ID: 1085273194

View in Genome Browser
Species Human (GRCh38)
Location 11:75282392-75282414
Sequence TAGGCCCACCAAAATCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085273194_1085273199 14 Left 1085273194 11:75282392-75282414 CCTGGATGATTTTGGTGGGCCTA 0: 1
1: 0
2: 5
3: 44
4: 348
Right 1085273199 11:75282429-75282451 GTCCTTAGAAGTGGAAGCAGGGG 0: 1
1: 0
2: 8
3: 44
4: 265
1085273194_1085273200 15 Left 1085273194 11:75282392-75282414 CCTGGATGATTTTGGTGGGCCTA 0: 1
1: 0
2: 5
3: 44
4: 348
Right 1085273200 11:75282430-75282452 TCCTTAGAAGTGGAAGCAGGGGG 0: 1
1: 1
2: 21
3: 105
4: 510
1085273194_1085273198 13 Left 1085273194 11:75282392-75282414 CCTGGATGATTTTGGTGGGCCTA 0: 1
1: 0
2: 5
3: 44
4: 348
Right 1085273198 11:75282428-75282450 AGTCCTTAGAAGTGGAAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 234
1085273194_1085273196 5 Left 1085273194 11:75282392-75282414 CCTGGATGATTTTGGTGGGCCTA 0: 1
1: 0
2: 5
3: 44
4: 348
Right 1085273196 11:75282420-75282442 ATCACAAGAGTCCTTAGAAGTGG 0: 3
1: 29
2: 210
3: 506
4: 1003
1085273194_1085273197 12 Left 1085273194 11:75282392-75282414 CCTGGATGATTTTGGTGGGCCTA 0: 1
1: 0
2: 5
3: 44
4: 348
Right 1085273197 11:75282427-75282449 GAGTCCTTAGAAGTGGAAGCAGG 0: 1
1: 1
2: 15
3: 92
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085273194 Original CRISPR TAGGCCCACCAAAATCATCC AGG (reversed) Intronic
900326024 1:2109072-2109094 TGGGCCCACCCAGATCATCCAGG + Intronic
900890945 1:5449283-5449305 TAGGCCCACCTGGATAATCCAGG - Intergenic
901263691 1:7892828-7892850 CAGGCCCACCCAGATAATCCAGG + Intergenic
904483955 1:30812200-30812222 TATGACCATCAAAATCATGCTGG + Intergenic
906172117 1:43735316-43735338 TGGGCCCACCTTAATAATCCAGG - Intronic
907181941 1:52578510-52578532 GAGGGCCACCTAAATCTTCCTGG - Intergenic
907691826 1:56676252-56676274 TTGGCCCACCTACATGATCCAGG - Intronic
907751430 1:57267104-57267126 AAGGCCTACCAGAATAATCCAGG - Intronic
908187567 1:61667294-61667316 TGGGCCCACCCAGATAATCCAGG - Intergenic
908646120 1:66279852-66279874 AAGGCCCACCAACATCATCGGGG + Intronic
909363766 1:74796224-74796246 TGGGCCCACCTGAATAATCCAGG - Intergenic
910672225 1:89784908-89784930 TGGGCCCACCCAAATGATCCAGG + Intronic
910766766 1:90789965-90789987 TAGGCCCACCTGGATAATCCAGG - Intergenic
911154863 1:94627475-94627497 TGGGCCCACCCAGATAATCCAGG + Intergenic
911658863 1:100476896-100476918 TGGGCCCACCCAAACAATCCGGG - Intronic
911722106 1:101202708-101202730 TGGGCCCACCCAGATAATCCAGG + Intergenic
911754804 1:101541156-101541178 TATTCCCACCAAAAGCATCAGGG - Intergenic
912427160 1:109604538-109604560 GAAGCCTATCAAAATCATCCTGG - Exonic
912465621 1:109871467-109871489 TGGGCCCATAAAGATCATCCAGG - Intergenic
913057368 1:115174947-115174969 AGGGCCCACCTAGATCATCCAGG + Intergenic
913478301 1:119260265-119260287 TGGGCCCACCTAGATAATCCAGG + Intergenic
915743344 1:158137026-158137048 TGGGCCTACCCAAATAATCCAGG - Intergenic
918153455 1:181819309-181819331 TTGGCCCACTCAAATAATCCAGG + Intergenic
918798312 1:188935741-188935763 CAGGCCCACCAGAATGATTCAGG - Intergenic
919813657 1:201424465-201424487 GGGGCCCACCAAGATAATCCAGG - Intronic
920083034 1:203390381-203390403 TCGGCCCACCCAGATCATCCAGG - Intergenic
920258923 1:204675623-204675645 TGGGCCCACCCAGATAATCCAGG + Intronic
920925499 1:210337691-210337713 TGGGCCCACCCAGATAATCCAGG + Intronic
921061367 1:211587829-211587851 AGGGCCCACCTAGATCATCCAGG - Intergenic
921155703 1:212436634-212436656 TAGGCCCACCCAGATTATCTGGG + Intronic
921796692 1:219352815-219352837 TAGGACCAGAAAAACCATCCAGG - Intergenic
922087388 1:222363860-222363882 TAGGACCACCCAAAGCAACCAGG + Intergenic
922090535 1:222391136-222391158 GAGGCCTATCAGAATCATCCAGG + Intergenic
