868561-868583 CCCTGGGGCTCCTGGAGTGAGGG + Intronic
1133267737 16:4594836-4594858 GCCTGGGGCCCTGGTTCTGCTGG + Intronic
1134266858 16:12700369-12700391 CTCTGTGGCCTTTGGTCTTAGGG - Intronic
1134875821 16:17697723-17697745 CCCTTTGGCCCTCTGTCTGAAGG - Intergenic
1136153392 16:28366473-28366495 CGCTGAGGTCCTTGGTCTGCAGG - Intergenic
1136209694 16:28748794-28748816 CGCTGAGGTCCTTGGTCTGCAGG + Intergenic
1137389214 16:48067520-48067542 CACTGAGGCCCTTGTTCTGAGGG + Intergenic
1137903047 16:52289951-52289973 CCATGGTGTCCTTGCTCTGATGG + Intergenic
1140122184 16:72093478-72093500 CCCTGGGTGACTTGGTCTTAGGG - Exonic
1140480152 16:75258017-75258039 CCCTGGGGCCATCAGACTGATGG + Intronic
1141233404 16:82192757-82192779 CCTTGTGGCCCTTGGGGTGATGG + Intergenic
1141279459 16:82617914-82617936 CCCCTGGGCCCTTGGTCTTATGG + Intergenic
1141973336 16:87496983-87497005 TCGTGGGGTCCTAGGTCTGAAGG - Intergenic
1142119863 16:88381999-88382021 CCCGGGGGACCTTTGTCTGAAGG + Intergenic
1142142997 16:88480797-88480819 CCCTGGGGCCCACAGTCTGGGGG + Intronic
1142264726 16:89058463-89058485 CCCTGGGGGCCTGGGTCCCAGGG - Intergenic
1142622781 17:1175585-1175607 GCCAGGGGCCCTGGGGCTGATGG - Intronic
1142979020 17:3660860-3660882 CCATGGGGCTCTTTCTCTGAAGG + Exonic
1143026449 17:3944492-3944514 CCCTGGGGCTCTTGGTCTGTGGG - Intronic
1143954059 17:10655177-10655199 TCCTGGGGCCCTGACTCTGAGGG - Intronic
1144513256 17:15895775-15895797 CATTCGGGCCCTTGGTCTTAGGG + Intergenic
1145279191 17:21455833-21455855 ACCTGGGGGGCTGGGTCTGAGGG + Intergenic
1145398666 17:22514614-22514636 ACCTGGGGGGCTGGGTCTGAGGG - Intergenic
1147331227 17:39700463-39700485 CCCTGGGGCCCTCGGGCGGGAGG + Intronic
1147690602 17:42312515-42312537 CGCTGGGGCCCTTGGGCTCAGGG + Intergenic
1147864801 17:43545400-43545422 CCCTGAGGCGCTTAGTCTGGGGG + Intronic
1147893962 17:43738254-43738276 CCCTGTGGCCCTTGTGCTCAAGG + Intergenic
1148850986 17:50555249-50555271 CCTTGGTGTCCTTGGCCTGACGG - Exonic
1151015868 17:70552066-70552088 ACCTGGGGCACTAAGTCTGAAGG + Intergenic
1151584615 17:75001548-75001570 CACAGGGGCCCATGGACTGATGG + Intronic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152780776 17:82226623-82226645 CCCTGGAGCCCTGTGTCAGATGG + Intergenic
1152821384 17:82439478-82439500 CCCTGGGCCCCATGGGTTGAGGG + Intronic
1154324884 18:13382831-13382853 CCCTGGGCCTCTTGCCCTGAAGG - Intronic
1154999483 18:21672912-21672934 TCCTGGGGCCCTTTGTTTTATGG - Intronic
1155211277 18:23604331-23604353 CCCTTAGGCCCTGGGTCTGGGGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155749197 18:29398961-29398983 ACCTGGGGCTCTTGGCCTCATGG + Intergenic
1156987201 18:43362091-43362113 CCCTGGGGCCCTTGGGCCTTCGG - Intergenic
1157479426 18:48044073-48044095 CCAAGGTGCCCTTGGTCTGAGGG + Intronic
1159230892 18:65605706-65605728 CCCTGGGCCCCTGAGTCTGGTGG + Intergenic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1160445325 18:78922956-78922978 CCCTGCTGCCCTTGCACTGAAGG - Intergenic
1160931972 19:1575077-1575099 CGGTGGGGAGCTTGGTCTGAGGG + Intronic
1161009720 19:1954399-1954421 CCCTGCGGCCCCAGGTCAGAGGG + Intronic
1161219494 19:3111815-3111837 CCCTGGGGCCTTTCAGCTGAGGG + Intronic
