ID: 1085282661

View in Genome Browser
Species Human (GRCh38)
Location 11:75341114-75341136
Sequence CCCTCAGTCTTGAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085282661 Original CRISPR CCCTCAGTCTTGAATGATGA TGG Intronic
902650486 1:17834004-17834026 CGCTCAGTCTGGAAGGATAAAGG + Intergenic
903093842 1:20949920-20949942 CTCTTACTCTTGAATGCTGACGG + Intronic
903560297 1:24222080-24222102 CCCTCTGTCCTGATTGATCATGG + Intergenic
904671240 1:32167312-32167334 CCCGTTGTCTTGAATGATAATGG + Intronic
909935761 1:81548779-81548801 CCCAAATTCTTGAATGATTAAGG + Intronic
913521066 1:119646912-119646934 CGCTCAGTCTTGAGGGAGGAGGG + Intronic
915277574 1:154800227-154800249 GCCACAGTCTGGAATCATGAGGG + Intronic
915482816 1:156198851-156198873 ACCTCAGTCTTAGATAATGAAGG - Intronic
915940961 1:160117901-160117923 CTCTGGGTCTTGAATGCTGAAGG - Intronic
916118338 1:161506816-161506838 GCCTCAGTCTTGATTGAGCAAGG + Intronic
917204373 1:172555388-172555410 CCTTCAGTCTTGAATGACCTGGG - Intronic
921053338 1:211526608-211526630 CCCTCTGTCTTGCATCATGGTGG - Intergenic
922825091 1:228512205-228512227 CCCTCAGTTTTGACAGATGCTGG + Intergenic
923813370 1:237345630-237345652 TCATCAGTCATGAATAATGATGG - Intronic
924436275 1:244047012-244047034 ACCTCAGTGATGAATCATGAGGG + Intergenic
1064204961 10:13315010-13315032 CTCTGTGTCTTGAATGAGGATGG - Intergenic
1065904272 10:30235451-30235473 CCCTCACACTTGAACAATGATGG - Intergenic
1067820389 10:49523849-49523871 CCCTGAGTCCTTAATGATGCTGG - Intronic
1071120463 10:82270953-82270975 CCCTCATCCTGGAATGAAGAAGG - Intronic
1076999563 11:315863-315885 CCCGCAGTCTTGAAATGTGACGG + Intergenic
1078399689 11:11013907-11013929 CCTTCACTCTTGAGTGATAATGG - Intergenic
1079658948 11:23017106-23017128 TCTTCACTCTTGAATCATGATGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082841770 11:57695905-57695927 CCCTTAGACTGGATTGATGAAGG - Exonic
1085282661 11:75341114-75341136 CCCTCAGTCTTGAATGATGATGG + Intronic
1085746598 11:79120100-79120122 CCCTCATTGTTGGATGAAGAAGG + Intronic
1086606886 11:88706290-88706312 CCCTAAATCTTGAGTGAGGAAGG - Intronic
1087525458 11:99305094-99305116 CCCTCATTCTGGAATGCTTATGG - Intronic
1089986153 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG + Intergenic
1090207236 11:124892213-124892235 CCATCAGTCTTGAGTGTGGAAGG - Intronic
1092066436 12:5593512-5593534 CCCTCATTCTTTAATAATTAGGG + Intronic
1094298470 12:28934796-28934818 CCCTGAGTCTTCACTGTTGATGG + Intergenic
1095948543 12:47767709-47767731 AGCTGAGACTTGAATGATGAGGG + Intronic
1097074669 12:56383988-56384010 CCCTCACTCTTAAAGGATGTAGG + Intergenic
1097805442 12:63960262-63960284 CCCTCAGTCTGAAAGGATGTTGG - Intronic
1101548593 12:105740389-105740411 CCTTCAGTTTTGAATGAACATGG + Intergenic
1102237937 12:111306414-111306436 CCCTCTGTCCTGGATGAAGATGG - Intronic
1105241738 13:18614770-18614792 CCCCCAGTCCTGAATGAAGAAGG - Intergenic
1105241768 13:18614907-18614929 CCCTCAGTCCTGGATGGAGAAGG - Intergenic
1105241843 13:18615204-18615226 CCCTCAGTCCTGGATGGAGATGG - Intergenic
1106522817 13:30512833-30512855 CACTCAGTATTGAAGGATGCAGG - Intronic
1108140530 13:47416291-47416313 CCCTCAGTCCTGCATGTTGAAGG - Intergenic
1111104198 13:83624416-83624438 TACTTAGTCCTGAATGATGAAGG - Intergenic
1113697568 13:112356966-112356988 ACCTGAGTCTGGAATGAGGAGGG - Intergenic
1116962873 14:50984995-50985017 CCCACATTCTGGAATGAAGAAGG - Intronic
1122471463 14:101969905-101969927 TCCTCATTCATGAAAGATGAGGG - Intronic
