ID: 1085283439

View in Genome Browser
Species Human (GRCh38)
Location 11:75345309-75345331
Sequence TAGGGAAGGCGGGAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1445
Summary {0: 1, 1: 0, 2: 7, 3: 122, 4: 1315}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085283418_1085283439 28 Left 1085283418 11:75345258-75345280 CCCAGGAAGGAGGAGGCGCGTCT 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG 0: 1
1: 0
2: 7
3: 122
4: 1315
1085283423_1085283439 4 Left 1085283423 11:75345282-75345304 CCGAGAGATGACCCTGCCAGGGC 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG 0: 1
1: 0
2: 7
3: 122
4: 1315
1085283426_1085283439 -7 Left 1085283426 11:75345293-75345315 CCCTGCCAGGGCCCCTTAGGGAA 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG 0: 1
1: 0
2: 7
3: 122
4: 1315
1085283419_1085283439 27 Left 1085283419 11:75345259-75345281 CCAGGAAGGAGGAGGCGCGTCTC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG 0: 1
1: 0
2: 7
3: 122
4: 1315
1085283427_1085283439 -8 Left 1085283427 11:75345294-75345316 CCTGCCAGGGCCCCTTAGGGAAG 0: 1
1: 0
2: 1
3: 23
4: 242
Right 1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG 0: 1
1: 0
2: 7
3: 122
4: 1315
1085283421_1085283439 5 Left 1085283421 11:75345281-75345303 CCCGAGAGATGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG 0: 1
1: 0
2: 7
3: 122
4: 1315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085283439 Original CRISPR TAGGGAAGGCGGGAGGGGGC TGG Intronic
900188882 1:1345100-1345122 TCTGGATGGTGGGAGGGGGCAGG - Intronic
900378684 1:2373134-2373156 CAGGGATGGCAGGTGGGGGCAGG - Intronic
900378834 1:2373715-2373737 TCGGGAAGGCAGGAGTGGCCAGG - Intronic
900467764 1:2834110-2834132 TAGGGGAGGCGGTGAGGGGCTGG - Intergenic
900523082 1:3115604-3115626 GAGTGAAGCCGAGAGGGGGCGGG + Intronic
900530514 1:3150851-3150873 TATGGAGGCCGGGTGGGGGCGGG + Intronic
900540943 1:3202368-3202390 TAGGGGAGGCTGGGGGAGGCTGG + Intronic
900609280 1:3537612-3537634 CACGGAAGGCGGGAGAAGGCGGG + Intronic
900681659 1:3920093-3920115 AAGGGAGGGAGGGAGGGGGAAGG - Intergenic
900681713 1:3920249-3920271 GAGGGAAGGAGGGAAGGGGAGGG - Intergenic
900715220 1:4139813-4139835 CAGGGAAGTGGGGATGGGGCGGG + Intergenic
900732857 1:4274129-4274151 GAGGGAGGGAGGGAGGGGGGGGG - Intergenic
901012569 1:6209860-6209882 TAGGCATGGTGGGAGGTGGCAGG + Intronic
901018060 1:6242780-6242802 AAGGGTAGGCGGGGGCGGGCTGG + Intergenic
901417807 1:9129296-9129318 CTGGGACGGCGGGACGGGGCTGG - Intergenic
901502762 1:9663725-9663747 TTGGGATGGGGGGAGGGGGGAGG - Intronic
901657594 1:10779176-10779198 CAGGGAAGACGGGGTGGGGCTGG - Intronic
901666146 1:10827515-10827537 GGGGGAAGGAGGGAGGTGGCAGG - Intergenic
901730098 1:11273141-11273163 GCTGGAGGGCGGGAGGGGGCGGG - Intergenic
901796198 1:11681012-11681034 TGGGGGAGGGGAGAGGGGGCGGG - Intronic
901802895 1:11719480-11719502 TAATGAAGGCAGGAGGGAGCTGG + Intronic
901829323 1:11882452-11882474 TGGGGAAAGGGGGAAGGGGCTGG + Intergenic
901882907 1:12204436-12204458 TAGGGTAGCCGGGAGGTGGATGG - Intronic
902254268 1:15177418-15177440 TAGGGAAGTCGGGAGGAACCAGG + Intronic
902289375 1:15426621-15426643 CAGGGAAGGAGAGAGGTGGCAGG + Intronic
902290093 1:15429689-15429711 GAAGGATGGCGGGAGAGGGCTGG - Exonic
902410764 1:16210273-16210295 CAGGGAGGGAGGGAGGGAGCAGG + Intronic
902509980 1:16961150-16961172 CAGGGAAGGGGGGAGGTGGGCGG + Intronic
902518823 1:17004486-17004508 GAGGGATGGGGGTAGGGGGCAGG + Intronic
902612989 1:17608033-17608055 GAGGGAGGGAGGGAGGGAGCTGG + Intronic
902833836 1:19034460-19034482 TAGGGACGGGAGGAGTGGGCTGG - Intergenic
903331646 1:22599865-22599887 AAGGGAAGGAGGGAGGGAGTGGG + Intronic
903369228 1:22824567-22824589 GAGGGAAGACGGGTGGAGGCTGG + Intronic
903639613 1:24849320-24849342 GAGGGAAGGAGGGAGGGAGGGGG - Intergenic
903651762 1:24926928-24926950 GAAGGAAGGCGGGACGGGGGTGG - Intronic
903668697 1:25022893-25022915 GAGGGAAGGGGAGAGGGGGTAGG - Intergenic
903822281 1:26111744-26111766 TACGGAAAGCCGGAGGGGGGCGG + Intronic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
903907096 1:26695479-26695501 TAGGGACGCCGGGAGGGAGGCGG + Intergenic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904092610 1:27955888-27955910 GAGAGAAGGAGGGAGGGAGCTGG - Intronic
904208122 1:28868114-28868136 TAGGGAGGGCAGGAGGGTGATGG + Intergenic
904239150 1:29132797-29132819 GAGGGAGGGAGGGAGGGGCCGGG + Intergenic
904461941 1:30685634-30685656 GAGGGAAGGCGGGAGACGGAGGG + Intergenic
904499387 1:30905407-30905429 TTGGGAAGGCAGGAGGGGTGGGG - Intronic
904653638 1:32025699-32025721 GAGGGAAGAAGGGAGGGGGCAGG - Intronic
904695226 1:32326790-32326812 TAGGGTGGGAGGGAGGGGACTGG + Intronic
904919145 1:33993214-33993236 AGGGGAAGGCAGGAGAGGGCTGG + Intronic
905166006 1:36083957-36083979 TAGGGTAGGCGAGGGGCGGCCGG - Intergenic
905309131 1:37037419-37037441 GAGGGAAGGAGGGAGGGGAGGGG - Intergenic
905537949 1:38738276-38738298 TCGGGAAGTCAGGAGGGGTCTGG + Intergenic
905949844 1:41940872-41940894 AAGGGAAGGAGGGAGGGAGCGGG + Intronic
906152768 1:43597744-43597766 TGGGGAGGGGCGGAGGGGGCTGG - Exonic
906209107 1:44002480-44002502 GAGGGAAACCGGAAGGGGGCTGG - Intronic
906270378 1:44473081-44473103 TAGGCAGGGCAGGAGGAGGCAGG + Intronic
906293106 1:44632421-44632443 GAGGGAGGGAGGGAGGAGGCCGG - Intronic
906302335 1:44692072-44692094 TAGAGAAGGCGAGAGGGTTCAGG - Intronic
906612559 1:47213458-47213480 TAGGGAAGGAGGTAGCGGGCAGG + Intergenic
906690493 1:47789720-47789742 AAGGGAAGGAGGGAGGAGGCTGG - Intronic
907101843 1:51844761-51844783 GAGGGACGGAGGGAGGGGGGAGG + Intronic
907674591 1:56506758-56506780 GTGTGTAGGCGGGAGGGGGCTGG + Intronic
907800512 1:57760543-57760565 TAGAGAAGGGAGGAGAGGGCAGG - Intronic
908524342 1:64973323-64973345 GAGGGAAGGAGGGAGGGGAGGGG + Intergenic
908802869 1:67898123-67898145 TAGGAAAGGCATGAAGGGGCAGG - Intergenic
908824293 1:68118494-68118516 AAAGGAAGGCGGGAGGGAGGAGG - Intronic
909132433 1:71754630-71754652 TAGGGAATGCAGGTGGGGGTGGG - Intronic
909170434 1:72286483-72286505 TGGGGGAGGGGGGAGGGGGGAGG - Intergenic
910080774 1:83339163-83339185 GGGGGGAGGGGGGAGGGGGCAGG - Intergenic
910161220 1:84274896-84274918 GAGGGAAGGAGGGAGGCGGAGGG - Intergenic
910328531 1:86040457-86040479 TAGGGGTGGGGGGAGGGGGGAGG - Intronic
910345496 1:86231677-86231699 GATGAAATGCGGGAGGGGGCTGG + Intergenic
911180031 1:94852283-94852305 TAGGAAATGCATGAGGGGGCAGG + Intronic
911308811 1:96267130-96267152 TAGGGGTGGGGGGAGGGGGTAGG - Intergenic
911728984 1:101272192-101272214 TGGGGTAGGGGGGAGGGGGGAGG - Intergenic
912497255 1:110099671-110099693 GAGGGAGGGAGGGAGGGGGCCGG + Intergenic
912841408 1:113042629-113042651 GAATGAAGGCGGGAGGGGGAAGG + Intergenic
913409692 1:118537471-118537493 GAGGGAAGGAGGGAGGGAGATGG - Intergenic
913583949 1:120254770-120254792 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
913624232 1:120643570-120643592 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
914196070 1:145448730-145448752 TAGGGAAGGAGAGTGGGAGCCGG - Intergenic
914200555 1:145480929-145480951 TAGGGGAGAGGGCAGGGGGCAGG - Intergenic
914227071 1:145729367-145729389 AAGGGAGTGGGGGAGGGGGCTGG + Intronic
914242076 1:145858941-145858963 TGGGGATGGGGGGAGGGGGCCGG + Intronic
914417414 1:147496727-147496749 TTGGGTAGGCGGAAGGGAGCTGG - Intergenic
914479669 1:148054056-148054078 TAGGGGAGAGGGCAGGGGGCAGG - Intergenic
914565936 1:148866614-148866636 GAGGGAGGGAGGGAGGGGGAAGG + Intronic
914606885 1:149263622-149263644 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
914665852 1:149832135-149832157 AAGGGAGGACGGGAGGGAGCAGG - Intergenic
914669913 1:149861659-149861681 AAGGGAGGACGGGAGGGAGCAGG + Intronic
914756226 1:150562939-150562961 TGGGGAAGCTGGGAGGGGGAGGG - Intergenic
915090483 1:153420807-153420829 TAGAGAAGGCAGCAGGGGGCTGG - Exonic
915095010 1:153456296-153456318 TAGAGAAGGCAGCAGGGGTCTGG + Intergenic
915103872 1:153520200-153520222 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
915133689 1:153714436-153714458 GAGGGAGGGAGGGAGGGAGCCGG - Intergenic
915271283 1:154755589-154755611 AAGGGAGGGAGGGAGGGGGAGGG + Intronic
915312704 1:155012271-155012293 CAGGGAAGGAGGGAGAGGGATGG + Intronic
915342680 1:155185003-155185025 TGTGGTAGGCGGGAGGGAGCAGG + Intronic
915543405 1:156582642-156582664 TTGGGAAGGCAGCAGTGGGCAGG + Intronic
915602373 1:156930387-156930409 TAGAAATGGCTGGAGGGGGCTGG - Intronic
915974310 1:160375039-160375061 TGGGGGAGGAGGGAGAGGGCAGG + Intergenic
916759524 1:167803868-167803890 GAGGGATGGGGGGAGGGGGAAGG - Intergenic
916779437 1:168008889-168008911 AAGGGAGGGAGGGAGGGGGGAGG - Intronic
916832105 1:168503670-168503692 TAGGAAAGACTGGAGGGGGAGGG - Intergenic
916889728 1:169104258-169104280 TCAGGAAGGCTGGAGGAGGCTGG + Intergenic
917139072 1:171816553-171816575 GAGGGAAGGAGGGAGGGAGGAGG - Intergenic
917189587 1:172400417-172400439 GAGGGAAGGAGGGAAGGGGCAGG + Intronic
917189597 1:172400444-172400466 GAGGGAAGGAGGGAAGGGGCAGG + Intronic
918038385 1:180897051-180897073 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
918412258 1:184272054-184272076 TAGGGGTGGGGGGAGGGGGGAGG + Intergenic
918480910 1:184975413-184975435 TAGGGAAGGCGGGGGTGTGTGGG - Intergenic
919014348 1:192011742-192011764 CAGGCAAGGCCGGCGGGGGCGGG - Intergenic
919194051 1:194260562-194260584 TGGGGGGGGCGGGAGGGGGGAGG + Intergenic
919221142 1:194629933-194629955 GAGGGAAGGAGGGAAGGGGAAGG + Intergenic
919229020 1:194748636-194748658 TAGGGAAGGAGAGAGGGGAGTGG - Intergenic
