ID: 1085280855

View in Genome Browser
Species Human (GRCh38)
Location 11:75329505-75329527
Sequence TTAACAGGAGGGGCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085280855_1085280861 16 Left 1085280855 11:75329505-75329527 CCTTGCAGAGCCCCTCCTGTTAA 0: 1
1: 0
2: 2
3: 17
4: 162
Right 1085280861 11:75329544-75329566 AGCTGTCTCTTTGTGTAAGATGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085280855 Original CRISPR TTAACAGGAGGGGCTCTGCA AGG (reversed) Intronic
900016634 1:155138-155160 TTAATAGGAGAGGCAATGCATGG + Intergenic
900046895 1:513730-513752 TTAATAGGAGAGGCAATGCATGG + Intergenic
900069099 1:755448-755470 TTAATAGGAGAGGCAATGCATGG + Intergenic
900130003 1:1083346-1083368 TTAGAAGAAGGGGCTTTGCAGGG + Intronic
900679375 1:3907937-3907959 TTCTCAGGTGGGGCTTTGCAGGG + Intergenic
903391826 1:22969778-22969800 TTACCATGAGCGGCTCTGCCTGG - Intergenic
903611771 1:24620100-24620122 AAAACAGGAGGGGCTCTACATGG - Intergenic
904563066 1:31411700-31411722 TTAAGAGGAGGGCATCTGCCAGG + Intronic
905115023 1:35631152-35631174 GCAACAGGAGGGGTTCTGGAAGG + Intronic
906726829 1:48050338-48050360 TGATCAGGTGGGGCTTTGCAGGG - Intergenic
909610648 1:77548423-77548445 ATAACAGCAGCGGCTCAGCAAGG - Intronic
917123403 1:171664410-171664432 TTATCAGGAGGGCCTTTCCATGG - Intergenic
921295130 1:213694099-213694121 TTAACAGGAGGTGCTAGGAAAGG + Intergenic
922264780 1:223973355-223973377 TTAATAGGAGAGGCAATGCATGG + Intergenic
923010843 1:230086334-230086356 TGACCAGGAGGTGCTCTGCTGGG - Intronic
923273047 1:232374517-232374539 TCATCAGGAAGGGCTCTGCTTGG - Intergenic
923741367 1:236657994-236658016 TTAAGAGGAGAGGCTGGGCACGG - Intergenic
924038299 1:239957859-239957881 GGAGCAGGAGGGGCTCAGCAGGG - Intergenic
1070335941 10:75455269-75455291 TAAACAGGAGGAGACCTGCAAGG - Intronic
1074185678 10:111097989-111098011 ATAACAGGCCTGGCTCTGCATGG + Intergenic
1075553588 10:123412602-123412624 TTGAAAGCAGGGTCTCTGCAGGG + Intergenic
1076610393 10:131722584-131722606 CTCAGAGGAGGGGCTCTGGACGG - Intergenic
1076973225 11:150207-150229 TTAATAGGAGAGGCAATGCATGG + Intergenic
1077848491 11:6051124-6051146 CTAAGAGGAGGGCCCCTGCAAGG - Intergenic
1078453459 11:11457308-11457330 TCAGCAGAAGGGGATCTGCAGGG - Intronic
1078962583 11:16295638-16295660 TAAAGAGGAGGGGGTCAGCAAGG - Intronic
1079229483 11:18637270-18637292 TTAACTGGATGGGCTGGGCATGG - Intergenic
1079574360 11:21985059-21985081 TTATCTGGAGGGGCTCTGTGGGG - Intergenic
1080606060 11:33865745-33865767 TGAACAGGAGATGCTATGCATGG - Intronic
1082002324 11:47400116-47400138 GTAGCAGGAGGGGGTCTCCAGGG + Intergenic
1084705822 11:70815514-70815536 GTAACAGGAAGGGGGCTGCAAGG - Intronic