922254230 1:223878557-223878579 TGGGCCCACCCAGATAATCCAGG + Intergenic
1064005457 10:11695577-11695599 TGGGCCCACCCAGATAATCCAGG - Intergenic
1064190726 10:13203391-13203413 TGGGCCCACCCAGATCATCTAGG + Intronic
1066035963 10:31484151-31484173 CTGGCCCACCCAAATAATCCAGG + Intronic
1066228179 10:33404958-33404980 TAAGCCCACCCACATAATCCAGG + Intergenic
1067454271 10:46405098-46405120 TGGGCCCACCCAAACAATCCAGG + Intergenic
1067632932 10:47979534-47979556 TGGGCCCACCCAAACAATCCAGG - Intergenic
1070762012 10:79029801-79029823 CAGGCCCACCCAGATAATCCAGG - Intergenic
1071021571 10:81063460-81063482 AGGACCCACCAAAATAATCCAGG - Intergenic
1071806117 10:89123024-89123046 TAGGCCCACCTATATAATCTAGG + Intergenic
1072294829 10:93998863-93998885 TGAGCCCACCCAGATCATCCAGG - Intronic
1074726415 10:116314759-116314781 TGGGCCCACCCAGATAATCCAGG - Intergenic
1076375015 10:129977769-129977791 TGGGCCCACCCAAATAATCCAGG - Intergenic
1078571550 11:12462304-12462326 TAAGCCCACCTGAATAATCCAGG - Intronic
1079649290 11:22906746-22906768 TGGGTCCACCCAAATAATCCAGG - Intergenic
1085273194 11:75282392-75282414 TAGGCCCACCAAAATCATCCAGG - Intronic
1087320279 11:96650077-96650099 TGGGCCCACCCAAATAATTCAGG + Intergenic
1088560525 11:111110886-111110908 TAGGCCCACCCAGATAGTCCGGG - Intergenic
1091242261 11:134061574-134061596 GAGGTCCACCCAAACCATCCTGG + Intergenic
1093404897 12:18792312-18792334 TGGGCTCACCAGAATAATCCAGG + Intergenic
1093478462 12:19580779-19580801 TAGGCCCACCTGGATAATCCAGG - Intronic
1093749045 12:22777909-22777931 TATGTCAACCAAAATCATACTGG + Intergenic
1095631889 12:44386410-44386432 TATGCCCAAAAAAATCATTCAGG + Intronic
1097908328 12:64943629-64943651 CAGGCCCACCTAGATGATCCAGG + Intergenic
1100065306 12:90636692-90636714 TATGCCTACCAAAATCTTCCAGG - Intergenic
1100228963 12:92587974-92587996 TATGTCCACCAGAATTATCCAGG + Intergenic
1100432393 12:94542288-94542310 TAAGCCCACCCAGATAATCCAGG - Intergenic
1100595139 12:96065132-96065154 GGGGTCCACCCAAATCATCCAGG - Intergenic
1102963276 12:117107491-117107513 TGGGCCCACCCAGATAATCCAGG - Intergenic
1103970819 12:124670342-124670364 TGGGCCCACCTGGATCATCCAGG + Intergenic
1104244241 12:127022217-127022239 AAGGCCCACCCAGATAATCCAGG - Intergenic
1104280296 12:127370729-127370751 TGGGCCCACCTCAATAATCCAGG + Intergenic
1104369979 12:128215883-128215905 TGGGCCCACCCAGATAATCCAGG - Intergenic
1104573559 12:129946164-129946186 TGGGCCCACCCAGATAATCCAGG + Intergenic
1104690644 12:130823462-130823484 TGGGCCCACCCAGATAATCCAGG - Intronic
1104984363 12:132588145-132588167 TAGCCTGACCAAAATCCTCCAGG - Intergenic
1105059303 12:133133955-133133977 TAAGCCCACTGAAATAATCCAGG - Intronic
1105660961 13:22494655-22494677 AAGGTCCACCCAAATCATCCAGG - Intergenic
1107614499 13:42150899-42150921 TGGGCCCACCTAGATAATCCAGG - Intronic
1107619118 13:42206790-42206812 TGGGCCCACCTAGATCACCCAGG + Intronic
1107884841 13:44866720-44866742 TGGGCCCGCCCAGATCATCCAGG + Intergenic
1108111897 13:47082547-47082569 TAGGCCCACCTGGATAATCCAGG + Intergenic
1108286908 13:48917796-48917818 TAGGCCCACCTGAATCATCCAGG + Intergenic
1109349102 13:61153961-61153983 TGGGCCCACCTGAATAATCCAGG - Intergenic
1110441976 13:75536500-75536522 TAGGCCCACCTGGATAATCCAGG - Intronic
1111323176 13:86657256-86657278 TGGGCCTACCATAATAATCCAGG - Intergenic
1111931762 13:94519764-94519786 AAGCACCACCAAAATCACCCAGG - Intergenic
1112116970 13:96366682-96366704 TACCCCCACCAGAATCATCTGGG - Intronic
1112748238 13:102552231-102552253 TGGGCCCACCAAGAAAATCCAGG + Intergenic
1112969656 13:105244933-105244955 TAGGCCCTCTAAGTTCATCCAGG + Intergenic
1113095555 13:106660311-106660333 TAGGCCTACCCAAATCACACAGG - Intergenic