919712061 1:200738816-200738838 GAGGGAAGCGGGGAGGGGGCGGG + Intergenic
919846990 1:201648608-201648630 CAGGCACGGGGGGAGGGGGCAGG - Exonic
919907097 1:202085578-202085600 TAGGGAAGGGGGTAGGGGCAGGG + Intergenic
919969940 1:202569272-202569294 TAGTGAAATCTGGAGGGGGCAGG - Intronic
920004056 1:202819900-202819922 TTGGGAAGGCGAGAGGGAGTAGG + Intergenic
920034866 1:203059308-203059330 AAGGGAAGTGGGTAGGGGGCTGG - Intronic
920214358 1:204351352-204351374 TAGAGAAGGTGGGAGGGGTCGGG - Intronic
920338947 1:205263331-205263353 TGGAGAAGGCAGGACGGGGCTGG + Intronic
920369657 1:205470218-205470240 TGGAGAGGGTGGGAGGGGGCAGG + Intergenic
920912553 1:210232562-210232584 CAGGGAAGGAGGCAGGGGGCGGG + Intergenic
921177935 1:212609452-212609474 TGGGGAAGGGGCGAGAGGGCGGG + Intronic
921546000 1:216475729-216475751 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
921642519 1:217572030-217572052 TAGGGAGGGAGGGAGGGAGAGGG + Intronic
922176153 1:223199688-223199710 GGGGGAAGGGGGGAGGGGGGAGG - Intergenic
922443579 1:225677544-225677566 TCCGGAGGGCTGGAGGGGGCAGG + Intergenic
922648682 1:227318380-227318402 GAGGGAAGGCGGGGGAGGGCTGG - Exonic
922697129 1:227736146-227736168 GTGGGAGGGCTGGAGGGGGCAGG + Intronic
922704078 1:227779845-227779867 TAGGGAAGGCTGGATGGGGTGGG - Intronic
922916150 1:229259350-229259372 TAAGAAAGGAGGGAGAGGGCCGG + Intergenic
923191722 1:231626754-231626776 ACGGGAAGTGGGGAGGGGGCTGG - Intronic
923210499 1:231799873-231799895 AAGGGAAGGAGGGAAGGGGAAGG - Intronic
923784504 1:237054323-237054345 GAGGGAGGGGGGGAGGGGGGAGG - Intronic
923835712 1:237609008-237609030 GAGGGAAGGAGGGAGGGAGAGGG - Intronic
1062980446 10:1718068-1718090 GAGGGAAGGAGGGAGGGAGGAGG + Intronic
1063332444 10:5175110-5175132 TGGGGGAGGGGGGAGGGGGGAGG - Intergenic
1063536761 10:6891224-6891246 GAGGGCAGGCAGGAGGGGCCAGG - Intergenic
1064208870 10:13347487-13347509 TCGGGCCGGCGGGAGGCGGCGGG + Intronic
1064211489 10:13363889-13363911 TAGTGGAGGCAGGACGGGGCGGG - Intergenic
1064528572 10:16283796-16283818 TATGGAAGGCAGGAGAAGGCTGG - Intergenic
1064542016 10:16414814-16414836 CAGGGGAGGCGGGAGGTGGGGGG - Intergenic
1064877746 10:20014334-20014356 AAGGGAAGGAGGGAGGGAGGTGG - Intronic
1065177688 10:23095419-23095441 GAGGGAAGGAGGGAGGGGCAGGG + Intergenic
1066052541 10:31648805-31648827 TAGGGAAGGTGGAGGGTGGCTGG + Intergenic
1066265757 10:33774378-33774400 TGGGGAAGCCGGAAGGGAGCTGG - Intergenic
1066303510 10:34117432-34117454 GAGGGCAGTGGGGAGGGGGCAGG + Intronic
1066569398 10:36754398-36754420 GAAGGAAGGAGGGAGGGGGAAGG + Intergenic
1066689311 10:38010835-38010857 TGGGGCGGGCGGCAGGGGGCCGG + Intronic
1067044205 10:42975281-42975303 CAGGGGAGGCTGGAGGGGGTGGG - Intergenic
1067056947 10:43058053-43058075 TGGAGAAGGAGGGAGGGGCCTGG - Intergenic
1067089784 10:43260654-43260676 TGGGAAAGGTGGGAGGGGGCGGG - Intronic
1067261851 10:44699826-44699848 TAGGAAAGGCTGGAGTAGGCAGG + Intergenic
1067344539 10:45428042-45428064 TAGGGAAGGTCTGCGGGGGCGGG - Intronic
1067432409 10:46252965-46252987 TGGGGAAGGCAGGGGAGGGCAGG + Intergenic
1067704424 10:48596435-48596457 TGGGGCTGGCTGGAGGGGGCAGG + Intronic
1067912153 10:50356417-50356439 TGCGGAAGGCGGAAGGCGGCAGG + Intronic
1067985191 10:51135966-51135988 GGGGGAAGGGGGGAGGGGGGAGG + Intronic
1068075521 10:52248965-52248987 TGGGGAAGGGGGAAGGGGGAAGG - Intronic
1068261741 10:54592297-54592319 AAGGGAAGGAGGGAGGGGAGGGG - Intronic
1068420043 10:56779680-56779702 GGGGGAAGGGGGGAGGGGGGAGG - Intergenic
1068525563 10:58125538-58125560 AAGGGCAGGGGGCAGGGGGCAGG + Intergenic
1068538645 10:58267959-58267981 GGAGGACGGCGGGAGGGGGCGGG - Intergenic
1068627417 10:59264200-59264222 GAGGGAAGGAGGGAGAGGGTGGG + Intronic
1068983039 10:63081431-63081453 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
1069566677 10:69468107-69468129 TGGGGGAGGGGGGCGGGGGCTGG - Intronic
1069749753 10:70737560-70737582 TAGGGCAGGAGGCAGGGGGCAGG - Intronic
1069798378 10:71067579-71067601 TGAGGAAGGTGGGAGCGGGCCGG - Intergenic
1069991989 10:72321742-72321764 TAGGGAAAGGGGGAGGGGAGGGG - Intergenic
1070531429 10:77340711-77340733 TGGGGTCGGGGGGAGGGGGCAGG + Intronic
1070776809 10:79114556-79114578 AAGGGAGGGAGGGAAGGGGCGGG + Intronic
1070812691 10:79306288-79306310 TGGGGGAGGCGGGAGGGGATAGG - Exonic
1070933979 10:80279335-80279357 AAGGGCAGGAGGGAGGTGGCAGG + Intronic
1070955556 10:80461174-80461196 CAGGGTAGGCTGGAGGGAGCCGG - Intronic
1071398123 10:85243051-85243073 GAGGGAAGGAGGGAGGGAGGAGG + Intergenic
1072758718 10:98038499-98038521 AAGGCAAGGCGGGGCGGGGCTGG + Intergenic
1073053405 10:100683957-100683979 TAGGGACGGGGGGAGGGGGGAGG + Intergenic
1073229093 10:101951909-101951931 GAGGGAAGGAGGGAGGGGGGCGG + Intronic
1073285109 10:102382785-102382807 GAGGGTAGGCAGGTGGGGGCTGG + Exonic
1073523387 10:104155907-104155929 TAGGGATTGGGGGAGGAGGCAGG + Intronic
1073797455 10:107003807-107003829 TTGGGAAGAAGGAAGGGGGCAGG + Intronic
1074169833 10:110920450-110920472 TAGGCATGGGGGGAGGGGGATGG - Intronic
1074236506 10:111589784-111589806 GTGGGAAGGTGGGAGGGGGGAGG + Intergenic
1074272331 10:111966691-111966713 GAGGGAAGGAGGGAGGGAGGGGG + Intergenic
1074302509 10:112245345-112245367 TCAGGAAGGCGGGTGGGGGAAGG + Intergenic
1074326393 10:112455346-112455368 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1074329934 10:112496189-112496211 TAGAGACGGCGGGGGGGGGGGGG - Intronic
1074755857 10:116623738-116623760 TGGGAAGGGCGGGTGGGGGCAGG - Intronic
1074771790 10:116739649-116739671 CAGGTCATGCGGGAGGGGGCAGG + Intronic
1074964078 10:118473426-118473448 GAGGGAGGGAGGGAGAGGGCAGG - Intergenic
1075096761 10:119476762-119476784 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
1075122666 10:119675794-119675816 CAGGGAAGGGGGGAAGGGGAAGG - Intronic
1075122677 10:119675820-119675842 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1075309976 10:121405818-121405840 TGGAGAAGGCTGGATGGGGCTGG - Intergenic
1075442779 10:122493164-122493186 CAGGGCAGGCAAGAGGGGGCTGG - Intronic
1075491634 10:122876288-122876310 ACGGGAAGGCTAGAGGGGGCTGG + Intronic
1075574281 10:123567302-123567324 TGTGGAAGGCAGGAGGTGGCTGG + Intergenic
1075622284 10:123936808-123936830 TGAGGAAGGCAGGAGGGTGCAGG - Intronic
1075646853 10:124102471-124102493 TGGGGATGGCGGGAGGGGCAGGG - Intergenic
1075724982 10:124606477-124606499 TGGTGGAGGTGGGAGGGGGCAGG + Intronic
1075775595 10:124984039-124984061 GAGGGTAGGCGGCAGGGGGAGGG + Intronic
1075802208 10:125160583-125160605 TGGGGAGGGCGGGAGGGGGAGGG - Intronic
1076102978 10:127797654-127797676 GAGGGATGGAGGGAGGGTGCAGG - Intergenic
1076402630 10:130193813-130193835 GGGGGAAGGCGGGCGGGGGAGGG - Intergenic
1076692319 10:132230141-132230163 TTGGGAGGGCGGGGCGGGGCGGG + Intronic
1076706482 10:132304833-132304855 TGGGGAAGGCTGGAGTGGACAGG - Intronic
1076764385 10:132625114-132625136 GAAGGAAGGAGGGAGGGGGAGGG - Intronic
1077008299 11:369344-369366 GAGGGGAGGCGGGGCGGGGCGGG - Intergenic
1077009718 11:374684-374706 CAGGGAGGGAGGGAGGGGGAAGG + Intronic
1077059311 11:610768-610790 TGGGGAAAGTGGGAGGAGGCAGG - Intronic
1077140118 11:1020581-1020603 GTGGGAAGCAGGGAGGGGGCAGG - Intronic
1077166019 11:1139252-1139274 TGGGGGAGGCGGGGGGTGGCTGG + Intergenic
1077276429 11:1712679-1712701 GAGGGGCGGCGAGAGGGGGCTGG - Intergenic
1077343682 11:2036961-2036983 TGCGGGTGGCGGGAGGGGGCTGG + Intergenic
1077394674 11:2315173-2315195 GAGGGGAGCAGGGAGGGGGCAGG - Intronic
1077459177 11:2700257-2700279 CAGGGACGACGGGTGGGGGCAGG - Intronic
1077779267 11:5307655-5307677 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1078152558 11:8771823-8771845 GAGAGAGGGCAGGAGGGGGCCGG + Intronic
1078527324 11:12110756-12110778 TGGGGAGGGCGGGCGGGCGCGGG + Intronic
1078579767 11:12529315-12529337 TAGGGAAGGGCGGAGGGGGGTGG + Exonic
1078840566 11:15073111-15073133 CAGGGAAGGAGGGGGGGGGAGGG - Intronic
1078863418 11:15274842-15274864 TTGGCAAGGTGGGAGAGGGCAGG - Intergenic
1079077473 11:17393130-17393152 TGGGCAGGGCAGGAGGGGGCGGG + Intronic
1080156990 11:29122942-29122964 TAGGGAAGTGGGGAGAGGGGAGG - Intergenic
1080582046 11:33651911-33651933 AAGGGAGGGAGGGAGGGGGAGGG - Intronic
1080641521 11:34161201-34161223 GGGGGCAGGCGGGAGGGGGCGGG - Intronic
1080836274 11:35943977-35943999 CGGGGAAGGCGGGAGGGAGGAGG + Intronic
1081600384 11:44488602-44488624 GAGGGAGGGAGGGAGGGAGCGGG - Intergenic
1081808341 11:45901889-45901911 TAGGGATGGCCTGAGGGGGCAGG + Intronic
1082063161 11:47877729-47877751 AAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1082244427 11:49905182-49905204 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082849819 11:57754723-57754745 GAGGGAGGGAGGGAGGGGGAGGG - Intronic
1082986222 11:59172832-59172854 TTGGGAAGGTGGGAGCAGGCGGG - Intronic
1083024389 11:59537646-59537668 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1083063951 11:59903996-59904018 TGGGGGAGGGGGGAGGGGGGAGG + Intergenic
1083069746 11:59965146-59965168 TGGGGGAGGGGGGAGGGGGGAGG + Intergenic
1083142593 11:60734069-60734091 TAGAGATGGCGGGTGGGGGGAGG - Intronic
1083224596 11:61276876-61276898 GAGGGATGGGGGGAGGGGGAGGG + Intronic
1083233824 11:61339466-61339488 AAGGGAAGGCTGGAAAGGGCTGG - Intronic
1083258027 11:61508646-61508668 GAGGGAGGGCGGGGCGGGGCGGG - Intergenic
1083733562 11:64667099-64667121 TTGGGAAGACGTGAGGGGGGTGG + Intronic
1083883388 11:65558988-65559010 AAGGAAAGGGGGGAGGTGGCAGG - Intergenic
1083894221 11:65612091-65612113 TAGGAAATGCAGGAGGGGCCAGG - Intronic