1085280855 11:75329505-75329527 TTAACAGGAGGGGCTCTGCAAGG - Intronic
1086511577 11:87563772-87563794 TTAATACTAGGGGTTCTGCAGGG + Intergenic
1086521722 11:87676017-87676039 TTTGCAGGAGGGGCTCTCCAGGG - Intergenic
1087586651 11:100130556-100130578 TTATCAAGCAGGGCTCTGCAGGG + Intronic
1088751157 11:112843235-112843257 TTCACAGGAGGGGCTCTGGGGGG - Intergenic
1088900145 11:114109606-114109628 TTAAGAGGATGGCCTCTGCAAGG - Intronic
1089632898 11:119794517-119794539 GGAAGTGGAGGGGCTCTGCAAGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090053459 11:123401426-123401448 TTAAGAGCATGTGCTCTGCACGG - Intergenic
1090336093 11:125966505-125966527 TTAACTGGAGTCTCTCTGCAGGG + Intronic
1091294002 11:134459723-134459745 ATAACAGCAGCAGCTCTGCAGGG - Intergenic
1091912946 12:4246368-4246390 CTGACAGCAGGGCCTCTGCAAGG + Intergenic
1094418097 12:30238855-30238877 TGAACATGAGAGGCCCTGCAGGG - Intergenic
1097590626 12:61570635-61570657 TGGAAAGGAGGGGCTCAGCAAGG + Intergenic
1098846282 12:75539380-75539402 TGCACAGAAGGGGATCTGCAGGG + Intergenic
1101396645 12:104354575-104354597 TTAGCAGGAAGGGTACTGCAGGG - Intergenic
1103216402 12:119204918-119204940 TTACCACGTGGGGCTCTCCATGG + Intronic
1103911023 12:124352339-124352361 TTAAAAAGGGGGGCTCTCCATGG + Intronic
1104033401 12:125081287-125081309 TTAAAAGAAGGGGCTCTGCTAGG - Intronic
1104108651 12:125686442-125686464 TTAACAGCTGGGGATCTGAAGGG - Intergenic
1109130554 13:58579100-58579122 TTCACAATAGGGGATCTGCAAGG - Intergenic
1117848381 14:59938065-59938087 TTAGCAAGAGGGGCTGTGTAGGG + Intronic
1119421994 14:74512692-74512714 TTTTCAGGTGGGTCTCTGCAAGG + Intronic
1122781108 14:104143934-104143956 CTACCAGGAAGGGCTCTGCTCGG + Intronic
1125476879 15:40053769-40053791 TTCAGAGGCAGGGCTCTGCAAGG - Intergenic
1126011798 15:44310178-44310200 TTAAAAGAAGGGGCTCTGGCTGG - Intronic
1126482564 15:49142352-49142374 TTAATAGGAGGGGCACTCCATGG - Intronic
1126561387 15:50048170-50048192 TTAACAGGAGGGGAGCTCCTGGG + Intronic
1128229653 15:66025626-66025648 TTAACAGGAGTGGATCTGGGTGG - Intronic
1128739052 15:70071210-70071232 TTAACAGGAGGGGCTTTAGAAGG - Intronic
1129165004 15:73771847-73771869 TGAGCAGGAGGGGCTCTGATAGG + Intergenic
1130081171 15:80735007-80735029 CTAACAGCAGAGGCTCTGGAAGG - Intronic
1130223443 15:82040630-82040652 GTAAAAGGAGTGGCTCTGCTTGG - Intergenic
1131993118 15:98109519-98109541 CTGACAGGAGGGGCTGTGCCTGG + Intergenic
1132549841 16:549839-549861 GTAAGAGGAGGGGCACTGCGTGG + Intronic
1132713418 16:1279104-1279126 GGAGCAGGAGGGGCTCAGCAGGG + Intergenic
1135273156 16:21086139-21086161 TTACCAGGAGTCGCTCTGTATGG - Intronic
1135491153 16:22910860-22910882 CTAGCAGGAGGGGCTCAGGATGG + Intronic