1114673220 14:24424572-24424594 TAGGCCCACCCAGATAAGCCAGG - Intergenic
1114688528 14:24558421-24558443 TTGGCCCACCTAGATAATCCAGG - Intergenic
1114713037 14:24797547-24797569 TGGGCCCACCTAGATAATCCAGG + Intergenic
1114756992 14:25270388-25270410 TGGGCCCACCCAGATAATCCAGG + Intergenic
1115310206 14:31971811-31971833 TAGGCCCACCCAAATTATTGAGG + Intergenic
1116005929 14:39289998-39290020 TGGGCCCACCAAAATAATTCTGG + Intronic
1116968299 14:51038122-51038144 TGGGCCCACCTAGATAATCCAGG - Intronic
1117484885 14:56186042-56186064 TGGGCCCACCCAGATAATCCAGG - Intronic
1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG + Intronic
1119433141 14:74581368-74581390 TGGGCCCACCAAGATAATCCAGG - Intronic
1119693207 14:76692788-76692810 AGGGCCCACCCAAATAATCCAGG + Intergenic
1119881185 14:78101165-78101187 CAGGCCCACCTAGATAATCCAGG + Intergenic
1119914083 14:78380434-78380456 TATGCCCACCCAGATAATCCAGG - Intronic
1119993447 14:79225968-79225990 CAGGCCCACCCAGATAATCCAGG + Intronic
1120688725 14:87568614-87568636 TGGGCCCACCCAAATAATCCAGG - Intergenic
1121047766 14:90800468-90800490 TGGGCCCACCCAAATAATCCAGG - Intronic
1121786291 14:96663563-96663585 TAGTCCCAGAAAAATCTTCCTGG + Intergenic
1122020815 14:98836470-98836492 TGGGCCCACCAGGATCACCCAGG + Intergenic
1124007046 15:25802783-25802805 TGGGCCCACCCAGATGATCCAGG + Intronic
1124666342 15:31596033-31596055 TGGGCCCACCTAGATAATCCAGG + Intronic
1124846578 15:33297196-33297218 CAGGCCCACCCAGATTATCCAGG + Intergenic
1125315307 15:38425294-38425316 TGGGCCCACCTGAATAATCCAGG - Intergenic
1125457006 15:39870223-39870245 AAGGCCCACCCAGATAATCCAGG + Intronic
1127087439 15:55437621-55437643 AAGTCCCACCTACATCATCCAGG - Intronic
1127105925 15:55615005-55615027 TGAGCCCACCTAAATAATCCAGG - Exonic
1128207742 15:65868231-65868253 TGGGCCCACCCAACTAATCCAGG + Intronic
1128612517 15:69085276-69085298 TGGGCCCACCCAGATAATCCAGG - Intergenic
1128819587 15:70639801-70639823 TGGGCCCACCTAGATAATCCAGG - Intergenic
1128934283 15:71732100-71732122 TGGGCCCACCCAAGTAATCCAGG + Intronic
1129157168 15:73725597-73725619 TGGGCCCACCTAGATAATCCAGG - Intergenic
1130436858 15:83909180-83909202 TAAGCCCACCAAAGTAATCTGGG + Intronic
1134238454 16:12486263-12486285 TGGGCCCACCCAGATTATCCAGG + Intronic
1135912482 16:26574052-26574074 TGGGCCCACCAGGATAATCCAGG - Intergenic
1137474135 16:48792112-48792134 TAGGCCCACCCAGATAATCTAGG + Intergenic
1137504954 16:49046329-49046351 TGGGCCCACCTAGATCATCCAGG + Intergenic
1137708560 16:50551076-50551098 GAGACCCACCAAAAACATGCGGG - Intronic
1140831938 16:78760000-78760022 TAGGCCCACCAGGCTCATCCAGG + Intronic
1140904424 16:79398252-79398274 TAGGTCCAGCAAGATAATCCAGG + Intergenic
1141078998 16:81034640-81034662 TGGGCCCATTCAAATCATCCAGG - Intergenic
1141622529 16:85244182-85244204 TGGGCCCACCAGCATAATCCAGG - Intergenic
1141681747 16:85548755-85548777 TAGGCCCACCCTAATCATCCAGG + Intergenic
1141757775 16:86003954-86003976 TGGGCCCACCCAAATAACCCAGG - Intergenic
1143262732 17:5612113-5612135 TGAGCCCACCCAGATCATCCAGG - Intronic
1143366354 17:6411133-6411155 TGGGCCCACCCAGATAATCCAGG - Intronic
1143813116 17:9488493-9488515 TGGGCCCACCCAGATAATCCAGG - Intronic
1143907814 17:10223575-10223597 TAGGACCACCTGAATAATCCGGG + Intergenic
1144217617 17:13070334-13070356 TAGGCCCACCTGAATAATCCAGG - Intergenic
1144596045 17:16570928-16570950 CAGGCCCACCCAAATTATCTAGG - Intergenic
1150642073 17:66956025-66956047 GAGGCCCACCACAGTCATGCAGG + Intergenic
1150767782 17:68015845-68015867 TGGGCACAACAAACTCATCCTGG - Intergenic
1150934630 17:69622472-69622494 TGAGCCCACCCAAATAATCCAGG + Intergenic
1151035784 17:70797505-70797527 TGGGCCCACCCAGATAATCCAGG + Intergenic