1162590320 19:11587164-11587186 CACTGGGGCTCCTGGTCTGAGGG - Intronic
1163580493 19:18135877-18135899 CCCTGGGTCCCAGGGCCTGAAGG - Intronic
1164665932 19:30036797-30036819 CCCTGGAGGCCTCTGTCTGAGGG + Intergenic
1165786253 19:38463626-38463648 CCAGGGGGTCCTTGGACTGAGGG + Intronic
1165938379 19:39403155-39403177 GCCTGGACCCCTGGGTCTGAGGG + Intergenic
1165938409 19:39403232-39403254 GCCTGGACCCCTGGGTCTGAGGG + Intergenic
1165938485 19:39403413-39403435 GCCTGGAGTCCTGGGTCTGAGGG + Intergenic
1166043763 19:40217861-40217883 GCCAGGGGCCCTGGGGCTGAAGG - Intronic
1166297129 19:41894859-41894881 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166297185 19:41894998-41895020 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166305382 19:41934596-41934618 TCCTGGGCTCCTGGGTCTGAGGG + Intergenic
1166313482 19:41976078-41976100 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166316237 19:41991733-41991755 TCCTGGATCCCTGGGTCTGAGGG + Intronic
1166316305 19:41991912-41991934 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166373813 19:42316176-42316198 GCCTGAGCCCCTGGGTCTGAAGG + Intronic
1166373831 19:42316213-42316235 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166373849 19:42316250-42316272 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166384792 19:42374970-42374992 CCCTGGGGCCTTTGCACTGGCGG - Intronic
1166521921 19:43486502-43486524 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166525431 19:43507327-43507349 ACCTGGGCTCCTGGGTCTGAGGG - Intronic
1166525465 19:43507416-43507438 ACCTGGGCTCCTGGGTCTGAGGG - Intronic
1166525503 19:43507527-43507549 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1166525533 19:43507606-43507628 GCCTGGGGTCCTGGGTCTGAGGG - Intronic
1166532685 19:43552409-43552431 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166532732 19:43552520-43552542 GCCTGGATCCCTGGGTCTGAGGG - Intronic
1166532790 19:43552668-43552690 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166662171 19:44654235-44654257 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166679038 19:44756444-44756466 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1166682721 19:44778460-44778482 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166682765 19:44778569-44778591 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166682809 19:44778678-44778700 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166682854 19:44778788-44778810 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166682882 19:44778861-44778883 GCCTGGATCCCTGGGTCTGAGGG - Intronic
1166682898 19:44778897-44778919 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1166689192 19:44812602-44812624 CCCTGGACTCCTGGGTCTGAGGG + Intronic
1166695904 19:44851323-44851345 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1166716123 19:44968928-44968950 CCCTGGGGTCCAGGGTCTTAGGG - Intronic
1167248727 19:48390015-48390037 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1167249341 19:48392187-48392209 GCCTGGAGTCCTGGGTCTGAGGG - Intergenic