1083899846 11:65638298-65638320 GAGGGAAGTTGGGAGGGTGCTGG - Intronic
1084026144 11:66450978-66451000 GAAGGAATGAGGGAGGGGGCAGG + Intronic
1084032911 11:66491647-66491669 AGGGGCAGGCAGGAGGGGGCAGG - Intronic
1084046155 11:66568670-66568692 TAGGGAGAGCGGGAGGCTGCTGG + Intronic
1084571671 11:69963431-69963453 GGGGGAAGGGGGGAGGGGGAAGG + Intergenic
1084571681 11:69963445-69963467 GGGGGAAGGGGGGAGGGGGAGGG + Intergenic
1084624650 11:70296747-70296769 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1084691019 11:70726618-70726640 TTGGGAAGGCAGGTGGGGGTTGG + Intronic
1084742827 11:71150247-71150269 GAGGGAAGGAGGGAGGGAGAGGG + Intronic
1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG + Intronic
1085523866 11:77153323-77153345 TTGGGAAGGCTGGAGAGAGCAGG + Intronic
1085658862 11:78343392-78343414 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1086001575 11:81990948-81990970 TAGGGGAGGTGGGAGGGTGAGGG + Intergenic
1087157713 11:94921308-94921330 TAGGGCAGGGGTGAGGGGGATGG - Intergenic
1088051179 11:105517360-105517382 GAGGGGAGGGGGGAGGGGGGAGG + Intergenic
1088075150 11:105839072-105839094 GAGGGAAAGCTAGAGGGGGCCGG - Intronic
1088209832 11:107442804-107442826 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1088339300 11:108745059-108745081 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1089049864 11:115536703-115536725 TTGGGGAGGCGGGGGAGGGCAGG + Intergenic
1089335208 11:117718223-117718245 TCGGGAAGGGGGGTGGGGGATGG - Intronic
1089411993 11:118252089-118252111 GAAGGAAGGAGGGAGGGAGCGGG - Intronic
1089498156 11:118918154-118918176 TAGGGAAAGCTGGAGGAAGCTGG - Intronic
1089520574 11:119059932-119059954 TGGGGAAAGGGGGAGGGGGAGGG + Intergenic
1090202985 11:124869169-124869191 TGGGGTAGGCGGGAGGGCACTGG + Intronic
1090366625 11:126211840-126211862 TAGGGAAGCCGGGCTGGGGCTGG + Intronic
1090379931 11:126319308-126319330 TAGGGGAGGTGGTAGGGGACAGG + Intronic
1090399552 11:126440416-126440438 CAGGGACGGCGGGCGGGGGCCGG - Intronic
1090402855 11:126460117-126460139 GGGGGAAGGGGGGAGGGAGCGGG + Intronic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091018081 11:132072330-132072352 TAGGGAAGTAGGGAGGGGTAGGG + Intronic
1091160257 11:133413328-133413350 TGGGGTAGGGGGGAGGGGGAGGG + Intronic
1091251573 11:134148419-134148441 TGGGGTAGGCCTGAGGGGGCAGG + Intronic
1202826668 11_KI270721v1_random:92150-92172 TGCGGGTGGCGGGAGGGGGCTGG + Intergenic
1091407940 12:220695-220717 TTGGGAAGCTGGGTGGGGGCTGG - Exonic
1091558292 12:1592690-1592712 GCTGGAAGCCGGGAGGGGGCTGG + Intronic
1091567907 12:1661890-1661912 GGGGGGAGGCGGGAGGCGGCGGG + Intergenic
1091652198 12:2318849-2318871 CAGGGAAGGAGGGAGGGAGGTGG + Intronic
1091659088 12:2369337-2369359 TAAGGAAGGTGGGCGAGGGCAGG + Intronic
1091853515 12:3720173-3720195 AAGGGAGGGCGGGAGGGAGGGGG + Intronic
1091858823 12:3760443-3760465 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1091985823 12:4909806-4909828 TGGGGAGGGCGGGGGAGGGCAGG - Intergenic
1092003308 12:5048659-5048681 TGGGGAGGGTGGGAGGGGACAGG - Intergenic
1092228887 12:6766275-6766297 TGGGGCAGGCGGGAGCGGGGAGG - Intronic
1092237999 12:6821789-6821811 GAGGGAAGGAGGGAGGAGGGCGG + Exonic
1092238237 12:6822709-6822731 GAGGGAGGGAGGGAGGGAGCAGG - Intronic
1092730125 12:11523576-11523598 TAGGGGTGGGGGGAGGGGGAGGG - Intergenic
1092817227 12:12322912-12322934 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1093712996 12:22349064-22349086 TAGGGAATTAGGGATGGGGCAGG + Intronic
1093778946 12:23111854-23111876 GAGGGAAGGAGGGAGAGGGAGGG - Intergenic
1093938403 12:25026134-25026156 TAGGGGTGGAGTGAGGGGGCTGG + Intronic
1095234565 12:39781388-39781410 TGTGGAAGGCTGGAGGGGGCAGG - Intronic
1095783523 12:46086273-46086295 TAGGGCAGCCTAGAGGGGGCTGG + Intergenic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096407416 12:51354101-51354123 TAGGGAAGGCAGCTGGGGGAGGG - Exonic
1096527142 12:52217219-52217241 TAGGGAAGGGAGGAGGGGAGAGG - Intergenic
1096621716 12:52869578-52869600 TGGGGAAGCTGGGATGGGGCTGG - Intergenic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG + Intergenic
1096782538 12:53999513-53999535 GAGGGAGGGTGGGAGGGGACTGG - Intronic
1096792621 12:54054386-54054408 TAGGGAAGAAGGGAGGGAGGGGG - Intronic
1096844941 12:54401353-54401375 GAGGTAAGGGGGGAAGGGGCAGG - Exonic
1096975873 12:55699035-55699057 TAGGGGAGGGGGCAGGGTGCAGG - Intronic
1097167686 12:57094288-57094310 TTGGGAAGGGGGGAGGGGAGAGG + Intronic
1097173096 12:57128416-57128438 GAGGGAGGGAGGGAAGGGGCGGG - Intronic
1097667504 12:62497163-62497185 TGGGGGAGGGGGGAGGGGGGAGG + Intronic
1097721052 12:63021768-63021790 GAGGGAAGGAGGGAAGGGGGGGG + Intergenic
1097924233 12:65110243-65110265 AGGGGAAGGGGGCAGGGGGCAGG - Intronic
1097949287 12:65408763-65408785 CAGAGAAGGCTGGAGTGGGCTGG + Intronic
1098288693 12:68934104-68934126 GAGGGAAGGGGAGAGGGGGAGGG - Intronic
1098750815 12:74292284-74292306 GAGGGAAGGCTGGGCGGGGCTGG - Intergenic
1098929744 12:76397342-76397364 TGGGGAGGGGGGGTGGGGGCAGG + Intronic
1099005709 12:77232902-77232924 GAGGGAAGGAGGGAGGGAGGGGG - Intergenic
1099315458 12:81078033-81078055 GAGGGAAGGGAGTAGGGGGCGGG - Exonic
1099323267 12:81178313-81178335 GTGGGATGGGGGGAGGGGGCAGG + Intronic
1099385272 12:82006163-82006185 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1099385298 12:82006228-82006250 AAGGGAAGGAGGGAGGGGGAAGG + Intergenic
1099854202 12:88142786-88142808 CAGGTAAGGCGGGCGGGGTCGGG - Intronic
1100329718 12:93571810-93571832 AAGGGGAGGTGGGAGGGGCCCGG - Exonic
1100611738 12:96195882-96195904 GAGGGAGGGTGGGAGGGGGCTGG - Intronic
1100715560 12:97301880-97301902 AAGGGAAAGAGGCAGGGGGCAGG - Intergenic
1100787103 12:98089974-98089996 GAGGGAAGGAGGGAGGGAGGGGG + Intergenic
1100826971 12:98483718-98483740 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
1101255578 12:102973722-102973744 AAGGGAAAGAGGGAGGGGGAAGG - Intergenic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1101640796 12:106584613-106584635 TATGGAAGTGGGGTGGGGGCTGG + Intronic
1101940617 12:109097196-109097218 TGGGGTCGGGGGGAGGGGGCTGG - Intergenic
1101961726 12:109255971-109255993 TTGGGAAGGAGGGAAGGGGTTGG + Intronic
1102157559 12:110742986-110743008 TAGGGGGCGCGGGAGGGGGCGGG + Intergenic
1102186555 12:110951915-110951937 GAGGGAGGGGGGGAGGGGGAGGG + Intergenic
1102390169 12:112543300-112543322 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1102390180 12:112543319-112543341 AAGGGAGGGAGGGAGGGGGGAGG - Intergenic
1102394227 12:112574128-112574150 AAGTGAAGGAGGGAGGGGGTGGG + Intronic
1102500502 12:113348994-113349016 AAGGGAAGGAGGGAGGGGCCCGG - Intronic
1102528421 12:113528635-113528657 GAGGGAAACAGGGAGGGGGCAGG - Intergenic
1102565548 12:113794998-113795020 GGGGGAAGGAGGGAGGGGGTGGG + Intergenic
1102738371 12:115183276-115183298 TAGGGCAGGCTGGAGGTTGCTGG + Intergenic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103147969 12:118611593-118611615 AGGGGAAGGAGGGAGGGGCCTGG + Intergenic
1103164329 12:118757176-118757198 GAGGGAAGGAGGGATGGGGTAGG + Intergenic
1103238912 12:119397800-119397822 TGGGGAAGGGGGGAGGGAGGGGG + Intronic
1103758039 12:123225530-123225552 AAGGGAGGGAGGGAGGGGGTGGG + Intronic
1103892328 12:124249334-124249356 TAGGGAATGAAGGAGGGGGTGGG + Intronic
1104074163 12:125374643-125374665 TAGAGAAGCCGGGGCGGGGCGGG - Intronic
1104114711 12:125738242-125738264 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1104932003 12:132344937-132344959 GAGGGGAGGTGGGAGGGAGCGGG - Intergenic
1104942899 12:132403221-132403243 CTGGGAAGGAGAGAGGGGGCGGG + Intergenic
1104966282 12:132510037-132510059 GAGTGAAGGCGTGAGTGGGCCGG - Intronic
1105492647 13:20903076-20903098 TAGGGTAGTGGGGAGAGGGCCGG - Intergenic
1105891726 13:24686926-24686948 CAGGGAAGGCAGGAGGGTGGAGG + Intronic
1106028483 13:25977032-25977054 CAGGGAAGGGGGGTGGGGGTGGG - Intronic
1106248883 13:27969190-27969212 AAGGGAGGGAGGGAGGAGGCAGG - Exonic
1107834915 13:44405288-44405310 GAAGGAAGGTGGGAGGCGGCAGG - Intergenic
1108346418 13:49551118-49551140 AAGGGAAGGGGGGAGGGAGAAGG + Intronic
1108357752 13:49642600-49642622 AAGGGAGGGAGGGAGGGAGCTGG + Intergenic
1108688821 13:52845318-52845340 TGGGGAAGAGGGAAGGGGGCTGG + Intronic
1108854646 13:54777288-54777310 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
1109382675 13:61584998-61585020 GAAGGAAGGAGGGAGGGGGAGGG + Intergenic
1110364823 13:74670018-74670040 GAGGGAAGGAGGGAGGGAGGCGG - Intergenic
1111401108 13:87736234-87736256 GGGGGGAGGCGGGAGGGGGGAGG - Intergenic
1111950938 13:94708418-94708440 TTGGGAAAAGGGGAGGGGGCGGG + Intergenic
1112038173 13:95517088-95517110 GAGGGAGGGCGGGAGGGAGGAGG - Intronic
1112267477 13:97938248-97938270 TAGGGATGGCAGGGAGGGGCTGG + Intergenic
1113032383 13:106008405-106008427 GAGGGAGGGGGGGAGGGGACAGG + Intergenic
1113186128 13:107687312-107687334 GAGGGAAGGAGGGAGGGGGAAGG + Intronic
1113314437 13:109163484-109163506 GAGGGAAGGAGGGAGTGGGGAGG - Intronic
1113314449 13:109163511-109163533 GAGGGAAGGAGGGAGGTGGGAGG - Intronic
1113494267 13:110714847-110714869 AAGTGAGGGCCGGAGGGGGCTGG - Intronic
1113566177 13:111320954-111320976 GAGGGAAGGCGCCAGGGGGGCGG + Intronic
1113781169 13:112978370-112978392 TGTGGAAGGCAGGAGGGGGATGG + Intronic
1113804222 13:113104058-113104080 GCGGGCAGGCGGGAGGGGGCAGG - Intergenic
1113975570 13:114225425-114225447 AAGGGGAGGGGGGAGGGGGGAGG + Intergenic
1114045452 14:18871650-18871672 GAGGGAAGGAGGGAGGGTGGAGG + Intergenic