1123489548 15:20770101-20770123 CCCTCAGTCCTGGATGGAGAAGG + Intergenic
1123489585 15:20770266-20770288 CCCCCAGTCCTGGATGAAGAAGG + Intergenic
1123546047 15:21339188-21339210 CCCTCAGTCCTGGATGGAGAAGG + Intergenic
1123546084 15:21339353-21339375 CCCCCAGTCCTGGATGAAGAAGG + Intergenic
1202954390 15_KI270727v1_random:66460-66482 CCCTCAGTCCTGGATGGAGAAGG + Intergenic
1133554224 16:6889538-6889560 CACCCTGTCTTGAATGATGATGG + Intronic
1134191362 16:12123704-12123726 CCTTCAGCCCTGAATGAAGAAGG + Intronic
1135482462 16:22832518-22832540 CCCACATTCCTGAATGATGTTGG + Intronic
1137345265 16:47652088-47652110 CCCTCAGTCTTTCATGTTGGAGG + Intronic
1138220776 16:55248552-55248574 CCCTCAGTGATGAATGCGGAGGG - Intergenic
1138556794 16:57775591-57775613 CCCTCAGTCTTCCCTGAGGAAGG - Intronic
1140443705 16:75006736-75006758 ACCTCAGTCTTTTAGGATGATGG + Intronic
1145015187 17:19391878-19391900 CCCTTAGGCTGGGATGATGAGGG + Intergenic
1146672804 17:34753503-34753525 TCCTCAGCCTTGGATGATGAAGG - Intergenic
1148785012 17:50141909-50141931 CGCTCAGTCAAGTATGATGAAGG - Intronic
1154023102 18:10682550-10682572 CCCACAGTCTTGAAGGGAGAAGG - Intronic
1154042786 18:10874569-10874591 CCCTGATTCTTGAGTGTTGATGG - Intronic
1154447108 18:14444674-14444696 CCCTCAGTCCTGGATGGAGATGG + Intergenic
1154447194 18:14444999-14445021 CCCTCAGTCCTGGATGGAGAAGG + Intergenic
1154447224 18:14445136-14445158 CCCCCGGTCCTGAATGAAGAAGG + Intergenic
1155672363 18:28387736-28387758 GCCTCAGTCTAGAAGCATGATGG - Intergenic
1157692705 18:49697115-49697137 CCCTCAGGCCTGTATCATGAGGG + Intergenic
1158405673 18:57157254-57157276 CTCTCAGTCTTGAAGGACCATGG - Intergenic
1158521736 18:58176820-58176842 TCTTCAGTCTAGAATGATGCTGG + Intronic
1160104868 18:75964687-75964709 CCCCAAGTCTTGAAAGAGGAAGG - Intergenic
1162146926 19:8618109-8618131 TCCTCAGTATTAAAAGATGAAGG - Intergenic
1163814041 19:19452962-19452984 CCCTCAGTCCTCAAAGGTGATGG + Intronic
926167737 2:10532016-10532038 GGCTCAGTCCTGAAGGATGACGG - Intergenic
926936489 2:18091029-18091051 CCCAAAGTCTTGAATGAGAATGG - Intronic
928430628 2:31215562-31215584 CCCTGAGCTTTGAAGGATGAGGG - Intronic
932812837 2:74838482-74838504 CACACAGTCTTGATTGCTGAAGG - Intronic
933459928 2:82569659-82569681 CCCTCAGTTTACAAAGATGATGG - Intergenic
935803957 2:106728427-106728449 CTTTCATTATTGAATGATGAAGG + Intergenic
936731488 2:115386407-115386429 CACTCAGTGATGAGTGATGATGG + Intronic
937413970 2:121699691-121699713 CCCTCAGCCTTGCAAGGTGAAGG + Intergenic
937472846 2:122188714-122188736 ACCTCACCCTTGAATGAGGAGGG - Intergenic
938482870 2:131675781-131675803 CCCTCAGTCCTGGATGGAGAAGG - Intergenic
944335146 2:198524307-198524329 CCCTCAATGTTAAAAGATGAGGG + Intronic
945230596 2:207585097-207585119 CCCACTGTCTGGAATCATGAAGG + Intronic
945840599 2:214883446-214883468 CCCTTCGTCTTTGATGATGATGG - Intergenic
947185437 2:227451135-227451157 CCCTCAGTCTTGAAGGATAAGGG - Intergenic
948042024 2:234909750-234909772 CCCTGATTATTGAATGATCATGG - Intergenic
948370442 2:237486364-237486386 CGCCCAGTCTTGGAGGATGAGGG + Intronic
1173498858 20:43538123-43538145 GCCTCAGACCTGAGTGATGAGGG + Intronic
1178104460 21:29302158-29302180 CCCTCTGTCTAGAATGCTCAGGG - Intronic
1179122535 21:38561185-38561207 TCCTCAGTCTTTTATGATAATGG - Intronic
1180179396 21:46111322-46111344 CCCTCAGTCTTCAAGGAAGCGGG - Intronic
949439671 3:4066972-4066994 ACCACAGTCTTGATTTATGAAGG + Intronic
951422919 3:22509330-22509352 CCCTGAGTATTGAAGGATGAAGG - Intergenic