1167249397 19:48392335-48392357 CCCTGGACCCCTGGGTCTGAGGG - Intergenic
1167249414 19:48392372-48392394 CCCTGGACCCCTGGGTCTGAGGG - Intergenic
1167249431 19:48392409-48392431 CCCTGGACCCCTGGGTCTGAGGG - Intergenic
1167264973 19:48478814-48478836 GCCTGGACCCCTGGGTCTGACGG + Intronic
1167286180 19:48599882-48599904 GCCTGGACCCCTGGGTCTGAGGG + Intergenic
1167314666 19:48756554-48756576 GCCTTGGCCCCTGGGTCTGAGGG + Intronic
1167314696 19:48756628-48756650 ATCTGGGCCCCTGGGTCTGAGGG + Intronic
1167314936 19:48757607-48757629 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1167315019 19:48757825-48757847 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1167327640 19:48835486-48835508 GCCTGGACCCCTGGGTCTGAAGG + Intronic
1167353830 19:48991776-48991798 GCCGGGACCCCTTGGTCTGAAGG + Intronic
1167441662 19:49512792-49512814 GCCTGGAACCCTGGGTCTGAGGG + Intronic
1167460112 19:49620645-49620667 GCCTGGAGTCCTGGGTCTGAGGG + Intronic
1167496009 19:49818956-49818978 GCCTGGGCTCCTGGGTCTGAGGG + Intronic
1167560800 19:50225829-50225851 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1167560868 19:50226014-50226036 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1167560912 19:50226126-50226148 ACCTGGACCCCTGGGTCTGAGGG + Intronic
1167560980 19:50226311-50226333 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1167561025 19:50226423-50226445 GCCTGGACCCCTGGGTCTGAGGG + Intronic
1167561051 19:50226497-50226519 GCCTGGACCCCTGGGTCTGAAGG + Intronic
1167600435 19:50451560-50451582 ACCTGGATCCCTGGGTCTGAGGG + Intronic
1167630853 19:50625602-50625624 TCCTGGACCCCTAGGTCTGAGGG - Intronic
1167662705 19:50805163-50805185 GCCTGGACCCCTGGGTCTGAGGG + Intergenic
1167678752 19:50906582-50906604 GCCTGGACCCCTGGGTCTGAGGG + Exonic
1167689073 19:50974782-50974804 ACCTGGGCTCCTGGGTCTGAGGG + Intergenic
1167690679 19:50982566-50982588 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1168057306 19:53870375-53870397 GCCTGGGCTCCTGGGTCTGAGGG + Intronic
1168057322 19:53870412-53870434 GCCTGGGCTCCTGGGTCTGAGGG + Intronic
1168077733 19:53990510-53990532 GCCTGGGCTCCTGGGTCTGAGGG - Intergenic
1168077749 19:53990547-53990569 GCCTGGGCTCCTGGGTCTGAGGG - Intergenic
1168077765 19:53990584-53990606 GCCTGGGCTCCTGGGTCTGAGGG - Intergenic
1168077863 19:53990841-53990863 GCCTGGGCTCCTGGGTCTGAGGG - Intergenic
1168092568 19:54095602-54095624 GCCTGGAGTCCTGGGTCTGAGGG + Exonic
1168092629 19:54095787-54095809 GCCTGGGCTCCTGGGTCTGAGGG + Exonic
1168242056 19:55093289-55093311 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1168242149 19:55093544-55093566 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1168242190 19:55093653-55093675 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1168242219 19:55093725-55093747 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1168242302 19:55093942-55093964 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1168242357 19:55094087-55094109 GCCTGGGCTCCTGGGTCTGAGGG - Intronic
1168254542 19:55158250-55158272 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1168255313 19:55161593-55161615 GCCTGGACCCCTGGGTCTGAGGG - Intronic