1114118760 14:19647818-19647840 GAGGGAAGGAGGGAGGGTGGAGG - Intergenic
1114265187 14:21069621-21069643 TGGGGAAGGCGGGAGTGTGCGGG - Intronic
1114270632 14:21098232-21098254 TCCGGGAGGGGGGAGGGGGCCGG + Intronic
1114529205 14:23384885-23384907 TAGGGGAGGCGGAAGGTGGGCGG + Intronic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1114587273 14:23826319-23826341 TGGGGAAGCCAGGAGGGGGCAGG - Intergenic
1115434800 14:33360345-33360367 TGGTGGGGGCGGGAGGGGGCTGG + Intronic
1116498923 14:45596805-45596827 CAGGGGAGGGGGGAGGGGGGAGG - Intergenic
1116825360 14:49668285-49668307 AAGGGAAGGAGGAAGGGGGAAGG + Intronic
1117455547 14:55893531-55893553 TAGAGAAGGTGGGAGGGTTCAGG - Intergenic
1118366631 14:65102213-65102235 GGGCGACGGCGGGAGGGGGCCGG - Intronic
1118467228 14:66041939-66041961 TGGGGTAGGGGGGAGGGGGATGG + Intergenic
1118764569 14:68901151-68901173 TAGGAGAGGTGGGAGAGGGCAGG + Intronic
1118862102 14:69672490-69672512 CAGGGAAGCAGAGAGGGGGCTGG + Intronic
1119771163 14:77221278-77221300 GAGGGAAGGCGTGAGTGGGAGGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119878740 14:78082648-78082670 TAGGGAAGGCAAGAGGGAGAAGG - Intergenic
1119912202 14:78359873-78359895 TGGAGAAGGCAGGAGGGTGCAGG - Intronic
1120191170 14:81441082-81441104 GAGGGAAGGAGGGAAAGGGCCGG - Intergenic
1120420887 14:84284329-84284351 ATGGGAAGGGGGGAGGGGGGAGG + Intergenic
1120452269 14:84683656-84683678 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1120514279 14:85452057-85452079 TTGTGAAGGCGGGAGGGAACTGG - Intergenic
1120575515 14:86175747-86175769 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
1120809970 14:88792996-88793018 GAGTGAGCGCGGGAGGGGGCGGG - Intergenic
1121098359 14:91233480-91233502 GAAGGAAGGCAGGAGGGGGAAGG - Exonic
1121098366 14:91233498-91233520 AAGGGAAGACTGGAGGGGGAAGG - Exonic
1121235713 14:92390064-92390086 TAAGGAAGGAGAGAAGGGGCAGG - Intronic
1121279194 14:92687406-92687428 TTGGTAAAGCGGGAGGGGACCGG - Intronic
1121340216 14:93100501-93100523 CAGGGAAGCAGGGAGGGGGCCGG + Intronic
1122133070 14:99617341-99617363 GAGGGGAGGCGGGAGTGGGAGGG + Intergenic
1122300981 14:100730970-100730992 TAAGGCAGGCTGGAGGGGGTGGG - Intronic
1122330355 14:100907992-100908014 AAGGCAAGGAGGGAGGGGACTGG + Intergenic
1122584691 14:102797061-102797083 TAGGCAAGGCGGGAGGGCAAGGG + Intronic
1122618569 14:103038709-103038731 TAGAGACGGGGGGGGGGGGCGGG + Intronic
1122807249 14:104266119-104266141 TAGGGAGTGCGGGTGAGGGCAGG + Intergenic
1122871620 14:104641372-104641394 GAGGGGTGGCGGGAGTGGGCAGG - Intergenic
1122907514 14:104808567-104808589 GAGGGAAAGTGGGAGGGGGAGGG - Intergenic
1123684388 15:22786836-22786858 TAGGGCGGGCGGCAGGCGGCAGG + Intronic
1124045199 15:26142531-26142553 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1124431001 15:29608503-29608525 TAAAGAAGGCAGGAGGAGGCAGG - Intergenic
1124538763 15:30567351-30567373 TGGTGGAGGCGGGGGGGGGCGGG + Intergenic
1124551109 15:30682284-30682306 TAGGGCAGGGGTGAGGGGGTGGG + Intronic
1125233215 15:37482050-37482072 GAGGGAAGGAGGGAGGGAGGGGG + Intergenic
1125480617 15:40077153-40077175 GAGGGGTGGCGGAAGGGGGCGGG + Intergenic
1125600842 15:40915110-40915132 CAGTGATGGGGGGAGGGGGCTGG - Intergenic
1125603980 15:40929808-40929830 GAGGGAAGGAGGGAGGGGACCGG - Intronic
1125684237 15:41554103-41554125 AAGGGATGGGGGGATGGGGCAGG - Intergenic
1125766457 15:42139798-42139820 AAGGGCAGGGGGCAGGGGGCAGG - Exonic
1126167626 15:45667006-45667028 GAGGGAGGGAGGGAGGGGGAAGG - Intronic
1126181913 15:45793729-45793751 GAGGGAAGGAGGGAGGGGAGGGG - Intergenic
1126436660 15:48644895-48644917 TGGAGAAGGCGGGAGGAGCCCGG - Exonic
1127507533 15:59610838-59610860 GAGGGAAGGAGGGAGGGGGAGGG - Intronic
1127507542 15:59610856-59610878 GAGGGAAGGAGGAAGGGGGAGGG - Intronic
1127963560 15:63907757-63907779 TAGGGAAGCAAGGAGGAGGCAGG + Exonic
1128071539 15:64800058-64800080 TAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1128156754 15:65396238-65396260 GAGGGAGGGCGGTGGGGGGCAGG - Intronic
1128317736 15:66671609-66671631 TGAGGAAGGCGGGAAGAGGCAGG + Intronic
1128614046 15:69095582-69095604 TAGGGAAGGTGGAAGGAGGGAGG - Intergenic
1128635432 15:69299399-69299421 TGGGGGCGGCGGGAGGGGGGCGG - Intronic
1129144316 15:73633277-73633299 AGGGGAGGGAGGGAGGGGGCGGG + Exonic
1129203061 15:74017282-74017304 TAGGGAGGAGGGTAGGGGGCAGG - Intronic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1129902909 15:79165432-79165454 TAGGGAAGGAGGGAGGGTTAGGG + Intergenic
1130332771 15:82934571-82934593 AAGGGAGGCCGGGAGGTGGCTGG - Intronic
1130461390 15:84160086-84160108 CAGGCAAGGCAGGAGGTGGCCGG - Intergenic
1130819064 15:87473514-87473536 TAGGAAAGGTGGGAGGGGCAGGG + Intergenic
1130846747 15:87754869-87754891 GAGGGAAGGTGGAAGGGGACAGG - Intergenic
1130926303 15:88388233-88388255 CAAGGAAGACTGGAGGGGGCAGG + Intergenic
1131046397 15:89319186-89319208 TAAGGATGGAGGGAGGGGTCTGG - Intronic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131260265 15:90884292-90884314 AACGGAAGGGAGGAGGGGGCCGG - Intronic
1131284286 15:91044304-91044326 TAGGGAAGGGGGGAAGGGCAGGG - Intergenic
1131831457 15:96357235-96357257 TGGGGAAGGCTGGCGGCGGCGGG + Intergenic
1131908326 15:97168765-97168787 TAGGGAAAGCGGCAGAGGACAGG + Intergenic
1132149867 15:99451822-99451844 GAGGCAGGTCGGGAGGGGGCTGG - Intergenic
1132399299 15:101495741-101495763 TAGGGAAGGAGGGAAAGGGGGGG + Intronic
1132535497 16:477477-477499 TGGGGAAGGCATGACGGGGCAGG - Intronic
1132755887 16:1485161-1485183 AAGGGAGGGAGGGAGGGGCCAGG + Intergenic
1132897316 16:2235152-2235174 TAGGGCAGGCGGGGGCGGGGAGG + Intronic
1133125309 16:3642395-3642417 TGAGGAAGGAGGGAGGGGACAGG - Intronic
1133232487 16:4373131-4373153 TGGGGCAGGCGGGTGGGGGATGG + Intronic
1133321209 16:4914842-4914864 TAGGGAATGAGGGAGGAGTCGGG - Intronic
1133414681 16:5597235-5597257 CAGAGAAAGCGGGAGGGGGGTGG - Intergenic
1133495389 16:6312744-6312766 GAGGGACGGAGGGAGGGGGAAGG - Intronic
1133924583 16:10182592-10182614 TTGGGAAGGGGGGAGGTGGGAGG - Intronic
1134133852 16:11667456-11667478 TTGAGAAGACAGGAGGGGGCAGG - Intergenic
1134186032 16:12085621-12085643 TAGAGAAGTAGGGTGGGGGCTGG - Intronic
1134291709 16:12907034-12907056 GAGGGAAGGGGGAAGGGGGATGG - Intronic
1134449319 16:14354008-14354030 GAGGGAAGGAGGAAGGGGGAGGG + Intergenic
1134549477 16:15132346-15132368 TAGGGGAGGGGGGAGGGGCAAGG + Intronic
1134885645 16:17789081-17789103 AAGGGAGGGCGGGAGGGAGGGGG - Intergenic
1135110927 16:19690321-19690343 GAGGGAAGGAGGGAGGGAGGAGG + Intronic
1135164774 16:20129567-20129589 AAGGGAAGGGGGGATGGGGAGGG - Intergenic
1135400634 16:22164056-22164078 GAGGGAGGTCGGGAGGGGGGTGG + Intergenic
1135527952 16:23228342-23228364 TAGGGAAGGCCGAGGGGGTCTGG - Intergenic
1135543240 16:23348453-23348475 AAGGGAGGGAGGGAGGGGGGAGG + Intronic
1135603337 16:23801746-23801768 GAGGGAAGACGGGAGGGGAGGGG - Intergenic
1135800714 16:25492483-25492505 CATGGAAGGCTGGAGGGGGTTGG + Intergenic
1135927683 16:26709824-26709846 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
1136021913 16:27445869-27445891 CAGGGAAGGAGGGAGGCGCCTGG + Intronic
1136220097 16:28823206-28823228 AAGGGAGGGAGAGAGGGGGCCGG - Exonic
1136271841 16:29153313-29153335 GAGGGAAAGCGGGAGGGGACGGG - Intergenic
1136343173 16:29658344-29658366 AAGAGAAGGAGGGAGGGAGCAGG - Intergenic
1136366674 16:29812221-29812243 TAGGGAGGGAGGGAGGCGGCGGG - Exonic
1136403491 16:30030703-30030725 CTGGGGAGTCGGGAGGGGGCTGG + Exonic
1136421615 16:30137633-30137655 TTGGGGAGGCGGGAGGAGGTTGG + Intergenic
1136541262 16:30928647-30928669 AAGGGAAGGTGGGAAGGGGAGGG - Intronic
1136546656 16:30958385-30958407 GTGAGGAGGCGGGAGGGGGCGGG + Intronic
1136581007 16:31150598-31150620 TAGGGACCCTGGGAGGGGGCTGG + Intergenic
1136619230 16:31417003-31417025 AAGGGAGGGAGGGAGGGGGGAGG - Intronic
1136986280 16:35108625-35108647 GAGGGGAGGGGGGAGGGGGGAGG - Intergenic
1137238694 16:46636618-46636640 AAGGGAAGGAGGGAGGGAGAGGG + Intergenic
1137444965 16:48526056-48526078 TAGGGATGGCAGGAGGGCACAGG - Intergenic
1137476205 16:48811622-48811644 GAAGGAAGGCAGGAAGGGGCGGG - Intergenic
1137572285 16:49574737-49574759 GAGGGAAAGCAGGAGGGAGCAGG - Intronic
1137774045 16:51040982-51041004 AAGGGAAGGAGGGAGGGAGGAGG + Intergenic
1138144244 16:54594939-54594961 TGGGGAGGGGGGGAGGTGGCGGG - Intergenic
1138513969 16:57525872-57525894 CGTGGGAGGCGGGAGGGGGCAGG - Intronic
1139210044 16:65068048-65068070 GAGGAAGGGAGGGAGGGGGCAGG + Intronic
1139210062 16:65068115-65068137 AAAGGAGGGAGGGAGGGGGCAGG + Intronic
1139341282 16:66269797-66269819 GAGGGAGGGAGGGAGGGGGCTGG + Intergenic
1139475322 16:67200008-67200030 TGGGGAAGGCGGGACGGGAGGGG - Intronic
1139511868 16:67432253-67432275 AGGGGAAGGGGGGGGGGGGCTGG + Intronic
1139568692 16:67796769-67796791 TAGGGAAGTTGGGAGGGGACTGG - Intronic
1139641444 16:68294528-68294550 TAGGGAAGGGGGGAGCAGGGAGG + Intronic
1139672216 16:68499637-68499659 TGGGGCAGGGGGCAGGGGGCTGG - Intergenic
1140191263 16:72819206-72819228 GAGGGAGGGAGGGAGGGAGCCGG - Intronic
1140426538 16:74866047-74866069 GAGGGAGGGAGGGAGGGGGTGGG + Intergenic
1140442646 16:74999327-74999349 CAGGGAAGGAGGGAGGGAGGCGG - Exonic
1140814097 16:78604840-78604862 AAGGGAAGGAGGGAGGGAGGGGG - Intronic
1140833266 16:78770652-78770674 CGGGGAGGGGGGGAGGGGGCGGG - Intronic
1140978037 16:80079677-80079699 TAGAGAAAGAGGGAGGGGGGGGG - Intergenic
1141187096 16:81795859-81795881 AATAGAAGGTGGGAGGGGGCCGG - Intronic