1151285023 17:73104619-73104641 TGGGCCCACCCAGATAATCCAGG - Intergenic
1153312108 18:3686918-3686940 TAGGCCCACCCTAATAATCCGGG - Intronic
1153328794 18:3850561-3850583 TAGGGCCCCCAAAATCAACCTGG + Intronic
1153852313 18:9106973-9106995 TGGGCCCACCTAGATAATCCAGG + Intronic
1154248895 18:12726262-12726284 TGGGCCCACCCCAATAATCCAGG + Intergenic
1154253061 18:12760318-12760340 TAGGCCCACCTAAAACATGGAGG - Intergenic
1154461157 18:14588844-14588866 TAGGCCCAGCTAGATAATCCAGG - Intergenic
1155161386 18:23198571-23198593 TGGGGCCACCTAAATAATCCAGG - Intronic
1155583896 18:27343026-27343048 TTGGCCTACCCAAATAATCCAGG + Intergenic
1156314219 18:35952168-35952190 TGGGCCCACCTAGATTATCCAGG + Intergenic
1156509751 18:37626483-37626505 TGGGCCCACCCGAATAATCCAGG + Intergenic
1158146758 18:54322986-54323008 TAGGGCCACCAGGATAATCCAGG + Intergenic
1158219304 18:55133768-55133790 TGGGCCCACCCAGATGATCCAGG - Intergenic
1158424712 18:57328542-57328564 CAGGCCCACCCAGATAATCCAGG + Intergenic
1158445574 18:57517745-57517767 AGTGACCACCAAAATCATCCTGG - Intergenic
1160969281 19:1760272-1760294 TAGGCCCACCAGACTCAGCGGGG - Intronic
1161761956 19:6180142-6180164 TTGGGCCACCCAGATCATCCAGG + Intronic
1163839986 19:19601592-19601614 TAGGCCCCCCCAGATAATCCGGG - Intronic
1166350091 19:42193359-42193381 AGGGCCCACCCAAATAATCCAGG - Intronic
1167717345 19:51152286-51152308 TGGGCCCACCCAAATAATCCAGG + Intronic
1167746890 19:51356991-51357013 AGGGCCCACCTAAATAATCCAGG + Exonic
1167767399 19:51492597-51492619 TGGGCCCACCCAAGTAATCCAGG - Intronic
1168507929 19:56951849-56951871 GAGGCCCACCCACATCCTCCAGG - Intergenic
1202655575 1_KI270708v1_random:17496-17518 TAAACCCACAAAAATCAGCCGGG - Intergenic
926920873 2:17938643-17938665 TAGGCCCACCTGGATAATCCAGG + Intronic
927710305 2:25321444-25321466 TGGGCCCACCCAGATAATCCAGG + Intronic
928650764 2:33401257-33401279 TGGGCCCACCCACATAATCCAGG - Intergenic
932263721 2:70348155-70348177 TGGGCCCACCCAGATAATCCAGG + Intergenic
932345385 2:70991912-70991934 TAGGCCCACTCCAATCATGCTGG + Exonic
932454278 2:71836653-71836675 TGGGCCCACCCAGATAATCCAGG + Intergenic
932832692 2:75006420-75006442 TGGGCCCACCCAGATAATCCAGG + Intergenic
932926296 2:75978881-75978903 TAGGCCCACCCAGATAATCCAGG - Intergenic
933372413 2:81432252-81432274 AAGGCCCACCAATATCTTCGGGG + Intergenic
933577703 2:84088545-84088567 TAGGCCCATAAAAACCATTCTGG + Intergenic
935261677 2:101361387-101361409 TGGGCTCAGCCAAATCATCCAGG - Intronic
935460857 2:103332021-103332043 CAGGACCAGGAAAATCATCCTGG - Intergenic
935519417 2:104085437-104085459 TAGGCCATCCCAGATCATCCAGG + Intergenic
936506100 2:113108525-113108547 TGGGTCCACCTAAATAATCCAGG + Intronic
937101847 2:119277426-119277448 TAAGAATACCAAAATCATCCAGG - Intergenic
938710691 2:133973959-133973981 TAGGTCCACCCAGACCATCCAGG + Intergenic
939554776 2:143661180-143661202 CAGGCCCACCCCAATAATCCAGG + Intronic
940329393 2:152457989-152458011 TGGGCCCACCCAGATAATCCAGG + Intronic
941614854 2:167707658-167707680 TGGGCCCACCCAGATAATCCAGG + Intergenic
942030548 2:171954837-171954859 TAGGTCCACCCAAATATTCCAGG - Intronic
943675879 2:190716118-190716140 TAGGCTCAGCAAACTCATTCTGG + Intergenic
944507092 2:200424134-200424156 TAATCCAATCAAAATCATCCTGG + Intronic
944659627 2:201910567-201910589 TGGGCCCACCTAGATAATCCAGG - Intergenic
945121628 2:206463231-206463253 TGGGCCCACCCAGATAATCCAGG - Intronic
945750463 2:213776200-213776222 TGGGTCCACCAACATAATCCAGG - Intronic
946552071 2:220813046-220813068 GAAGCCGACCAAATTCATCCAGG + Intergenic
947152776 2:227131732-227131754 AGGGCCCACCTAAATCACCCAGG - Intronic
947990643 2:234484922-234484944 CGGGCCCACCCAAATAATCCAGG - Intergenic