1138913283 16:61429411-61429433 TTAACAAGAGGGGAATTGCAAGG - Intergenic
1141638867 16:85329742-85329764 TTAGCAGGTGCGGCTCTGAAAGG - Intergenic
1141800079 16:86301514-86301536 TTAACTGGAGAGTTTCTGCAGGG + Intergenic
1142447026 16:90147319-90147341 TTAATAGGAGAGGCAATGCATGG - Intergenic
1142460466 17:88012-88034 TTAATAGGAGAGGCAATGCATGG + Intergenic
1147611400 17:41803665-41803687 TTAAAAGGTGGGGCTGTGCAGGG - Intronic
1152331919 17:79678459-79678481 CTAACAGGAGGGGACCCGCAGGG + Intergenic
1152569948 17:81117230-81117252 TGGACAGGAGGGGCTGTGCCAGG - Exonic
1155234618 18:23806687-23806709 TTAACAGCAGATACTCTGCAAGG + Intronic
1155372881 18:25121665-25121687 ACAACAGGAGGGGCTCTGAGAGG + Intronic
1158594862 18:58807210-58807232 TTCACAGGAGGGGTTGGGCACGG - Intergenic
1158887861 18:61845900-61845922 TTAACAGGTGGGGCTTTGTGTGG + Intronic
1160650181 19:220512-220534 TTAATAGGAGAGGCAATGCATGG + Intergenic
1161452223 19:4352889-4352911 TTCACTGGCTGGGCTCTGCAGGG - Exonic
1161984316 19:7645351-7645373 ATCACAGCCGGGGCTCTGCAAGG + Intronic
1163771808 19:19195648-19195670 GTAACAGGAGGGCCTCCCCAAGG - Intronic
1164051861 19:21590605-21590627 TTCACAGGAGGCGAACTGCAGGG + Intergenic
1164055197 19:21616254-21616276 TTAACAGGAGAGACTGAGCATGG + Intergenic
1164966497 19:32489415-32489437 TTAAGGGGAAGGGCTCTGCAGGG + Intergenic
1166054134 19:40278655-40278677 AGCACAGAAGGGGCTCTGCAGGG - Intronic
1166271432 19:41716678-41716700 TTCACCACAGGGGCTCTGCACGG + Intronic
925193070 2:1900883-1900905 TCCACAGGAGGGCCTCTGCCGGG + Intronic
929006246 2:37396040-37396062 GCAACAGGAAGGTCTCTGCAGGG + Intergenic
933599139 2:84312248-84312270 TGTAGAGGAGGGGCTCTGCCAGG + Intergenic
937815998 2:126251349-126251371 GTAAGAGGAAGGGCACTGCAGGG + Intergenic
939618352 2:144386521-144386543 GTAACAGGAGGGGCAAGGCAGGG + Intergenic
1168771101 20:417497-417519 AGAACAGCAGGGGCTCAGCATGG - Intronic
1171062616 20:21981167-21981189 TTAATAAGAGGGGCTCTGCAAGG - Intergenic
1171980004 20:31621056-31621078 TCAACATCAGGGCCTCTGCAAGG + Intergenic
1173094789 20:40015088-40015110 TTAAGAGGAGGGGCTCATCTGGG + Intergenic
1174767715 20:53269458-53269480 GTAACAAGTGGGGCTTTGCAAGG - Intronic
1175085470 20:56454961-56454983 ATGACTGTAGGGGCTCTGCAAGG + Intronic
1178465042 21:32840368-32840390 TTAACAGTGCGGGCTCTTCAGGG + Intergenic
1179187816 21:39098095-39098117 TTAACGGGAAGGGCTCTGCAAGG - Intergenic
1180098654 21:45574181-45574203 TTAGCACGGGTGGCTCTGCAGGG - Intergenic
1182590527 22:31376128-31376150 TTAAAAGGAAGGGCTGGGCACGG - Intergenic
1184036184 22:41919468-41919490 ATACCAGGAGGGGTTCTGGAGGG + Intergenic