1168263055 19:55207581-55207603 GCCTGGGGGCCTGGGTCTGAGGG + Intronic
1168263245 19:55208129-55208151 GCCTGGGGGCCTGGGTCTGAGGG + Intronic
1168266147 19:55224989-55225011 GGCTGGGGGCCTGGGTCTGAGGG - Intergenic
1168292007 19:55361622-55361644 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1168292085 19:55361869-55361891 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1168292109 19:55361941-55361963 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1168295363 19:55375167-55375189 CCCTGGACTCCTGGGTCTGAGGG - Intergenic
1168295884 19:55377216-55377238 TCCTGGATTCCTTGGTCTGAGGG + Intronic
1168310163 19:55456074-55456096 GCCTGGATCCCTGGGTCTGAAGG + Intronic
1168644964 19:58053877-58053899 CCCGGGGGCCCTTGCTCCGGGGG - Exonic
926157728 2:10466870-10466892 CCCTCTGGCCCTTGGCCTGGAGG - Intergenic
927258263 2:21059765-21059787 TCCTGTGGGCCTTGGTCTCATGG - Intergenic
927351841 2:22125196-22125218 CCCTGACGGCCTTGGGCTGAAGG + Intergenic
928773623 2:34732505-34732527 ACCTGGGGTTCTTGGTCTCATGG + Intergenic
929571842 2:43027623-43027645 CCCTGGAGGCCCTGGTCTGTGGG + Intergenic
929803891 2:45127911-45127933 CCCTGGGCTTCTTGGTGTGATGG - Intergenic
930051445 2:47219194-47219216 CCCAGGGGCCATTGCTCTGTTGG - Intergenic
931176307 2:59858500-59858522 CCCTGGGGCCATGTGTCTGAGGG - Intergenic
931489236 2:62726003-62726025 CCCTGTGTCCCTTGGTCTGCTGG - Intronic
931527659 2:63174807-63174829 TCCTGGGACCCTTGGACAGAGGG - Exonic
931784613 2:65608017-65608039 TCCTGGGCCCCTGGGTCTGCTGG + Intergenic
931969137 2:67566662-67566684 CTCTGGGGTCCTTGTTCTGGGGG - Intergenic
932084849 2:68748904-68748926 CCCAGGGCCCCTGAGTCTGAAGG - Intronic
932103805 2:68924797-68924819 ACCTGGAGTCCTTGGTATGATGG - Intergenic
932491917 2:72127891-72127913 CCCTGGGGGCCTCTGTCCGAGGG + Intergenic
932873412 2:75426164-75426186 CACTGGGGCCTTTGGGGTGAGGG - Intergenic
933710515 2:85322332-85322354 CCCTGGGGCCCGGGCTCTGTAGG - Exonic
934475114 2:94588416-94588438 CCCTGGGGACCAAGGTCTGATGG + Intergenic
935580091 2:104749173-104749195 TTCTGGGGCCCTTTGTCGGACGG - Intergenic
936987632 2:118326769-118326791 TCCTGGGGGCCTTTGGCTGAAGG - Intergenic
937205105 2:120231319-120231341 CCCTGTGGCCCTTGTTCCCAAGG + Intergenic
937363082 2:121242543-121242565 CCCTGGGGCCCTGGGTGAGGTGG - Intronic
940910947 2:159209546-159209568 CCCTGAGGCCCTCAGTGTGACGG + Intronic
947721774 2:232374101-232374123 CCCTGTGGCCCTTGGTCTTGGGG - Intergenic
948608814 2:239154162-239154184 TCCTGGGGCCCTTGGTGGAAAGG + Intronic
948708028 2:239807228-239807250 GCCTGGGGGCCCTGGTCTCAGGG - Intergenic
948939069 2:241187311-241187333 CCTTGGGGCCCTGGGCCTCAGGG - Intergenic
949033169 2:241805974-241805996 GCCTAGGTCCCTTGGGCTGAGGG - Intergenic
1169760759 20:9091047-9091069 CCCTGGGGACCCTGGTCTCTGGG - Intronic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1170624146 20:18018710-18018732 CCCTGGAGCCTTGGGTCTGAAGG - Intronic
1171239164 20:23551218-23551240 CTCTGGGGCCCTGGGGCTGAGGG + Intergenic
1171487574 20:25495482-25495504 CCCTTGGGTTCTTGGTCTGCAGG - Intronic
1172519362 20:35557132-35557154 CTCTGGGGGCCTGGGCCTGAGGG + Intronic