1169928147 20:10804168-10804190 AAAGCCCACCCAAATAATCCAGG - Intergenic
1170067902 20:12334468-12334490 TAGGCCCACCCAGATAATACCGG + Intergenic
1174032610 20:47642231-47642253 GTGGCCCAACAAGATCATCCAGG - Exonic
1174539760 20:51279715-51279737 TGGGCCCACCCAGGTCATCCAGG - Intergenic
1174551913 20:51368325-51368347 AGGGCCCACCCAGATCATCCAGG + Intergenic
1174673444 20:52330533-52330555 TCAGCCAATCAAAATCATCCAGG - Intergenic
1175131435 20:56792664-56792686 TGGGCCCACCTTAATAATCCAGG - Intergenic
1175239009 20:57533050-57533072 TAGGCCCACCTGAAGAATCCAGG - Intergenic
1175275739 20:57769428-57769450 TGGGCCCACCAGGATCATTCAGG - Intergenic
1175312497 20:58021338-58021360 CAGGCCCACCCAGGTCATCCAGG + Intergenic
1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG + Intergenic
1175972703 20:62694870-62694892 TTGGCCCACCCAGATCATCCAGG - Intergenic
1176013153 20:62911315-62911337 TGGGCTCACCAGAATCCTCCAGG + Exonic
1176813344 21:13569004-13569026 TAGGCCCAGCTAGATAATCCAGG + Intergenic
1177315941 21:19461189-19461211 TTGGCCCACCCAGATAATCCAGG - Intergenic
1177770732 21:25512768-25512790 TGGGCCCACCCAGATAATCCAGG - Intergenic
1178134374 21:29610363-29610385 TAGGCCCACCCAGATAATCCGGG - Intronic
1178277151 21:31249425-31249447 CAGCCCCAGCAAACTCATCCAGG + Intronic
1178854108 21:36236725-36236747 AAAACCCACCAAAGTCATCCAGG - Intronic
1179011345 21:37558588-37558610 TAGGCCCACCCAGATAATCCAGG + Intergenic
1179013050 21:37571243-37571265 TAGGTCCACTAAGATTATCCAGG - Intergenic
1179140059 21:38717482-38717504 TAGGCCCACCTCAATATTCCAGG - Intergenic
1179181900 21:39052907-39052929 GAGGCCCACCCAAATTATCAAGG + Intergenic
1179252078 21:39679084-39679106 TAGGCCCACCCACATTATCCAGG + Intergenic
1181562752 22:23715224-23715246 TAGGCCCCCCAAAGGGATCCAGG + Intergenic
1182106310 22:27692266-27692288 TTGGCCCACCAAGATAATCCAGG - Intergenic
1182667329 22:31969380-31969402 CAAGCCCACCTAAATTATCCAGG + Intergenic
1183436185 22:37796845-37796867 TGGGCCCACCAGGATAATCCAGG + Intergenic
1183672541 22:39281554-39281576 TGGGCCCACCCAAATCATCCAGG - Intergenic
1184144703 22:42602769-42602791 GAAGCTCACCAAAACCATCCAGG - Exonic
1184364349 22:44040446-44040468 TGGGCCCACCCAAATAACCCAGG - Intronic
949107919 3:223019-223041 TTGGCCCACCCACATAATCCAGG + Intronic
949438581 3:4056051-4056073 TGGGCCCACCCAGATAATCCAGG + Intronic
949807777 3:7974390-7974412 TAGGCTCACCACAATGACCCAGG + Intergenic
950132127 3:10554436-10554458 TTGGCCCACCCAGATCATCCAGG - Intronic
950990280 3:17428913-17428935 TAGGACCTGGAAAATCATCCAGG - Intronic
951512970 3:23525192-23525214 TGGGCCCACCTAAATAATCCAGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955097623 3:55815372-55815394 TAGTCCCGCCAGAATAATCCAGG - Intronic
955169585 3:56550313-56550335 TGGGCCCACCCAAATTATCTAGG + Intergenic
955567860 3:60268839-60268861 TGGGCCCACCTAGATAATCCAGG - Intronic
955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG + Intronic
955686842 3:61557744-61557766 TAGGCTCACCAAGACCATCTGGG + Intergenic
957969201 3:87361460-87361482 TGGGCCCACCCAGATAATCCAGG - Intergenic
958797222 3:98718483-98718505 TGGGCCCATCCAGATCATCCAGG - Intergenic
958853792 3:99360068-99360090 TGGGCCCACCCAGATAATCCAGG - Intergenic
958931622 3:100213738-100213760 TGGGCCCACCCAAATCACCCAGG - Intergenic
960424352 3:117487884-117487906 CAGGCTCACCCAGATCATCCAGG - Intergenic
960748539 3:120918209-120918231 TGGGCCCACCAGGATAATCCAGG + Intronic
960945266 3:122962053-122962075 TGGGCCCATCTAGATCATCCAGG + Intronic
962877274 3:139544869-139544891 TATGCCCACCCAGATAATCCAGG + Intergenic
963617500 3:147560285-147560307 TGGGCCCACCCAAATAATCCAGG + Intergenic
964298176 3:155257223-155257245 TGGGCCCACCCAGATAATCCAGG - Intergenic