1141196068 16:81862205-81862227 GACTGAAGGCGAGAGGGGGCAGG + Intronic
1141635164 16:85310654-85310676 CAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1141666999 16:85470730-85470752 AAGGGAAGTGGGCAGGGGGCGGG - Intergenic
1141695926 16:85619411-85619433 GAGTGGAGGCGGGAGGGGGGTGG + Intronic
1141802446 16:86320034-86320056 TGCCGAAGGTGGGAGGGGGCGGG - Intergenic
1142075508 16:88115469-88115491 GAGGGAAAGCGGGAGGGGACCGG - Intronic
1142148425 16:88502339-88502361 TGGGCAGGGCGGGAGAGGGCGGG - Intronic
1142207804 16:88792256-88792278 CATGGCAGGCGGCAGGGGGCCGG - Intergenic
1142257817 16:89023779-89023801 TGGGGAAGGGGTGAGGGGCCGGG - Intergenic
1142285920 16:89171512-89171534 TGGGGCAGGCGGGGCGGGGCCGG - Intergenic
1142369665 16:89671547-89671569 TGGGGTAGGGGGGAGGGGGGAGG - Intergenic
1142395137 16:89828014-89828036 CTGGGAACGCGGGAGGGAGCCGG - Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142795487 17:2303826-2303848 AAGGGAGGGCGGCAGGGGGCGGG - Exonic
1142876016 17:2852753-2852775 GGGGTGAGGCGGGAGGGGGCTGG + Intronic
1142968327 17:3594788-3594810 GAGGGACTGCAGGAGGGGGCAGG + Intronic
1143000181 17:3789450-3789472 GAGGGAGGGAGGGAGGGGGGAGG - Intronic
1143019806 17:3911530-3911552 ATGGGAAGGGGGGACGGGGCGGG - Intronic
1143097219 17:4484745-4484767 GATGGAAGGAGGGAGGGGGAGGG - Intronic
1143110235 17:4548794-4548816 CGGGCAAGGCTGGAGGGGGCTGG + Intronic
1143163605 17:4886631-4886653 GTGGGCAGGCTGGAGGGGGCAGG + Intronic
1143254260 17:5544102-5544124 GAGGGAGGGAGGGAGGTGGCAGG - Intronic
1143297676 17:5883482-5883504 AAGGGAAGGCGGGGAGGGGACGG - Intronic
1143391510 17:6561591-6561613 GAGGGAAGGAGGGAGGGAGAAGG - Intergenic
1143467253 17:7145827-7145849 TGGGGAAGGGGGGAGGGAGAGGG - Intergenic
1143520273 17:7440650-7440672 TAGGGGAGCTGGGAGCGGGCGGG - Intronic
1143520986 17:7444257-7444279 TAGGGAAGCTGGGATGGGGGAGG + Exonic
1143655491 17:8291281-8291303 TCGGGAAGGGGGGAAGGGGAGGG - Intronic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144461328 17:15460868-15460890 TGGGGAAGGCGGGGGAGGGAGGG - Intronic
1144573751 17:16416333-16416355 TGGAGAAGGGGGCAGGGGGCAGG - Intronic
1144575705 17:16428109-16428131 TAGGCAAGGCCGGGGGGTGCAGG - Intronic
1144586691 17:16491770-16491792 CAGGGCCGGCGGGAGGAGGCGGG - Exonic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1144871022 17:18371009-18371031 GAGGGAGGGAGGGAGGGAGCCGG + Intergenic
1145052120 17:19670855-19670877 TAAAGAATGAGGGAGGGGGCCGG - Intronic
1145267912 17:21389375-21389397 TAGGGAACGGGTGAAGGGGCAGG - Intronic
1145276303 17:21433231-21433253 TTGGGCAGGTGGCAGGGGGCAGG - Intergenic
1145314139 17:21719125-21719147 TTGGGCAGGTGGCAGGGGGCAGG - Intergenic
1145712585 17:26991102-26991124 TTGGGCAGGTGGCAGGGGGCAGG - Intergenic
1145898691 17:28475784-28475806 CAGGAAAGGTGGGAAGGGGCAGG - Intronic
1145982380 17:29020552-29020574 TGGGGCAGGGGGGTGGGGGCTGG + Intronic
1146629300 17:34458512-34458534 CAGGGAAGGCGGGTGAGGGGAGG - Intergenic
1146914668 17:36670969-36670991 AAGGGAAGGAGGGAGGGAGAAGG - Intergenic
1146923362 17:36728275-36728297 TGGGGAAGGGGGGAGGGGGCAGG - Intergenic
1147132136 17:38415766-38415788 GAGGGAAGGAGGGGGGCGGCGGG - Intergenic
1147316198 17:39621614-39621636 CAGGGCAGGTGGGTGGGGGCAGG - Intergenic
1147579973 17:41622717-41622739 GAGGGGAGGCGGGAGGCGGGAGG - Intronic
1147876850 17:43627868-43627890 GAGAGATGGGGGGAGGGGGCAGG - Intergenic
1147966332 17:44196223-44196245 TGGGGAAGGGGGGTGGGGGAGGG - Intronic
1147996280 17:44362097-44362119 TGGGGGAGAAGGGAGGGGGCAGG + Intronic
1148203702 17:45766315-45766337 TGGGGAAGGCGGGCAGGGGAGGG - Intergenic
1148255198 17:46125033-46125055 TAGGGAGGGAGGGAGGAGGGAGG + Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148404091 17:47397030-47397052 GAGGGAAAGGGGGAGGGGGAGGG - Intronic
1148431814 17:47649480-47649502 GCGGGAAGGCGGGAGGTGCCCGG - Intronic
1148460963 17:47838766-47838788 TAGTGAACGGTGGAGGGGGCTGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148560652 17:48604091-48604113 GAGGGATGGCAGGAGGGGGAGGG + Intronic
1148615225 17:48996350-48996372 GCGGGAAGGCGGGAGAGGGACGG - Intergenic
1148734408 17:49857131-49857153 GAGGGAAGGAGGGAGGGGGATGG + Intergenic
1148851537 17:50557886-50557908 AAGGCAGGGCTGGAGGGGGCTGG + Intergenic
1149344174 17:55717539-55717561 TAGGGATGGTGGGGGGGAGCGGG + Intergenic
1149447508 17:56725034-56725056 TAGAGAAAGTGGGAGGGGGCAGG - Intergenic
1149627293 17:58088835-58088857 TAGGGGTGGCGTGAGGGGGTGGG + Intronic
1149685432 17:58532048-58532070 TCGGGGAGGCGGGAGGGTGACGG - Intronic
1149845188 17:60005150-60005172 TTGGGACAGCGGGAGGGGGATGG + Intergenic
1149857662 17:60096847-60096869 TTGGGACAGCGGGAGGGGGATGG + Intergenic
1149891209 17:60391985-60392007 AGGAGAAGGCGGGAGGGGGGTGG - Exonic
1151272490 17:73007679-73007701 GAGGGAAGGAGGGAGGGGCCAGG + Intronic
1151475988 17:74344629-74344651 AAGGGCAGGCTGGAGTGGGCTGG - Intronic
1151523568 17:74648260-74648282 TGGGGAAGGAGGGAGAGGGGAGG + Intergenic
1151659577 17:75511833-75511855 GAGGGCAGGCGGGAGGGGTTTGG - Intronic
1151763953 17:76122540-76122562 CTGGGAAGTAGGGAGGGGGCCGG + Intergenic
1151919173 17:77140959-77140981 CCGGGGAGGCGGGAGGGGGAAGG - Intronic
1151974589 17:77477114-77477136 AAGGGAAGGAGGGAGGGGGAAGG - Intronic
1152050735 17:77974039-77974061 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1152268613 17:79310643-79310665 TGGGGAATGCGGGAGGAGGGTGG - Intronic
1152273805 17:79342011-79342033 CAGGGAGGCTGGGAGGGGGCCGG - Intronic
1152450111 17:80373267-80373289 TGGGGAAGGTGTGAGGGGGTGGG - Intronic
1152594532 17:81231984-81232006 CTGGGCAGGCCGGAGGGGGCTGG - Exonic
1152681451 17:81670456-81670478 GAGTGGAGGCGGGAGGGGGAGGG + Intronic
1152818758 17:82424922-82424944 TAGAGAAGGCTGGAGAAGGCTGG + Intronic
1152818770 17:82424992-82425014 TAGAGAAGGCCGGAGAAGGCTGG + Intronic
1152818778 17:82425022-82425044 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818790 17:82425072-82425094 TGGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818796 17:82425097-82425119 TAGAGAAGGCCGGAGGAGGCTGG + Intronic
1152818811 17:82425157-82425179 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818833 17:82425242-82425264 TAGAGAAGGCTGGAGAAGGCTGG + Intronic
1152818864 17:82425404-82425426 TAGAGAAGGCTGGAGGATGCTGG + Intronic
1152863697 17:82710034-82710056 TAGAGAAGACGGGATGGGTCTGG + Intergenic
1152911212 17:83005864-83005886 GAGGTCAGGCTGGAGGGGGCCGG - Intronic
1153299808 18:3582841-3582863 GAGGGAGGGAGGGAGGGGGGAGG - Intronic
1153528490 18:6020192-6020214 TAGGGAAGGATGGAGGGAGGGGG + Intronic
1154385091 18:13886069-13886091 TCGGAAGGGTGGGAGGGGGCGGG + Intronic
1155022870 18:21912558-21912580 TTGGGAAGGCTGGAGGGGATGGG + Intergenic
1155966059 18:32036606-32036628 GAGGGAAGGAGGGAGGGGAGAGG + Intronic
1156382833 18:36579425-36579447 TAGGGAAGGTGGGATGGGTATGG + Intronic
1156449939 18:37261225-37261247 TGGGGGGGGCTGGAGGGGGCTGG - Intronic
1156596152 18:38550565-38550587 TAGGGAAGGAGAGAGGTGGCTGG - Intergenic
1156902641 18:42319448-42319470 TGGGGCAGGGGGCAGGGGGCAGG - Intergenic
1157220482 18:45825627-45825649 GAAGGAAGGCGGGCGGGGGTGGG - Exonic
1157332768 18:46715417-46715439 TTGGGAAGGCAGGAGGGAGGAGG + Intronic
1157551068 18:48582237-48582259 TTGGCAAGGCGGCAGGGGGCAGG + Intronic
1157649863 18:49317601-49317623 GAGGGAGGGAGGGAGGGGGGAGG - Intronic
1157769963 18:50337285-50337307 TAGGGAAACCTGGAAGGGGCTGG + Intergenic
1157904853 18:51560692-51560714 TAGGGATGGCAGGAGGGGAGTGG - Intergenic
1158103843 18:53861534-53861556 GAGGGAAGGAGGGAGGAGGGAGG + Intergenic
1158457540 18:57621554-57621576 GAGGGAGGGAGGGAGGGTGCTGG - Intronic
1158572742 18:58610764-58610786 TAGGGACGGGGGGAGGGGGGTGG - Intronic
1158602192 18:58864304-58864326 GACGGAAGGGAGGAGGGGGCTGG + Intronic
1158611192 18:58942315-58942337 GAGGGAGGGAGGGAGGGGCCAGG - Intronic
1158648190 18:59265628-59265650 TAGCGAAGGCGGGGAGGGGAAGG - Intergenic
1159034952 18:63267818-63267840 GAGGGAAGGAGGGAGAGAGCAGG - Intronic
1159798422 18:72868979-72869001 GAGGGAGGGCGGGACGGAGCCGG - Intergenic
1160178645 18:76615895-76615917 CAGGGAAGGTGGAAGGGGGATGG + Intergenic
1160397621 18:78583807-78583829 TAGAAAAGGCGGGAGGGTGTGGG - Intergenic
1160592743 18:79952901-79952923 TCGGGCAGGGGGCAGGGGGCAGG - Intergenic
1160659503 19:291532-291554 GAGGGGAGGAGGGAGGGGGAGGG + Intergenic
1160659530 19:291579-291601 GAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1160872170 19:1282467-1282489 GAGGGAAGTAGGGAGGGGGAGGG + Intergenic
1161022226 19:2015756-2015778 GAGGGAAGGAGGGAGGGGAAAGG + Intronic
1161055296 19:2187985-2188007 CGGGGAAGGCGGGAGGCAGCAGG + Intronic
1161139684 19:2639957-2639979 GAGGGAAGGAAGGAGGGGGGAGG + Intronic
1161139701 19:2640004-2640026 GAGGGAAGGAGGGAGGGGGAGGG + Intronic
1161322359 19:3647102-3647124 GAGGGATGGGGGGAGGGTGCAGG + Intronic
1161424968 19:4198340-4198362 CAGGGAGGGCGGGACCGGGCGGG + Intronic
1161443498 19:4305229-4305251 CAGGTAAGCGGGGAGGGGGCAGG - Intronic
1161483899 19:4524628-4524650 GAGGGAAAGCGAGAAGGGGCGGG + Intronic
1161491582 19:4565042-4565064 TTGGGCAGGGGGGAGGGAGCCGG + Intergenic
1161680255 19:5676601-5676623 TTGGGAAGGCGGGAAGGGGCTGG - Intronic
1161713711 19:5863994-5864016 TGGGGAAGGTGTGAGGGGACTGG - Intergenic
1161753951 19:6117755-6117777 AAGGGAAGGAGGGAGGGAGGAGG + Intronic
1161977798 19:7615786-7615808 TGGGTAAGGGGGGAGGGGGAGGG + Intronic
1161977809 19:7615818-7615840 CAGGGGTGCCGGGAGGGGGCGGG + Intronic