1172848644 20:37944942-37944964 GCCTGGGGCCATGGGTCCGAGGG - Exonic
1173227200 20:41168892-41168914 CACTGGGGCCCTTGGACTCTGGG - Intronic
1175239465 20:57536174-57536196 TACTGGGGCCCATGGTATGAGGG - Intergenic
1176269334 20:64227492-64227514 CCCTGGGGCCCAGGACCTGAGGG - Intronic
1176378961 21:6102179-6102201 CCCTGGAGGCCTCGGTCTGTGGG - Intergenic
1176672958 21:9751430-9751452 CCATGGGGCCCTAGGACTTAGGG + Intergenic
1178319491 21:31594596-31594618 CCCTGGAGCCCTAGGTAAGATGG + Intergenic
1179264817 21:39794022-39794044 CCTTGGGGCCTTTGGACTCATGG + Intronic
1179569862 21:42272374-42272396 CCCTGGATCCCCAGGTCTGAAGG - Intronic
1179744513 21:43436058-43436080 CCCTGGAGGCCTCGGTCTGTGGG + Intergenic
1180058671 21:45373885-45373907 CCATGGAGCTCTTGGCCTGAAGG + Intergenic
1181043136 22:20202337-20202359 TCCTGGGCCCCTTGGTCATAAGG + Intergenic
1181182775 22:21079153-21079175 TCCTTGGGCCCTTGGCCTGCGGG - Intergenic
1181329653 22:22079966-22079988 CCCTGGGGCTCTGGGCCAGAGGG + Intergenic
1184234033 22:43173686-43173708 CCCTGGGGCTCCTGGTCTGCGGG + Intronic
1184333768 22:43841483-43841505 CCCTGGGGGCCCTCCTCTGAGGG - Intronic
1184833053 22:47002756-47002778 CCCTGGGGCCCCGGTTCTGGTGG + Intronic
1185008806 22:48301576-48301598 CCCGGGGGCCCCAGGCCTGAAGG - Intergenic
1185051505 22:48556611-48556633 CCCTGGGGGCTCTGGTCTGCAGG + Intronic
1185306718 22:50121738-50121760 CCCTGGGGACCCAGGTCTGCTGG + Intronic
951837688 3:27001416-27001438 ACCTGGGGTTCTTGGTCTCACGG - Intergenic
953874884 3:46661030-46661052 CCCTGGGGCACTAGGTCACATGG + Intergenic
954136655 3:48585035-48585057 CCCTGGAGCCCCTGGCCTAAAGG - Exonic
954406578 3:50348611-50348633 CTCAGGGGCCCTGGGTGTGAGGG - Intronic
954627195 3:52028998-52029020 CCTTAGGGACTTTGGTCTGATGG - Intergenic
957081471 3:75639356-75639378 ACCTGGGGCTCTTGGCCTCACGG + Intergenic
961035285 3:123637772-123637794 GCCTGGGGCCTTTGGTCAGGAGG - Intronic
961593198 3:127996196-127996218 CCCTGGGGCCCCAGGACAGATGG - Intergenic
962050765 3:131812550-131812572 CCCTAGGGCTGTTGGTCTCAAGG - Intronic
962301868 3:134250588-134250610 CCCGGGGGCCCGCGGCCTGAGGG - Exonic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
967217424 3:187222296-187222318 CCCTGGCCCCCTTGGGCTCATGG - Intronic
967529785 3:190535186-190535208 CCCTGCGGCCTTTGTTCTGGAGG + Intronic
968508747 4:985570-985592 CTCTGGGGTCGTTGGACTGAGGG + Intronic
968844586 4:3033305-3033327 CCCTGGGGCCCCTTTTCTAATGG + Intronic
969460827 4:7327901-7327923 CTCAGGAGCCCTTGGTCTGGAGG - Intronic
974183867 4:58419542-58419564 CCTGGGGGGCCTTGGTTTGAAGG + Intergenic
974519999 4:62971668-62971690 ACCTGGGGTTCTTGGTCTCATGG - Intergenic
979828186 4:125266132-125266154 CCCTGGTGCACATGGTCTGGAGG - Intergenic
980901865 4:138912667-138912689 TCCAGGGGCCCTTGGTTTCATGG + Intergenic
981251885 4:142612695-142612717 CCCTGGGGCCTTTTTTATGAGGG + Intronic
983701655 4:170603360-170603382 CCCTGAAGCTCTTGGTATGATGG + Intergenic
984242726 4:177236967-177236989 GCCTGGGCCCCTTGGTAAGAAGG + Intergenic
984766260 4:183402716-183402738 ACGTGGAGCCCCTGGTCTGATGG + Intergenic
984934384 4:184877505-184877527 CCATGGAGCTCTTGGTCTCATGG + Intergenic