951859847 3:27239958-27239980 CCCTCAGTCTGTTATGAAGATGG + Intronic
951966237 3:28388798-28388820 CCTTCATTCTTGAGTGATGTGGG + Intronic
952291913 3:32025166-32025188 CCCTCTATCTTGTTTGATGAGGG + Intronic
953257055 3:41301164-41301186 CTCTCAGTCTTGACTAATGAAGG - Intronic
956339876 3:68210522-68210544 CCTTCAGTCTAGCATAATGAAGG + Intronic
963940293 3:151090371-151090393 GCCTGAGACTTGAATGATGAAGG - Intronic
967332738 3:188308081-188308103 CCATCAGTCCTGAATTCTGAGGG - Intronic
967875674 3:194266974-194266996 ACATCAGTCTTCAAGGATGAAGG - Intergenic
970241783 4:14016480-14016502 TCCTCAGTCTTGAAAGAGAAAGG - Intergenic
976966879 4:91054113-91054135 CCCTCAGACTTGTAGGATGAGGG + Intronic
979745675 4:124209900-124209922 TCCTTGGTCTTGATTGATGATGG - Intergenic
981896361 4:149804970-149804992 CCTCTAATCTTGAATGATGATGG + Intergenic
985708400 5:1414541-1414563 GCCTCACTCTTGAAGGATGGTGG - Intronic
990469432 5:56100843-56100865 CACTCAGTCTTGAATGCTGTTGG - Intronic
991648561 5:68827835-68827857 CTCTCAATCTGGAAGGATGAAGG - Intergenic
992668424 5:79034471-79034493 CACTCAGTCTTGTCTAATGAAGG + Intronic
992763168 5:79969784-79969806 CCCTCTGCCTTGAATGCTGTCGG + Intergenic
993440225 5:87947674-87947696 ACTTCAGTCTAGAACGATGAAGG - Intergenic
995219252 5:109629428-109629450 CCATCATGTTTGAATGATGATGG + Intergenic
995451752 5:112309829-112309851 CCCTCTCACTTGAAAGATGAAGG + Intronic
996546251 5:124681972-124681994 CCCTCATGCTTGATTGATAATGG - Intronic
996612950 5:125405790-125405812 CACTAAGTCTTGAAGGATAAGGG - Intergenic
998282698 5:140827974-140827996 CCCTGACTGTTGAATGATGGCGG + Exonic
1002475273 5:179461690-179461712 AACTCAGTCTTGAATGGTGTAGG - Intergenic
1005861453 6:29905707-29905729 CCCTCAGTCTGAACTGATGGTGG + Intergenic
1005903940 6:30243958-30243980 CCCACAGTAGAGAATGATGACGG + Intergenic
1013654539 6:112231837-112231859 TCCTTAGTGTTGAAGGATGAAGG - Intronic
1014811015 6:125885778-125885800 CCCTCAGTCCTGCATGGAGAGGG + Intronic
1017982386 6:159411921-159411943 ATCTAAGTCTTAAATGATGATGG - Intergenic
1021303897 7:19007579-19007601 GCCTCACTCTTGAATGATCGTGG + Intergenic
1022973636 7:35538101-35538123 CCCTTATTCTGGAACGATGAAGG + Intergenic
1028466639 7:91159851-91159873 CCCTCAGTCATGGATGGTGAGGG + Intronic
1038686617 8:29724782-29724804 CCCCCAGCATTGTATGATGAAGG + Intergenic
1039792658 8:40887987-40888009 CCCTGAGCATTGAAGGATGAGGG - Intronic
1044396771 8:91721918-91721940 CCCTCACCCAGGAATGATGAAGG - Intergenic
1051000337 9:12274188-12274210 GCCTTAGTCTGGAATGTTGAAGG + Intergenic
1052935792 9:34092049-34092071 CCCTCATTCTTTATTGAAGAGGG - Intronic
1054926148 9:70590577-70590599 CCCTTACTCTTGAATTCTGATGG + Intronic
1055942039 9:81659693-81659715 CCCTAATTTTTGGATGATGAGGG - Intronic
1056434239 9:86559884-86559906 CCCTCTGTCGAGAATGAGGAAGG + Intergenic
1059575999 9:115489167-115489189 ACCTCAGAATTGAAGGATGATGG - Intergenic
1060698499 9:125730576-125730598 CCCTCTGTCTTAAATGATCCTGG - Intergenic
1186239255 X:7548438-7548460 CCCTCCCTCTTCAGTGATGATGG - Intergenic
1190750600 X:53358414-53358436 CCCTCAGTCTGGTCTGAGGAGGG - Intergenic
1191841242 X:65514820-65514842 CACTCAGTCTTGCATGTTGAGGG + Exonic
1192221601 X:69200947-69200969 CCCTCAGTCCTCAGTGAAGATGG - Intergenic
1193162139 X:78240371-78240393 GCCTCAGTCTAGAATCATGGTGG - Intergenic
1199872436 X:151912117-151912139 CCCTCAGTCTTCACTCAGGAGGG - Intergenic
1202131121 Y:21611748-21611770 ACCTCAGCCTTGAAAAATGATGG + Intergenic