1162072953 19:8165873-8165895 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1162072972 19:8165913-8165935 GAGGGAAGGAGGGAGGAGGGAGG + Intronic
1162185737 19:8903534-8903556 TAGAGAAGGAGGGAGGAGACTGG + Intronic
1162186113 19:8906346-8906368 TAGAGAAGGAGGGAGGAGACTGG + Intronic
1162405285 19:10469432-10469454 TGGAGAAGGGGGGAGGGGACAGG - Exonic
1162799106 19:13101274-13101296 ATGGGAAGGAGGGAGGGGGAGGG + Intronic
1162823335 19:13236467-13236489 TGGGGAGGACGGGAGGGAGCTGG + Intronic
1162861662 19:13510047-13510069 GAGGGAGGGAGGGAGGGGGGAGG + Intronic
1162876821 19:13626673-13626695 GAGGGAAGGGGGGAGGGGAGGGG + Intergenic
1162879676 19:13648879-13648901 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
1163012554 19:14434567-14434589 CTGGGAAGGCGGGAGGGACCGGG - Intronic
1163035143 19:14565526-14565548 CAGGGGCGGCGGGAGGTGGCTGG + Intronic
1163109885 19:15153235-15153257 TAGGGAAGGAGGGATGGAGAAGG - Intergenic
1163190392 19:15673036-15673058 TAGGGAAGGCCGTAGGAGGCGGG - Exonic
1163424961 19:17236102-17236124 GAGGGGAGGCGGGGGGGGGGGGG + Intronic
1164149703 19:22540766-22540788 GAGGGAAGGAGGGAGGGGAGGGG + Intergenic
1164217091 19:23160372-23160394 TGTGGAAGGCGGAAGGTGGCAGG - Intergenic
1164557815 19:29267061-29267083 TGGGGAAGGAGGGAGGGAACAGG - Intergenic
1164562197 19:29300055-29300077 TAGGGAAGGCGGGCAGGAGCTGG + Intergenic
1164581569 19:29438497-29438519 GAGGGAAGGAGAGAGGGGGATGG + Intergenic
1164582674 19:29444351-29444373 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
1164615561 19:29665251-29665273 AAGGGAAGCCGGGCGGGGCCAGG + Exonic
1164651639 19:29895046-29895068 TAGGGAATGAGGGAGGGAGTAGG + Intergenic
1164651645 19:29895065-29895087 TAGGGAATGAGGGAGGGAGTAGG + Intergenic
1164677005 19:30107595-30107617 CAGGGAAGGAGGCGGGGGGCGGG - Intergenic
1164744250 19:30599432-30599454 GAAGGAAGGAGGGAGGGGGAAGG - Intronic
1165042761 19:33080856-33080878 GAGGGACGGGGGTAGGGGGCTGG + Intergenic
1165124391 19:33583503-33583525 TAGGGAAGCGGGGAGGGCGAGGG - Intergenic
1165154272 19:33777737-33777759 TAGGGAAGGGGGCAGGGGGCAGG + Intergenic
1165331399 19:35142814-35142836 AAGGAAAGGCGGGAGAGGGAGGG + Intronic
1165434290 19:35787983-35788005 GGGGGAAAGCAGGAGGGGGCTGG - Exonic
1165470941 19:36004193-36004215 TAGAGATGGGGGGAGGGGGCAGG + Intronic
1165700460 19:37933302-37933324 GAGGGAAGGAGGGAGGGAGGCGG - Intronic
1165738713 19:38193356-38193378 GAAGGAAGGAGGGAGGGGGGAGG + Intronic
1165742449 19:38211937-38211959 GGGGGAAGCCGAGAGGGGGCTGG - Exonic
1165840744 19:38788096-38788118 TGGGGGAGGCGGGGGGGGGGGGG - Intergenic
1165907469 19:39202855-39202877 CAGGGGAGGTGGGAGGGGGCAGG + Exonic
1165924925 19:39320897-39320919 GAGGGAGGGCGGGAGGCGGGAGG - Intergenic
1166035207 19:40163221-40163243 GAGGGAAGGGGGGAGGGGGAGGG + Intergenic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166293871 19:41879485-41879507 TAGGGAGGGCAAGAGGGGCCAGG + Intronic
1166536063 19:43575518-43575540 CAGGGAGAGTGGGAGGGGGCGGG + Exonic
1166719293 19:44988227-44988249 GAGGGGAGGAGGAAGGGGGCAGG - Intronic
1166747390 19:45147765-45147787 TAGGAAAGGGGGGAGCAGGCCGG + Intronic
1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG + Exonic
1166844272 19:45717331-45717353 GAGGGAAGGAGCGAGGGGGCGGG - Intronic
1166888118 19:45973586-45973608 GAGGGGAGGTGGGAGGGGGAGGG + Intergenic
1166916302 19:46197995-46198017 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1166948025 19:46409108-46409130 GAGGGAGGGTGGGAGGGGGAAGG + Intergenic
1166948087 19:46409254-46409276 GAGGGAAGGAGGGAGGAGGGTGG + Intergenic
1166997939 19:46728576-46728598 TGGGGAAGGCAAGCGGGGGCTGG + Intronic
1167062456 19:47158147-47158169 TAGGGAAAGCGGGGAGGGGAAGG - Intronic
1167129171 19:47573136-47573158 CGGGGAAGGCGGGAGGCCGCTGG - Intergenic
1167192363 19:48000228-48000250 TGGGGGATGGGGGAGGGGGCAGG - Intronic
1167295374 19:48646329-48646351 TTCGGAAGGAGGTAGGGGGCTGG + Intergenic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167571849 19:50293376-50293398 TGGGGTAGGCTGGAGGTGGCTGG + Intronic
1167575792 19:50316874-50316896 TGGGGAGGGCTGGAGGGGGAAGG + Intronic
1167579912 19:50335213-50335235 TAGGGCTGGCGGGGGAGGGCTGG - Intronic
1167636978 19:50660930-50660952 GAGGGAAGGCGGGGGGTGGGGGG + Intronic
1167643835 19:50695403-50695425 CCGGGCAGGGGGGAGGGGGCCGG + Intronic
1167948854 19:53010612-53010634 TAGGGCAACCTGGAGGGGGCTGG - Intergenic
1167952420 19:53037949-53037971 GAGGGAAGAAGGAAGGGGGCGGG + Intergenic
1168064026 19:53909355-53909377 GTGGGAGGCCGGGAGGGGGCCGG + Exonic
1168072002 19:53958581-53958603 CTGGGGACGCGGGAGGGGGCGGG + Intergenic
1168307423 19:55442988-55443010 TGGGGAGGGCGGGCGGGGGGCGG + Intergenic
1168316855 19:55488372-55488394 GAGGGGGGGCGGGAGGGGGCTGG - Intergenic
1168344450 19:55643600-55643622 TAGGGAAGGAAGGTTGGGGCGGG - Intronic
1168649688 19:58085362-58085384 TCCAGAAGGCGGGAGGCGGCAGG - Exonic
925139455 2:1539868-1539890 TGGGGAATGGGGGCGGGGGCAGG + Intronic
925170987 2:1750518-1750540 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
925171022 2:1750577-1750599 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
925171037 2:1750604-1750626 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
925171054 2:1750635-1750657 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925587071 2:5474951-5474973 CAGGGCAGGCGGGTGTGGGCGGG - Intergenic
925755432 2:7128163-7128185 AAGGGGAGGGGGGAGGGGGGAGG - Intergenic
925755455 2:7128204-7128226 AAGGGGAGGGGGGAGGGGGGAGG - Intergenic
925755485 2:7128258-7128280 AAGGGGAGGGGGGAGGGGGGAGG - Intergenic
925886810 2:8400662-8400684 TCAGGGAGGCGGGTGGGGGCGGG - Intergenic
926053195 2:9757660-9757682 CAGGGCTGGCTGGAGGGGGCTGG + Intergenic
926056933 2:9779208-9779230 AAGAGAAGGCGGGTGGTGGCCGG - Intergenic
926186710 2:10696404-10696426 TAGAGACGGCGGGGGGGGGGGGG + Intergenic
926217876 2:10916146-10916168 CAGGGAGGGCGGGAGAGGCCAGG + Intergenic
926683551 2:15681094-15681116 GAGGGGAGGGGGGAGGGGGAGGG + Intergenic
926911688 2:17857587-17857609 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
927107707 2:19842056-19842078 AAGGGAAGGAGGGAGGGGAGGGG + Intergenic
927131439 2:20063716-20063738 TGGGGAGGGCGGGATGGGGGAGG + Intergenic
927152033 2:20201782-20201804 TAGGGAGGGCGGCAGGGGCCTGG - Exonic
927471990 2:23384261-23384283 TAGGGGAGGAGGGAGAGGTCGGG + Intergenic
927638415 2:24832052-24832074 GGGGGAAGGGGGCAGGGGGCAGG + Intronic
927708296 2:25310476-25310498 TAGGGCAGGCGGCAGGTGCCAGG + Intronic
927852186 2:26506407-26506429 TGGGGAAGTGGGGAAGGGGCAGG - Intronic
928164788 2:28962801-28962823 GAGGGAAGGAGGGAAGGGGAGGG - Intronic
928230560 2:29495160-29495182 TGGGGTAGGCAGGAGGGAGCTGG - Intronic
928269311 2:29842065-29842087 GAGGGAAGGAAGGAGGGGGGAGG - Intronic
928921705 2:36534234-36534256 TGGGGAAGGAGGGAGGGGGAAGG + Intronic
928921724 2:36534296-36534318 AAAGGAAGGAGGGAGGGGGAAGG + Intronic
929315494 2:40473051-40473073 TCAGAATGGCGGGAGGGGGCGGG + Intronic
929339818 2:40801698-40801720 TTGGGGTGGGGGGAGGGGGCGGG - Intergenic
929787247 2:45001681-45001703 TAGGAAAGGCTGGAGGGGCAGGG - Intergenic
930084059 2:47480214-47480236 AAGGGAAGGAGGAAGGGGGAAGG - Intronic
930084067 2:47480233-47480255 AAGGGAAGGAGGAAGGGGGAAGG - Intronic
930312209 2:49755846-49755868 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
930786819 2:55279557-55279579 TACGGAAGGCGGAAGGCTGCAGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931348840 2:61470847-61470869 AAGAGAATGGGGGAGGGGGCCGG + Intergenic
931512860 2:63019810-63019832 TAGGGAAGGGAAGAGGGGGAGGG + Intronic
931580358 2:63765276-63765298 TAGGGAAGGCAAGAGGGTGGGGG + Intronic
931822180 2:65963200-65963222 GAGGGGAGGGGGGAGGGGGGAGG - Intergenic
932231862 2:70089586-70089608 TGGGGAAGGGGTGTGGGGGCAGG + Intergenic
932368383 2:71167416-71167438 TGGGGAAGGAGATAGGGGGCTGG - Intergenic
932404849 2:71506115-71506137 TAGGGGAGGTGAGAGTGGGCTGG + Intronic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
932475336 2:72002470-72002492 CAGGGAAGCAGGGAGGTGGCTGG - Intergenic
932495232 2:72142856-72142878 AAGGGAACGGGGGTGGGGGCAGG + Intronic
932578916 2:72980845-72980867 AGGGGAATGCAGGAGGGGGCAGG - Intronic
933109483 2:78379187-78379209 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
933194284 2:79371136-79371158 TGGGGAAGAGGGGAGGGGTCTGG + Intronic
933698493 2:85237765-85237787 TGAAGAAGGAGGGAGGGGGCTGG + Intronic
934033078 2:88065269-88065291 GAGGGAAGGGGGGGGGGGGAGGG - Intergenic
934549326 2:95245441-95245463 TAGAGACGGCGGGGGGGGGGGGG + Intronic
934562607 2:95320915-95320937 TAGGGAAGGCTGGGGGGGCAGGG - Intronic
934562705 2:95321154-95321176 TAGGGAAGGCTGGGGGTGCCGGG - Intronic
934735828 2:96689374-96689396 AAGGTAAGGCCAGAGGGGGCAGG + Intergenic
935021759 2:99238844-99238866 TAGGCTAGGTGGGAGGGGTCTGG - Intronic
935593747 2:104863909-104863931 GAGGCAAGGCCGGAGGCGGCCGG + Intergenic
935706505 2:105861935-105861957 AAGGGAAGGGGGGAGCGGGCAGG - Intronic
935918828 2:107986969-107986991 GAGGAAAGGCCGCAGGGGGCCGG + Intronic
936168399 2:110145041-110145063 TAGAGAAGGCGGCATGGGGAGGG - Intronic
936346383 2:111678627-111678649 CAGGGAAGGGGGGCGGGGGGAGG - Intergenic
936384837 2:112020165-112020187 GCTGGGAGGCGGGAGGGGGCAGG - Intronic
936508934 2:113130258-113130280 TAGGGAAGGTGGGAAGGTGGAGG - Intronic
937221313 2:120344579-120344601 GCGGGGAGGCGGGAGTGGGCCGG + Intergenic
937435759 2:121879776-121879798 ACAGGAAGGCTGGAGGGGGCTGG + Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