964562806 3:158016869-158016891 TAAGCCCACCTAGATAATCCAGG + Intergenic
965045963 3:163576950-163576972 TAGACCCACCACAATATTCCAGG + Intergenic
965178566 3:165368319-165368341 TAGGTTCACCAAAATCATTCTGG - Intergenic
967090443 3:186130418-186130440 AAGGCCCACGAAAATCTCCCTGG - Intronic
967655442 3:192042780-192042802 TAGGCCCAACATAATCACCAAGG + Intergenic
967819814 3:193830571-193830593 TGGGCCCAGCAAATTCAGCCTGG - Intergenic
969961508 4:10948999-10949021 TAGGCCCACCTAAATTATTGAGG - Intergenic
970774115 4:19652349-19652371 TGGGCCCACCTAGATTATCCGGG + Intergenic
971004925 4:22362556-22362578 TAGGCCCACCTGGATTATCCAGG + Intronic
971539382 4:27796520-27796542 TAGGACCACCAAAGTGAACCTGG + Intergenic
971835950 4:31762838-31762860 TTGGCCCACTAAGATAATCCAGG + Intergenic
971968221 4:33590761-33590783 TGGGCCCACCCACATAATCCAGG - Intergenic
972027160 4:34396878-34396900 AAGGCTCACCCAAATAATCCAGG + Intergenic
974183003 4:58407319-58407341 AAGGCCCACCCAAATTATCAAGG - Intergenic
975653178 4:76614801-76614823 TAGGCCAACCAAAACAAGCCTGG + Intronic
976932575 4:90586963-90586985 TAGGCCCACGAAGGTAATCCGGG - Intronic
978941143 4:114437187-114437209 TGGGCCCAACAAAATAATTCAGG - Intergenic
979503720 4:121469064-121469086 TAGGCCCACACAGATAATCCAGG + Intergenic
981141836 4:141278093-141278115 TAGGCCTACCCAGATAATCCAGG - Intergenic
981356458 4:143794930-143794952 TGGGCCCACCTAGATAATCCAGG + Intergenic
981367990 4:143925524-143925546 TGGGCCCACCTAGATAATCCAGG + Intergenic
981377786 4:144035803-144035825 TGGGCCCACCTAGATAATCCAGG + Intergenic
982044054 4:151424189-151424211 TAGGCCAACCAGAACCATTCCGG - Intronic
983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG + Intergenic
984073521 4:175147007-175147029 GAGGCCCAGCAAACTCATGCTGG + Intergenic
986658905 5:10041651-10041673 TGGGCCCACCCAGATAATCCAGG + Intergenic
986664630 5:10090050-10090072 TTGGCCCACCAGGATAATCCAGG - Intergenic
986692064 5:10321223-10321245 AGGGCCCACCCAGATCATCCAGG + Intergenic
986855644 5:11865722-11865744 TAAGCCCACCTCAATAATCCAGG - Intronic
989254638 5:39352979-39353001 TGGGCCCAACAAAATAATACAGG - Intronic
990865351 5:60373940-60373962 TGGGCCCACCCAGATAATCCAGG + Intronic
990867100 5:60391660-60391682 TGGGCCCACCAGGATAATCCAGG + Intronic
991429703 5:66531378-66531400 TGGGCCCACCCAGATAATCCAGG + Intergenic
992578183 5:78141783-78141805 AATGCCCACAAAAATCATCCAGG + Intronic
992591832 5:78303574-78303596 AAGGCCCACCAAGTTAATCCAGG + Intergenic
993384143 5:87243932-87243954 TTGGTCCACCACAGTCATCCAGG + Intergenic
993560700 5:89403686-89403708 TGGGACCACCAGAATAATCCAGG - Intergenic
993921317 5:93807461-93807483 TAGCACCAGGAAAATCATCCTGG + Intronic
994044558 5:95293346-95293368 TGGGCCCACCTAGATAATCCAGG + Intergenic
994224195 5:97232929-97232951 CATTCCCACCAAAATCCTCCTGG - Intergenic
994531024 5:100971320-100971342 TAAACCCACCAGAATCACCCAGG - Intergenic
995024392 5:107402355-107402377 TATGCACAACAAAATCATGCAGG + Intronic
995154630 5:108895631-108895653 TAGGCCCACCTGAATAATACAGG + Intronic
995412416 5:111873685-111873707 TGGGCCTACCCAAATAATCCAGG + Intronic
997927899 5:138047638-138047660 TGGGCCCACCCAGATAATCCGGG - Intronic
998812810 5:145983456-145983478 CAGGCCCACCCAAATCCTCAGGG + Intronic
999194028 5:149769893-149769915 TAGGCCCACCCAGGTCATCCGGG + Intronic
999438483 5:151582535-151582557 CAGTCACACCAAAATCACCCAGG - Intergenic
1000305192 5:159988053-159988075 CAGGCCCACCAGGATAATCCAGG - Intergenic
1004274875 6:14227207-14227229 AGGGGCCACCACAATCATCCAGG - Intergenic
1007148179 6:39658957-39658979 TAGGCCCACCCAAACTATCCTGG + Intronic
1008669087 6:53748248-53748270 TGGGCCCACCCAGATAATCCAGG - Intergenic
1009596888 6:65746765-65746787 TTGGCCCACTAAAATTTTCCAGG + Intergenic