1184105835 22:42367134-42367156 AAAACAGGAGTGGCTCAGCAAGG - Intergenic
949335323 3:2968468-2968490 TTAACAAGAGGAACTCTGGATGG - Intronic
951558576 3:23945095-23945117 GGAAGAGGAGGGGCTCGGCAAGG + Intronic
951871256 3:27365025-27365047 TTAACAGGAAGGGTTCTGCCTGG - Intronic
952483755 3:33788812-33788834 TTGCCAGGAGGGTTTCTGCATGG - Intergenic
952891321 3:38043603-38043625 TTAGCAGGAGGGGCCTGGCAAGG - Intronic
953249909 3:41235717-41235739 TTGGCAGGAGGGGGTCCGCATGG + Exonic
954472471 3:50709533-50709555 TAAACAGGTGGGGCTGGGCATGG + Intronic
954982488 3:54759109-54759131 TTCACAGAAGGAGCTCTGCAAGG + Intronic
955212915 3:56958790-56958812 TTAACAGCAGGGGCTACCCAGGG + Intronic
956079907 3:65547593-65547615 TTAAAAGCAGGAGCTCTGGAGGG + Intronic
959424717 3:106172671-106172693 TTAAAAGGAGGGTCTCTAAAAGG - Intergenic
960370892 3:116837691-116837713 TTAACAGCAGAGACTCTCCAGGG + Intronic
961045695 3:123706395-123706417 TGAACATGATGGGCTCAGCATGG + Intronic
966492394 3:180542477-180542499 TTAACAGAAGGGCCTCTTCAGGG - Intergenic
967933559 3:194708272-194708294 TCACCAGGAGGGACTCTGTATGG + Intergenic
968367666 3:198199617-198199639 TTAATAGGAGAGGCAATGCATGG - Intergenic
969087118 4:4664727-4664749 TAAACTGGAGGTGCTCAGCAAGG - Intergenic
969456089 4:7300453-7300475 TTCACAGGAGAGGCTCAGCAGGG - Intronic
970669056 4:18375162-18375184 TTGCCAGTAGGGACTCTGCAGGG - Intergenic
973540349 4:51928836-51928858 TTAACAGTAGACACTCTGCAAGG + Intergenic
986713456 5:10504277-10504299 TTATCAGGAGGGACACTCCAAGG + Intergenic
988984469 5:36603265-36603287 TTAAGAGAAGGGGCTGTGCCTGG - Intergenic
989400480 5:41002848-41002870 TTAACAGCTGGGGTTCTGAAGGG + Intronic
990068342 5:51747076-51747098 TTCAAAGGAGGGGCCCGGCATGG - Intergenic
990211101 5:53481994-53482016 TTTAGAGGAGAGGCTCTGCCTGG + Intronic
992225442 5:74615923-74615945 TCAACAGAAGGGGCTCTTCATGG + Intergenic
995285219 5:110380763-110380785 ATAACAGGAGAGGCTATGCAAGG - Intronic
997194683 5:131970863-131970885 CAAACAGGTGGGGCTCTGGAGGG - Intronic
998261240 5:140633334-140633356 GTAACAGGAAGGATTCTGCAGGG + Exonic
1000356136 5:160397949-160397971 ATTACAAGAGGGGCCCTGCACGG + Intronic
1002097564 5:176840475-176840497 ATAACACGTTGGGCTCTGCAAGG + Intronic
1002571490 5:180142116-180142138 TCAGCATGAGGGGCTCAGCATGG + Intronic
1002726886 5:181304846-181304868 TTAATAGGAGAGGCAATGCATGG - Intergenic
1002881499 6:1256605-1256627 TTGATGGCAGGGGCTCTGCAGGG + Intergenic
1003735052 6:8868932-8868954 TTTAGAGGAGGAGCTCTGCCTGG + Intergenic
1004093550 6:12530042-12530064 TTAACAGTTGGGGCTGTGGAGGG - Intergenic
1006512497 6:34529169-34529191 CTGACAGGAGGGTATCTGCAGGG + Intronic
1007822897 6:44574297-44574319 TTAACAGCATGTGCTCTTCATGG + Intergenic