985401731 4:189600198-189600220 CCATGGGGCCCTAGGACTTAGGG - Intergenic
985420548 4:189781180-189781202 CCCTGGGGCTCATTTTCTGAAGG - Intergenic
985449424 4:190051766-190051788 ACCTGGGGCTCTTGGCCTCACGG - Intergenic
986425463 5:7626930-7626952 TCCTGGGTCCCTTGGTCTGAAGG - Intronic
990886891 5:60604728-60604750 CCCTGGGGTCCATGGTCTCCAGG - Intronic
990960165 5:61385753-61385775 CCCTGGGGCACAGGGGCTGAGGG - Intronic
995725665 5:115178878-115178900 CCCTGGGGCCATAGGACTGTCGG + Intronic
997976475 5:138444466-138444488 CGCTGGAGCCCTTGGTGTAAGGG - Exonic
998407038 5:141879821-141879843 CCCTGGGCTCCTGGGGCTGAGGG - Intergenic
999158060 5:149472601-149472623 CACTGGGGCCCTTGGCCTCAAGG + Intergenic
1000011611 5:157238703-157238725 CCCTATGGCCGTGGGTCTGAAGG + Intronic
1000344165 5:160300444-160300466 GCATGGGGCCCATGGTCTGTGGG - Intronic
1002439313 5:179256134-179256156 GCCTGGGGCCTCTGCTCTGAGGG - Intronic
1002682347 5:180976689-180976711 CACTGGGGCCCATTGTATGAGGG + Intergenic
1004025061 6:11810288-11810310 CCCTGGGTCCCTTCCTCAGAGGG + Intergenic
1006364945 6:33609864-33609886 CTCTGGGGCCCCTAGACTGAGGG - Intergenic
1006574887 6:35037838-35037860 CCCTGGGGTCCTGGTTCTGGAGG + Intronic
1006800459 6:36756501-36756523 TCGTGGGACCCTGGGTCTGATGG - Intronic
1007400322 6:41599310-41599332 CCAGGGGGCCCTGGGTTTGAGGG - Exonic
1007687780 6:43677264-43677286 TCCTGGGGCCCTTCTCCTGATGG - Intronic
1009544365 6:65005389-65005411 ACCTGGGGCTCTTGGCCTCACGG - Intronic
1009935719 6:70232592-70232614 CCCTGGTGCTCTTGGTTTGAGGG - Exonic
1012495702 6:99831379-99831401 CCAAGGGGTCCTTGGTCTGAAGG - Intergenic
1013410552 6:109879879-109879901 ACCTGGGGTCCTTGGCCTCACGG - Intergenic
1015131658 6:129818003-129818025 GCCTGAGACCTTTGGTCTGAGGG + Intergenic
1015256343 6:131183512-131183534 CCCTGTGGCCCTTGAGCTGCTGG + Intronic
1016092181 6:139993467-139993489 GTCTGGGGGCTTTGGTCTGATGG + Intergenic
1016979067 6:149837667-149837689 CTCAGGGGCTCTTGGTCTGAGGG + Intronic
1018760593 6:166891474-166891496 ACCTGGGGTTCTTGGTCTCACGG - Intronic
1018857064 6:167682300-167682322 CCCTGGGGCCGATGGCCAGAAGG + Intergenic
1019151662 6:170010692-170010714 CCCTCAGGCCCTGGGTGTGATGG - Intergenic
1022257082 7:28669662-28669684 CCCTGTTGCCCTTGATGTGATGG - Intronic
1022483954 7:30763449-30763471 ACCTGGCTCCCTTGCTCTGATGG - Intronic
1022673747 7:32479198-32479220 CCCTGGGCCCCTTGATAGGAAGG - Intergenic
1023101281 7:36721112-36721134 TTCTGGAGCCATTGGTCTGAAGG + Intronic
1024023151 7:45389229-45389251 CTGAGGGGCCCCTGGTCTGACGG - Intergenic
1026125305 7:67574318-67574340 CACTGGGGCCCATTGTATGAGGG - Intergenic
1026959786 7:74400826-74400848 CCCGGGAACCCCTGGTCTGAAGG + Intronic
1028642727 7:93061406-93061428 CGCTGGGGTCCATGGGCTGAGGG + Intergenic
1028753746 7:94411124-94411146 CCCTGGGGAGCCTGGTCTCATGG + Exonic
1029653339 7:101908720-101908742 CCCTGGAGCCCCTGGCCTGGTGG + Intronic
1032507920 7:132449952-132449974 CCCTGGGGGCCCTGGGCTAATGG + Intronic
1034458575 7:151185851-151185873 CCCTTGAGCCCATGATCTGAGGG + Intronic
1034865297 7:154636557-154636579 CCCGGGGCCCCTTGCTTTGAGGG - Intronic
1035289315 7:157827586-157827608 CCCTGGGCCACTGGGTTTGAAGG - Intronic