937882369 2:126878056-126878078 TAGGGAGGGCGGGAGGTGCGCGG - Intergenic
938003921 2:127771793-127771815 GAGGGAGGGAGGGAGGGGGCAGG + Intronic
938269771 2:129959364-129959386 GAGGGAAGGCGGGAGGGTGGAGG - Intergenic
938314712 2:130317702-130317724 GAGGGAAGGCATGAGGGGGAGGG - Intergenic
938397945 2:130964316-130964338 AAGGAAAGGCAGGAGGGGGGCGG - Intronic
938419803 2:131136153-131136175 GAGGGAGGGAGGGAGGAGGCAGG - Intronic
938487986 2:131734364-131734386 TAGGGAAGGGGGGAGCCGGATGG + Intronic
938939959 2:136161517-136161539 CAGGGATGAGGGGAGGGGGCAGG - Intergenic
939415720 2:141894366-141894388 AATGGAAGGAGGGAGGGGGTAGG - Intronic
940168816 2:150804255-150804277 TAGGGATAGCGGCAGGAGGCAGG - Intergenic
940398961 2:153224321-153224343 TAGAGAAGGGGGGAAGGGGGTGG + Intergenic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
940815590 2:158293974-158293996 GAGGGAGGGAGGGAGGGGGGGGG - Intronic
941038184 2:160590498-160590520 GAGGGGAGGGGGGAGGGGGAGGG - Intergenic
941163466 2:162060897-162060919 TAGGGAGGGAGGGAGGGAGGAGG - Intronic
941492099 2:166155036-166155058 AAGGGAAGGGGGGAGAGGGAGGG + Intergenic
941683329 2:168422268-168422290 TTGGGGAGGCGGGAGAGGGGAGG + Intergenic
941858438 2:170253882-170253904 TGGGGACGGGGGGCGGGGGCGGG + Intronic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942187772 2:173440617-173440639 AAGGGCAGGGGGTAGGGGGCCGG - Intergenic
942189635 2:173457203-173457225 CAGGGAAGGTGGAAGAGGGCTGG - Intergenic
942276731 2:174328547-174328569 CAGGGAAGGCGGGCGGGCGGGGG + Intergenic
943342213 2:186694472-186694494 TAGGGAAGGGGCGAGGAAGCCGG - Intronic
944317071 2:198294940-198294962 TAGGAATGGAGGGAGGAGGCAGG + Intronic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
945033608 2:205686047-205686069 TAGAGAAGGCGCTGGGGGGCGGG - Intronic
945493104 2:210478911-210478933 GGGGGAAGGGGGGAGGGGGGAGG - Intronic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
946357765 2:219199269-219199291 TAGGGGTGGAAGGAGGGGGCTGG - Intronic
946432523 2:219633260-219633282 TTGGGATGGCTGGAAGGGGCAGG - Exonic
946444545 2:219727081-219727103 TGGGGAAGGCTGGAGGGGCCAGG + Intergenic
946519089 2:220446627-220446649 AAGGGAGGGGGGAAGGGGGCAGG - Intergenic
946894544 2:224310015-224310037 TGAGGAAGGAGGGAGGGAGCAGG - Intergenic
947242829 2:228015061-228015083 TGGGGGAGGGGGGAGGGGGAGGG - Intronic
947395592 2:229683821-229683843 TAGGGATGGGGGCTGGGGGCTGG + Intronic
947502178 2:230679126-230679148 TAGGGAAGGTGGTAGGGAGGGGG + Intergenic
947575394 2:231269862-231269884 TAGGGGGGGAGGGTGGGGGCGGG - Intronic
947661197 2:231869966-231869988 AAAGGAAGGGGGGAGGGGGGAGG - Intergenic
947742798 2:232492564-232492586 CAGGGAAGGTGGGACAGGGCGGG - Intergenic
947872044 2:233444676-233444698 TAGGGGAGGCAGGAGCGAGCAGG - Intronic
948167107 2:235871417-235871439 TGGGGTGGCCGGGAGGGGGCAGG + Intronic
948194702 2:236086851-236086873 TAGGGCAGGGGGGTGGGGGAGGG - Intronic
948663249 2:239519652-239519674 AAGGGAAGGCCAGAGGCGGCTGG + Intergenic
948739487 2:240033508-240033530 TAGGAAGTGAGGGAGGGGGCGGG - Intergenic
948793013 2:240388860-240388882 TTGGGCAGGAGGGAGGGGGACGG + Intergenic
948800171 2:240429912-240429934 GAGGGAAGGAGGAGGGGGGCTGG - Intergenic
1168744055 20:221292-221314 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1168793492 20:595918-595940 CAGGGAAGGTGGGTGGGGGTGGG + Intergenic
1168812083 20:710633-710655 TAGGGGAGGTGGGAGGTGGGAGG + Intergenic
1168965289 20:1894857-1894879 AAGGGAAGGAGGGAGGGGGTCGG + Intronic
1169022429 20:2340014-2340036 GCAGGAGGGCGGGAGGGGGCGGG + Intronic
1169065536 20:2692739-2692761 GAGGGATGTCGGGAGCGGGCGGG - Intergenic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1169254106 20:4084176-4084198 TAGGGATGGCAGGAGGCAGCAGG + Intergenic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1170700066 20:18695594-18695616 AAGGGAAGGGGGGAGGGGAGGGG - Intronic
1170870538 20:20201964-20201986 TAGGGTGGGAGGGAGGGGGCAGG - Intronic
1170879053 20:20278431-20278453 GAGGGAAGGAGGGAAGGGGCCGG + Intronic
1170914924 20:20613601-20613623 GAGGGGAGGAGGCAGGGGGCAGG - Intronic
1171052317 20:21871477-21871499 TCAGGAAGGAGGCAGGGGGCAGG - Intergenic
1171278810 20:23879879-23879901 TAGGGAGGGAGGGAGGTGGTTGG - Intergenic
1171400302 20:24868851-24868873 AGGGGAAGGTGGGAGGGAGCAGG - Intergenic
1171474538 20:25397867-25397889 GAGGGAAAGGGGGAGGGGGGAGG + Intergenic
1171842353 20:30230147-30230169 TGGGGTAGGGGGGAGGGGGGAGG - Intergenic
1171913858 20:30993593-30993615 GTGGGAAGGGGGGAGGGGGGAGG + Intergenic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172118416 20:32584502-32584524 TGGGGCAGGCGGGCGGGGGCGGG - Intronic
1172422049 20:34825696-34825718 GAGGGAGCGCGAGAGGGGGCGGG + Intergenic
1172895274 20:38295778-38295800 TGGAGGAGGCGAGAGGGGGCTGG + Intronic
1172979143 20:38927793-38927815 TAGAAAAAGCGGCAGGGGGCCGG - Intronic
1173002100 20:39111782-39111804 AAGGGAAGGAGGGAGGGGAAGGG + Intergenic
1173441338 20:43079186-43079208 TAGAGAGGGAGAGAGGGGGCTGG - Intronic
1173513708 20:43650040-43650062 GAGGAAAGGGGGGAGGGGGGAGG + Intergenic
1173520783 20:43698828-43698850 AAAGGGAGGGGGGAGGGGGCTGG - Intronic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1173847593 20:46197887-46197909 TAGGGGAGGAGGAAGAGGGCTGG + Intronic
1173856465 20:46253412-46253434 GAGGGATGGAGGGAGGGGTCTGG + Intronic
1173934551 20:46849947-46849969 TCTGGAAGGCGGCAGGAGGCAGG + Intergenic
1174267322 20:49341155-49341177 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
1174723291 20:52836242-52836264 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1174784157 20:53417073-53417095 CAGGGGAGGAGGGAGGGTGCAGG - Intronic
1175048638 20:56131696-56131718 TGGGGATGACTGGAGGGGGCAGG + Intergenic
1175151572 20:56939154-56939176 GAGGGAAGGAGGGAGGGAGGAGG + Intergenic
1175335966 20:58196543-58196565 TAGGGAAATGGGGAGGAGGCAGG - Intergenic
1175676394 20:60949857-60949879 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
1175925674 20:62470213-62470235 CAAGGAAGGCGGGAGAGGGAAGG + Intronic
1175990278 20:62785295-62785317 GATGGAAGGTGGGATGGGGCTGG + Intergenic
1176050848 20:63118939-63118961 TGGAGAAGGCAGGAGGGGGCGGG - Intergenic
1176264795 20:64203555-64203577 GAGGGAAGGAGGGAGGGAGGAGG - Intronic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1176668029 21:9705593-9705615 TAAGGAAGGCGGGAGCGCGGCGG - Intergenic
1176668037 21:9705629-9705651 TAAGGAAGGCGGGAGCGCGGCGG - Intergenic
1176668112 21:9705989-9706011 TAAGGAAGGCGGGAGCGCGGCGG - Intergenic
1179352135 21:40621900-40621922 AAGGGAGGGAGGGAGGGGGGAGG + Intronic
1179498463 21:41790713-41790735 TAGGGAATGGGGGAGGGATCAGG + Intergenic
1179626614 21:42653001-42653023 TGGGAAAGGCGGGAGGGGAAGGG - Intergenic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179795344 21:43779289-43779311 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1179879136 21:44286233-44286255 TGGGGAAGGCTGGAGGGGCTTGG - Intronic
1180253179 21:46603379-46603401 CTGGGACGGCGGGAGGGGGTGGG + Intronic
1180463983 22:15594267-15594289 GAGGGAAGGAGGGAGGGTGGAGG + Intergenic
1180782436 22:18528729-18528751 CAGGGCGGGCGGAAGGGGGCGGG + Intronic
1180866518 22:19122718-19122740 TAGGGACGGCGGGCGCGGGACGG + Intergenic
1181002824 22:19995842-19995864 TAGGGAAGGGTGGAGGGGAAAGG - Intronic
1181125989 22:20702756-20702778 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181239326 22:21468064-21468086 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181534356 22:23534013-23534035 AAGGGAAGGCAGGAGGGAGAGGG + Intergenic
1181876812 22:25946041-25946063 GAGGGAAGGTGGGAGGGGAGGGG - Intronic
1181901041 22:26155955-26155977 GAGGGAGGGAGGGAGGGGGGGGG + Intergenic
1181992400 22:26847399-26847421 TAGGGAAGTGAGGATGGGGCAGG - Intergenic
1182048956 22:27298777-27298799 GAGGGGAAGAGGGAGGGGGCAGG + Intergenic
1182082445 22:27538892-27538914 CAGGGAAGGAGGAAGGGGGAGGG - Intergenic
1182486341 22:30641298-30641320 GAGGGAAGGAGGGAGCTGGCAGG - Intronic
1182532351 22:30969741-30969763 TTGGGGGGGCAGGAGGGGGCCGG + Intergenic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183241143 22:36659183-36659205 AAGGGAAAGCGGGAGGGTGGGGG + Intronic
1183362653 22:37390732-37390754 GAGGGGTGGCGGGAGGGGGCAGG - Intronic
1183453903 22:37911152-37911174 TAGGAAAGGTGAGAGGTGGCAGG - Intronic
1183543516 22:38443460-38443482 TGGGGAAGGCAGGAGAGGGGAGG - Intronic
1183551022 22:38485524-38485546 TGGGGAGGGAGGGAGGGGGAGGG - Exonic
1183650338 22:39150023-39150045 TAGGGAGGGCAGTATGGGGCGGG - Intronic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1183748728 22:39706993-39707015 TTGGGAAGGCCGAGGGGGGCGGG + Intergenic
1183960131 22:41406486-41406508 TGGGGATGGGGGTAGGGGGCTGG - Intergenic
1184017833 22:41799562-41799584 CAGGGAAGGAGGGACGGGACAGG + Intergenic
1184034940 22:41913868-41913890 GAGGGCAGGGGGGTGGGGGCGGG - Intronic
1184116452 22:42425540-42425562 GAGGGAAGGAGGGAGCTGGCAGG - Intronic
1184166526 22:42732282-42732304 GAGGCAAGGAGAGAGGGGGCTGG - Intergenic
1184236885 22:43187386-43187408 TGGGGAGGGGGGCAGGGGGCGGG - Intergenic
1184342295 22:43892519-43892541 TAGGGGAGGAGGGAGGAGGTGGG - Intergenic
1184481837 22:44752625-44752647 CAGGTAAGGCGGGCGGCGGCGGG + Exonic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1185037011 22:48484698-48484720 GAGGGAAGGAGGGAGGGAGGGGG - Intergenic
1185235396 22:49709470-49709492 AAGGGAAGCCAGGAAGGGGCTGG + Intergenic
1185272478 22:49935573-49935595 TGGGGACGGAGGGTGGGGGCGGG + Intergenic