1011614603 6:89186343-89186365 CAGGCCCACCCAGATTATCCAGG - Intronic
1012815196 6:104015375-104015397 TAAGCCCACCCAATTCTTCCAGG + Intergenic
1012934418 6:105351215-105351237 CAGGCCCACTCAAATTATCCAGG - Intronic
1013424304 6:109996935-109996957 AGGGCCCACCAAGATAATCCAGG + Intergenic
1013776733 6:113687235-113687257 TGGGCCCACCCAAATAATCTGGG + Intergenic
1013788706 6:113811999-113812021 TAGGCCCACCCACATAATCCAGG + Intergenic
1014956231 6:127620108-127620130 TTGGCCAACCCAAATTATCCAGG - Intergenic
1015191068 6:130472923-130472945 TAGGCCCACCGGAATAACCCAGG - Intergenic
1016396462 6:143628610-143628632 TAGGCCCATCCAGATAATCCAGG + Intronic
1016918978 6:149272606-149272628 TGTGCCCACCCAAATCATCCAGG + Intronic
1017468554 6:154717478-154717500 AGGGCCCACCCAAATAATCCAGG - Intergenic
1018392078 6:163348241-163348263 TAGGCCCACCTGAATCATCCAGG - Intergenic
1018498949 6:164381887-164381909 TGGGCCCACCCAGATAATCCAGG - Intergenic
1018626259 6:165781629-165781651 TTGGGCCCCCAAGATCATCCAGG - Intronic
1019904897 7:4054532-4054554 TAAGGCCACAAAAATCATCTGGG + Intronic
1020367654 7:7397352-7397374 AAGGCCCACCCAGATAATCCAGG + Intronic
1020911503 7:14137604-14137626 TAGGCCCACCTGGATAATCCAGG + Intergenic
1021261719 7:18466642-18466664 TGGGCTCACCCAAATAATCCAGG + Intronic
1021897726 7:25252964-25252986 TGGGCCCACCCAGATAATCCAGG - Intergenic
1021955976 7:25824785-25824807 TAGACCCACCAAAATCACAGAGG - Intergenic
1022620684 7:31980922-31980944 TGGGCCCACCCAGATGATCCAGG + Intronic
1022958957 7:35407199-35407221 TAAACCCTTCAAAATCATCCAGG - Intergenic
1023712150 7:43006381-43006403 TGGAGCCCCCAAAATCATCCTGG - Intergenic
1023914036 7:44575075-44575097 TAGGCCCATCCAGATGATCCAGG + Intergenic
1024514105 7:50229488-50229510 TAGGAACACCAATTTCATCCAGG + Intergenic
1026144362 7:67733694-67733716 GAGGCCCACCAAAGTCATAGAGG + Intergenic
1026300684 7:69095470-69095492 TGGCCCCAGCAAAATCATCCAGG + Intergenic
1027249010 7:76387111-76387133 TAGGCCCACCTACGTAATCCTGG - Intergenic
1027428826 7:78088888-78088910 TAGGCCCACCCAAACAATCCTGG - Intronic
1028017167 7:85730773-85730795 AAGACACACCAAATTCATCCTGG + Intergenic
1028162429 7:87500582-87500604 AGGGCCCACCAGAATAATCCAGG + Intergenic
1028534193 7:91873454-91873476 TAGGCCCTCCAAAGTAATTCAGG + Exonic
1031739215 7:125407719-125407741 TGGGCCCACTAAAATAATCCAGG - Intergenic
1031869889 7:127080103-127080125 TGGGCCCACCAGAATCATCTGGG - Intronic
1032716787 7:134515627-134515649 CGGGCCCACCAGAATAATCCAGG + Intergenic
1032894218 7:136233098-136233120 TGGGCCCTCCAAATTAATCCAGG - Intergenic
1033582918 7:142752864-142752886 CAGGGCCACCAGAATCACCCTGG - Exonic
1033585944 7:142774352-142774374 CAGGGCCACCAGAATCACCCTGG - Intergenic
1033625123 7:143103472-143103494 TAGGCCCACCCAGATAACCCTGG + Intergenic
1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG + Intronic
1036152636 8:6312944-6312966 TGGGCCCACCTGGATCATCCAGG - Intergenic
1036527604 8:9549632-9549654 TAGGCCCACTCACATAATCCAGG + Intergenic
1036954862 8:13176795-13176817 TGGGCCCACCTAGATAATCCAGG - Intronic
1037214145 8:16427932-16427954 TGGGCCCACTGAAATAATCCAGG - Intronic
1037402566 8:18507605-18507627 TTGGCCCACCCAAGTAATCCAGG + Intergenic
1037701740 8:21281579-21281601 GAGGCCCATCAGAATAATCCAGG - Intergenic
1038127038 8:24686010-24686032 TAGGCCCACCCAGATATTCCAGG + Intergenic
1038748231 8:30272718-30272740 TGGGCTCACCAAGATGATCCAGG - Intergenic
1038923175 8:32108618-32108640 GGGGCCCACCGAGATCATCCAGG - Intronic
1039459651 8:37733014-37733036 TAAGCTCACCAAAATCTTACTGG + Intergenic
1039472138 8:37820148-37820170 GAGGCCCACCCACATCATACAGG + Intronic
1041426117 8:57722532-57722554 TAGGCCCATCTACATAATCCAGG - Intergenic