1036977279 8:13427687-13427709 CCTTGGGCCCCTTGTTCTCATGG + Intronic
1039484320 8:37899333-37899355 CCCCGGGGCCCTTGGCCCGCAGG + Exonic
1039804628 8:40987581-40987603 CCTTGGGCCACTTGGTCTGGTGG - Intergenic
1041487257 8:58392656-58392678 TCCTGGAGCCCTTGGGCTGCTGG + Intergenic
1041741870 8:61164964-61164986 ACCTGGGGTTCTTGGTCTCACGG + Intronic
1043190361 8:77213641-77213663 TCCTGGTGCCCTTGGTTTAAAGG - Intergenic
1045499564 8:102734786-102734808 CCCTGGGGCCCTGGGAGGGAAGG + Intergenic
1047160201 8:122369743-122369765 GCCTGGGGCCCTTGGGCCTAAGG - Intergenic
1047226563 8:122960083-122960105 TCATGGAGCCCTTGGTCTAATGG + Intronic
1049209536 8:141379110-141379132 CCCTGGGGACCCTGATCTGAGGG + Intergenic
1049242322 8:141544253-141544275 CCCTGAGGCCCCAGGTCAGAGGG - Intergenic
1049285768 8:141774382-141774404 CCCTGGGGCTGTGGGACTGAAGG + Intergenic
1051431409 9:16984332-16984354 CCCTGGTCCCCTTGGTCAGAGGG + Intergenic
1051516614 9:17936892-17936914 CCATGTGGCTTTTGGTCTGAGGG + Intergenic
1052854936 9:33401346-33401368 CCCTGGGGACCAAGGTCTGATGG - Intronic
1053071196 9:35103049-35103071 CACTGGGGCCCTTTTGCTGAGGG - Exonic
1053168426 9:35861035-35861057 CCAGGTGGCCCCTGGTCTGAAGG + Intergenic
1053682956 9:40497675-40497697 CCCTGGGGACAAAGGTCTGATGG - Intergenic
1053932939 9:43125989-43126011 CCCTGGGGACCAAGGTCTGATGG - Intergenic
1054280758 9:63127253-63127275 CCCTGGGGACAAAGGTCTGATGG + Intergenic
1054296056 9:63333175-63333197 CCCTGGGGACAAAGGTCTGATGG - Intergenic
1054852597 9:69864017-69864039 CCATGGGGCCCTGAGTTTGAGGG + Intronic
1057128466 9:92637528-92637550 CCATGGGGCCTTTGGACTGCGGG - Intronic
1057199274 9:93131730-93131752 CCCTGTGGCCCTTCATGTGAGGG - Intronic
1057740698 9:97708961-97708983 TCCTGGGTCTCATGGTCTGAAGG - Intergenic
1057843454 9:98504051-98504073 TCCTGGTGCCCTGGGTCTGGAGG - Intronic
1057930034 9:99185199-99185221 CCCTCTGGCCCTGGTTCTGACGG + Intergenic
1058634582 9:107024058-107024080 CCCTGGGTCTCCTGGTCTCAGGG + Intergenic
1060483272 9:124030378-124030400 CCCTGAGGCCCTTTGTTTTATGG + Intronic
1060919022 9:127407342-127407364 CCCTTGGAGCCTTGGTCTGCAGG + Exonic
1060987539 9:127828414-127828436 CCCTGGGGCCGGTGGCCAGAGGG - Intronic
1061806049 9:133138264-133138286 CTCTAGGGCCCTGGGTCTGAGGG + Intronic
1061832290 9:133303784-133303806 CCATGTGGCTCCTGGTCTGAAGG + Intergenic
1061894153 9:133638442-133638464 GCCTCGGGCCCTTGGCCTTAAGG - Intronic
1062268028 9:135696247-135696269 CCCTGGGTCCCTGGGTCTGCTGG - Intronic
1186051213 X:5597651-5597673 ACCTGAGGCCCATGGTCAGATGG - Intergenic
1187088103 X:16063162-16063184 CCTTGGCGCCCCTTGTCTGAAGG + Intergenic
1190071792 X:47285681-47285703 CACTGGGGCCCCTTGTATGAAGG + Intergenic
1192169558 X:68845864-68845886 CCCTGGTGCCCTGGAACTGAAGG - Intergenic
1194154461 X:90370022-90370044 ACCTGGGGTTCTTGGCCTGACGG + Intergenic
1197980922 X:132217674-132217696 CCCTGGGCCCCTTTGTGTGAAGG - Exonic
1199947605 X:152680927-152680949 AGGTGGGGGCCTTGGTCTGAGGG + Intergenic
1199962074 X:152787527-152787549 AGGTGGGGGCCTTGGTCTGAGGG - Intergenic
1200500814 Y:3946915-3946937 ACCTGGGGTTCTTGGCCTGACGG + Intergenic