1009466956 6:63982752-63982774 ATAACAGGAGGGGGATTGCAGGG + Intronic
1012162227 6:95900148-95900170 TTAGCAAGAGGGGCTCTTAATGG + Intergenic
1014016837 6:116540910-116540932 TTTCCAGGATGGGCTCTGGAAGG + Intronic
1015785064 6:136914911-136914933 GCAACAGAAGGGGCTCAGCATGG + Intergenic
1022028105 7:26467268-26467290 TGCACAGGAGGGGCTCGGCCTGG + Intergenic
1026016603 7:66676413-66676435 TTATAAGCAGGGGTTCTGCAGGG - Intronic
1032087743 7:128892642-128892664 TGCCCAGGAGGGGCTCAGCAGGG + Intronic
1032511295 7:132474714-132474736 TCCAGAGGTGGGGCTCTGCAGGG - Intronic
1033922563 7:146412195-146412217 TTAACAGGAGCCGACCTGCAGGG - Intronic
1036102466 8:5802111-5802133 TTATTAGGAAGGGGTCTGCAGGG + Intergenic
1036988458 8:13564828-13564850 GTAACAGGAGGGGCATAGCAAGG + Intergenic
1037763477 8:21757237-21757259 TTAACAGGAGAGGCTGGGCTGGG - Intronic
1038703389 8:29872282-29872304 TCATCAGGAGGAGCTCAGCATGG - Intergenic
1040839521 8:51770414-51770436 TTAGCTGGAGGGGCTCAGCATGG + Intronic
1042554689 8:70023989-70024011 TTGAAAGGATGGCCTCTGCAAGG - Intergenic
1042877178 8:73449863-73449885 CTGGCAGGAGGAGCTCTGCAGGG + Intronic
1045007946 8:97932401-97932423 TTAACAGGTGGGGAGCTGCCAGG - Intronic
1045527704 8:102955679-102955701 TTAAAATGAGGGGCTGGGCATGG + Intronic
1046036620 8:108850477-108850499 TCCACAGCAGGGGCTCTGCACGG + Intergenic
1049721727 8:144119451-144119473 CAAGCAGTAGGGGCTCTGCAGGG + Intergenic
1051912381 9:22168859-22168881 TTAAAAGGAAGGTCTCTGGATGG + Intergenic
1052978666 9:34430925-34430947 CAAACAGGAGGAGCTCTCCAGGG + Intronic
1053368153 9:37538410-37538432 TTAAAAGCATGGGCTCTGCCAGG + Intronic
1056909088 9:90681802-90681824 AAAACAGAAGTGGCTCTGCAAGG - Intergenic
1059162450 9:112048020-112048042 TTAACAGAAGGAGCTGAGCAAGG - Intronic
1060402101 9:123355208-123355230 TGGACAGGAGGAGCTCTTCAGGG - Intergenic
1062752007 9:138262322-138262344 TTAATAGGAGAGGCAATGCATGG - Intergenic
1186767492 X:12785883-12785905 TTAGTAGGAGAGGCTGTGCATGG - Intergenic
1188550635 X:31360962-31360984 TTAAAAGGTGGGGCTGGGCATGG + Intronic
1188565953 X:31526817-31526839 TTAAAAAGAGGGGCTGGGCATGG + Intronic
1189384089 X:40522350-40522372 CAGAGAGGAGGGGCTCTGCATGG + Intergenic
1190629861 X:52376003-52376025 TTAACAGAAGAGGCTGGGCACGG - Intergenic
1195668149 X:107449123-107449145 TGACCAGGAGGGGAGCTGCAGGG + Intergenic
1196636229 X:118005966-118005988 TTAACAGCAAGGGCTGTGCCTGG + Intronic
1198590189 X:138171315-138171337 TGAACAGGAGGGAGACTGCAAGG + Intergenic
1198871724 X:141182954-141182976 TTAAGAGTATGGGCTCTGGATGG - Intergenic
1200112748 X:153750453-153750475 TGTCCAGGAGGGGCTCAGCATGG + Intergenic