1041773822 8:61502276-61502298 TACGCCCAAGAAAAACATCCTGG + Exonic
1042821659 8:72936460-72936482 GTGGCCCACCAAAATGATGCAGG - Exonic
1043170006 8:76954012-76954034 TGGGTCCACCAAGATAATCCAGG - Intergenic
1043986999 8:86705519-86705541 TGGGCCCACCCAGATAATCCAGG - Intronic
1044647628 8:94460930-94460952 TGGGCCCACTCAGATCATCCAGG + Intronic
1045000623 8:97875049-97875071 TTGGCCCACCTAGATAATCCAGG + Intronic
1045401867 8:101827283-101827305 TGGGCCCACCCACATAATCCAGG + Intronic
1047052565 8:121129154-121129176 TGGGCCCACCTAGATGATCCAGG - Intergenic
1047120837 8:121902752-121902774 TGGGCCCACCTGAATAATCCAGG - Intergenic
1048166643 8:132067438-132067460 TAAGCTCACAAAAAGCATCCTGG - Intronic
1048247979 8:132830302-132830324 TGGGCCCACCCATATGATCCAGG + Intronic
1048556065 8:135477727-135477749 CAGGTCCACCCAAATGATCCAGG - Intronic
1048745534 8:137610763-137610785 TGGGCCCACCAAAATAATCCAGG + Intergenic
1048828892 8:138456941-138456963 AAGGACCAGGAAAATCATCCTGG + Intronic
1050911962 9:11082591-11082613 AGGGCCCACCAGAATAATCCAGG - Intergenic
1051042367 9:12826816-12826838 AAGGCCCACCCAGATAATCCAGG - Intergenic
1051738174 9:20224783-20224805 TAGCCCCACGAAAATGATCTGGG - Intergenic
1053470377 9:38342025-38342047 TGGGCCCACCCAGATAATCCAGG + Intergenic
1055086398 9:72318322-72318344 TGGACCCACCCAGATCATCCAGG - Intergenic
1055671179 9:78607680-78607702 TGGGCCCACACAAATAATCCAGG - Intergenic
1055899049 9:81213448-81213470 GAGGTCCACCAGAATCTTCCAGG + Intergenic
1056821749 9:89847156-89847178 TGGGCCCACCCAGATAATCCAGG - Intergenic
1057236328 9:93364869-93364891 GGGGCCCACCCAGATCATCCAGG - Intergenic
1058255055 9:102751379-102751401 TGGGCCCACCAAAATAGTCCAGG - Intergenic
1061945491 9:133906396-133906418 TAGGCCCATCACAGTCCTCCGGG + Intronic
1062240858 9:135537170-135537192 TGGGCCCACCCAGATAATCCAGG + Intergenic
1185537169 X:871590-871612 TAGGCTCACCAAGTTCAGCCTGG - Intergenic
1185540182 X:897156-897178 TAGACCCACCTAGATAATCCAGG + Intergenic
1185569597 X:1123462-1123484 CAGGCACCCCAAAATCACCCTGG + Intergenic
1185858979 X:3560191-3560213 TAGGCCCACCCACATCATGGAGG - Intergenic
1186601183 X:11039037-11039059 TCTGCCCGCCAAAATCATCTAGG + Intergenic
1186676027 X:11818343-11818365 TGGGCCCACCTAGATAATCCAGG - Intergenic
1186965814 X:14785203-14785225 TGGGCCCACCTAGATAATCCAGG + Intergenic
1187306783 X:18102319-18102341 TGGGCCCACCCAAAGAATCCAGG - Intergenic
1187909717 X:24100235-24100257 TGGGCCCACCCAGATAATCCAGG + Intergenic
1188099216 X:26062225-26062247 TGGGCCCACCTAGATAATCCAGG - Intergenic
1188354987 X:29179578-29179600 CAGGCCCACCCAGATAATCCAGG - Intronic
1188382252 X:29509292-29509314 CAGGCCCACCCAGATTATCCAGG + Intronic
1189722270 X:43932578-43932600 TGGGCCCACCCAGATAATCCAGG - Intergenic
1189729638 X:44005454-44005476 TGGGTCCACCAAAATAATCCAGG + Intergenic
1190024507 X:46911769-46911791 CAGGCCCACCTAGATTATCCAGG + Intergenic
1190040122 X:47064511-47064533 TGGGCCCACCTAGATAATCCAGG - Intergenic
1190577224 X:51852270-51852292 TGGGCTCACCAAGATAATCCAGG + Intronic
1191882660 X:65858094-65858116 TGGGCCCACCCAGATAATCCAGG + Intergenic
1197138062 X:123085877-123085899 TAGGCCCACCCAGATAATCCAGG + Intergenic
1198057348 X:133008163-133008185 TGGGCCCACCCAGATCATCCAGG + Intergenic
1199512226 X:148635166-148635188 TAGGCCCACCACGATAATCCAGG - Intronic
1199718939 X:150528061-150528083 GAGGCCCACCCACATCATCGAGG - Intergenic
1199785346 X:151100319-151100341 TAGGCCCTCTAAGATCATCCGGG + Intergenic
1201682490 Y:16663100-16663122 TGGGCCCACTTAAATAATCCAGG + Intergenic
1201942681 Y:19476750-19476772 AAAGCCCAGCAAAATCATTCAGG + Intergenic
1201983281 Y:19930909-19930931 TAAAACCACAAAAATCATCCGGG - Intergenic