1185327934 22:50236643-50236665 GAGGGTGGGCTGGAGGGGGCAGG + Intronic
1185343617 22:50302108-50302130 TGGGGAAGTGGGGTGGGGGCAGG + Intronic
1185413716 22:50698581-50698603 AAGGGAAGGAGGGAAAGGGCAGG + Intergenic
949382835 3:3465029-3465051 GAGGGAAGGGGAGAGGGGGAAGG + Intergenic
949433549 3:4003986-4004008 GAGGGAGGGAGGGAGGAGGCAGG + Intronic
949533670 3:4979400-4979422 GCGGGGAGGCGGGAGGGAGCGGG - Exonic
950021712 3:9792416-9792438 CAGGGGCCGCGGGAGGGGGCGGG + Exonic
950044443 3:9940716-9940738 GAGGGAAAGGGGGAGGGGGAGGG + Intronic
950085564 3:10255023-10255045 CAGGAAAGGAGGGAGGGGGAGGG - Intronic
950094281 3:10319790-10319812 GAGAGAAGGCGGGGGGGGGGGGG + Intronic
950151976 3:10694831-10694853 GAGGGAGGGGGGAAGGGGGCAGG - Intronic
950156277 3:10723772-10723794 TTGGGAAGGAGGGTGGGGGAGGG + Intergenic
950406881 3:12810322-12810344 TCGGTAAGGGGGCAGGGGGCGGG + Exonic
951420786 3:22482357-22482379 GAGGGAAGGCAGGAGGGGTGTGG - Intergenic
952067801 3:29593014-29593036 TGGGGGAGGGGGGAGGGGGGAGG + Intronic
952090901 3:29884475-29884497 GAGGGAGGGAGGGAGGGAGCGGG - Intronic
952145327 3:30525975-30525997 GAGGGAAGGAGGGAGGGGTGGGG - Intergenic
952187849 3:30989753-30989775 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
952314685 3:32222357-32222379 TAGGCAAGGGGGCAGGAGGCAGG - Intergenic
952344162 3:32468538-32468560 TAGGGAAGGAGGGAGGAAGGAGG - Intronic
952554544 3:34517409-34517431 TGGGGAAGGAGGGAGGGGCAAGG + Intergenic
953062479 3:39438645-39438667 GAGGGAGGGAGGGAGGGGCCAGG + Intergenic
953234908 3:41097794-41097816 GAGGCAAGGAGGGAGGGGACTGG - Intergenic
953422154 3:42762463-42762485 CAGGGTAGGCTGGAGGGGGCTGG + Intronic
953641340 3:44711090-44711112 CAGGGAAGGTGGTAGGGGCCTGG - Intergenic
953699016 3:45181712-45181734 TGGGGATGGCGGGGTGGGGCGGG + Intergenic
953839398 3:46377014-46377036 AAGGAAGGGCAGGAGGGGGCTGG + Intergenic
953856566 3:46503800-46503822 CAGGGAAAGGGGGAGGGTGCAGG - Intergenic
954021919 3:47749777-47749799 GAGGGATAGAGGGAGGGGGCAGG + Intronic
954063313 3:48087532-48087554 TAGAGATGGGGGGCGGGGGCAGG - Intronic
954073157 3:48157996-48158018 CAGGGAAGGGGGGTGGGGGTAGG - Exonic
954489942 3:50893979-50894001 GAGGGGAGGGGGGAGGGGGGAGG + Intronic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
954992909 3:54856303-54856325 TAGGGAAGGCTGCAGGGAGCTGG + Intronic
955225495 3:57056959-57056981 GATGGAAGGGGGCAGGGGGCAGG - Intronic
955395889 3:58556909-58556931 CAGGGAAGGAGGAAGGGGGAAGG + Intergenic
955495615 3:59529133-59529155 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
955592353 3:60551495-60551517 GAGGGGAGACGGGAGGGGGAGGG + Intronic
955592378 3:60551547-60551569 GAGGGGAGACGGGAGGGGGGAGG + Intronic
955712780 3:61797593-61797615 AAAGGAAGGCGGGAGGTGGGGGG - Intronic
955996931 3:64687687-64687709 GAGGGCAGGAGGGAGGGGGGTGG - Exonic
956322087 3:68008115-68008137 CAGGGAAGGCGAGGGGGCGCTGG + Intronic
956642822 3:71430819-71430841 GAGGGGAGGCGGCGGGGGGCAGG + Intronic
956838770 3:73117693-73117715 GAGGGAAGGAGGGAGGGGAGGGG - Intergenic
957193586 3:77040044-77040066 GAGGGAGGGAGGGAGGGGCCGGG - Intronic
958864955 3:99489335-99489357 CAGGGCAGGTGGGAGGGGGAAGG - Intergenic
959067471 3:101673152-101673174 TAGGGTAGGGGTGAGGAGGCAGG + Intronic
959815064 3:110665438-110665460 TATGGAAGGTGGGAGTGGGTGGG - Intergenic
960117539 3:113911599-113911621 AAGGGAAGGAGGGAGGGAGAAGG - Intronic
960281337 3:115784321-115784343 CAGGGCAGGAGGGAGGGCGCAGG + Intergenic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961144738 3:124584629-124584651 TTGGGAAGCGGGGAGGGGCCAGG - Intronic
961149820 3:124628309-124628331 GAGGGAAGGAAGGAGGGGGGAGG - Intronic
961314212 3:126023419-126023441 CAGGGAGGGCAGGAGGGAGCTGG + Intronic
962243854 3:133775201-133775223 TAGGGAAGGTTGGAAGGGGATGG + Intronic
962272980 3:133991726-133991748 GAGGGGAGGCTGCAGGGGGCCGG + Intronic
962723941 3:138203560-138203582 TAGAGAAAAAGGGAGGGGGCAGG + Intronic
963359206 3:144248948-144248970 AAGGGAGGGAGGGAGGGGGAAGG - Intergenic
963626735 3:147682837-147682859 GTGGGATGGCGGGAGGGGGGAGG - Intergenic
963641268 3:147863870-147863892 TAGGGCAAGCTGGAGTGGGCTGG - Intergenic
964635490 3:158853811-158853833 GAAGGAAGGTGGGAGGGGGAGGG - Intergenic
965045895 3:163576547-163576569 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
965120156 3:164543908-164543930 GAGGGGAGGGGGGAGGGGGGAGG - Intergenic
966351127 3:179033346-179033368 TGCGGAAGGCGGAAGGCGGCAGG + Intronic
966918163 3:184596141-184596163 TGGGGAAGGAGTGAGGGGGCAGG - Intronic
967033667 3:185631508-185631530 TAGGGAGAGAGGGAGGGGGAGGG - Exonic
967327013 3:188251011-188251033 GAGGGAAGGGGGGAGGGCGGGGG - Intronic
967754196 3:193149852-193149874 TGGGGGAGGGGGGAGGGGGGAGG + Intergenic
968088077 3:195883129-195883151 TACTGCGGGCGGGAGGGGGCGGG - Intronic
968339240 3:197941250-197941272 TAGGAAGGGAGGGAGGGGGAAGG - Intronic
968613612 4:1567787-1567809 GAGGGGAGGCTGGAGGGGCCGGG - Intergenic
969143557 4:5100757-5100779 AAGGGAAGGAGGGAGGGAGGAGG - Intronic
969161873 4:5267364-5267386 CAGGGAAAGCGGGGAGGGGCAGG - Intronic
969414235 4:7048271-7048293 TAAGGATGGCGGGAGGGGGAGGG + Intronic
969450262 4:7268928-7268950 GAGGGAAGGAGGGAGGTGGCAGG + Intronic
969581113 4:8066003-8066025 AAAGGAGGGAGGGAGGGGGCCGG + Intronic
970502329 4:16690503-16690525 GAGGGAGGGAGGGAGGGGGGAGG + Intronic
970730334 4:19095841-19095863 GAGGGAAGGAGGGAGGAGGAAGG + Intergenic
970852216 4:20615914-20615936 CAGGGAAGGGGGGAGGGTGCTGG - Intronic
970932677 4:21531341-21531363 GAGGGAGGGAGGGAGGGGGAGGG - Intronic
971154142 4:24064240-24064262 TAACGAAGAGGGGAGGGGGCTGG + Intergenic
971350569 4:25852295-25852317 TGGGGAAGGTGGGAGTGGGTGGG - Intronic
971920777 4:32936743-32936765 TGGGGAGGGGGGGAGGGGGGAGG - Intergenic
972388465 4:38590266-38590288 TAAGGAAGGAGGGAGGGGCATGG - Intergenic
972551968 4:40142124-40142146 TAGGGAGAGGGGGAGGGGGAGGG + Intronic
972653975 4:41048655-41048677 TAGGGGAGACGGGAGGGAGAGGG - Intronic
972671100 4:41214630-41214652 GAGGGAAGGCTGGAGGGACCCGG + Intronic
973334520 4:48942683-48942705 AAGGGAGGGAGGGAGGGGGGAGG - Intergenic
973738986 4:53901582-53901604 GAGGGAGGGAGGGAGGGGGAAGG + Intronic
973765402 4:54157247-54157269 GAGGGAGGGAGGGAGGGAGCCGG + Intronic
974434010 4:61834096-61834118 GGGGGAAGGGGGGAGGGGGGAGG - Intronic
975364427 4:73512246-73512268 TAGTGAGGGTGGGAGGGGGCAGG - Intergenic
975487299 4:74948548-74948570 TAGGGAAGAGGGAAGTGGGCTGG + Intronic
975801213 4:78059880-78059902 TAGAGACGGGGGGCGGGGGCGGG + Intronic
978384507 4:108167037-108167059 AAGGGGAGGCGGGCGTGGGCTGG - Intronic
978474137 4:109106771-109106793 TTGGGGGGGTGGGAGGGGGCAGG + Intronic
978576804 4:110197059-110197081 GAGGGCAGGCGGGAGGGCGCGGG + Intronic
979093389 4:116516253-116516275 TAGGGTAACCTGGAGGGGGCTGG + Intergenic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
979741112 4:124152289-124152311 TGGGGAAGTCGGCAGAGGGCCGG + Intergenic
980980686 4:139652245-139652267 TTGGGAGGGCAGGAGGGTGCAGG + Intergenic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981912225 4:149995226-149995248 AAGGGAAGGAGGGAGGGGGAGGG + Intergenic
981968819 4:150639209-150639231 AGGGGAAGGGGGGAGGGGGGAGG + Intronic
982500537 4:156149883-156149905 TAGGGGTGGGGGGAGGGGGGAGG + Intergenic
983087815 4:163468726-163468748 GGGGGAAGGGGGGAGGGGGGAGG + Intergenic
983537877 4:168877831-168877853 CGGGGAAGGCGGGCGGCGGCGGG - Intronic
983738222 4:171090733-171090755 TAGGATAAGCAGGAGGGGGCTGG - Intergenic
983928908 4:173432299-173432321 AAGGGAAGGAGGGAGGGAGGGGG - Intergenic
983939564 4:173525614-173525636 GCGGGAAGGGGGGAGGAGGCTGG - Intronic
984708125 4:182862728-182862750 CAGGGAAGGCTGGGGGTGGCAGG - Intergenic
984911446 4:184676949-184676971 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
985406656 4:189645429-189645451 TAAGGAAGGCGGGAGCGCGGCGG + Intergenic
985406678 4:189645537-189645559 TAAGGAAGGCGGGAGCGCGGCGG + Intergenic
985406726 4:189645789-189645811 TAAGGAAGGCGGGAGCGCGGCGG + Intergenic
985406761 4:189645969-189645991 TAAGGAAGGCGGGAGCGCGGCGG + Intergenic
985406832 4:189646329-189646351 TAAGGAAGGCGGGAGCGCGGCGG + Intergenic
985406867 4:189646509-189646531 TAAGGAAGGCGGGAGCGCGGCGG + Intergenic
985721735 5:1493141-1493163 TGGGGAAGCCTGGAGGAGGCTGG - Intronic
985767439 5:1787430-1787452 TATGGAAGATGGGAGGTGGCTGG - Intergenic
986010443 5:3709854-3709876 GAGGAAAGACAGGAGGGGGCCGG - Intergenic
986152427 5:5140096-5140118 GAGGGAAGGCGGGAGACAGCGGG - Intergenic
986240286 5:5954691-5954713 AAGGGAAGGAGAGAAGGGGCAGG - Intergenic
986313333 5:6571013-6571035 GAGGGAAGGAGGGAGGGAGGAGG + Intergenic
986321242 5:6633879-6633901 TAGGGTAGGGGGCCGGGGGCCGG - Intronic
986754627 5:10823993-10824015 TGGGGAGGGAGGGAGTGGGCTGG + Intergenic
986867413 5:12006421-12006443 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
987050332 5:14143320-14143342 TGGGGAAGGAAGGAGGGGGGAGG - Intergenic
987363449 5:17127325-17127347 TAGGGAAGGGGAAAGGGAGCTGG - Intronic
987859373 5:23464733-23464755 GAGGGGAGGGGGGAGGGGGAAGG + Intergenic
987920577 5:24274872-24274894 CTGGGAAGGGGGTAGGGGGCTGG + Intergenic
988220215 5:28335370-28335392 ATGGGAAAGTGGGAGGGGGCAGG + Intergenic
988599881 5:32630270-32630292 CCGGGAAGGAGGTAGGGGGCAGG - Intergenic
988985426 5:36613953-36613975 TGGAGAAGGTGGGAGAGGGCTGG - Intronic
989194931 5:38707436-38707458 AAGGGGAGGTGGGAGGGGCCGGG - Intergenic
989523059 5:42423689-42423711 TTGGGGAGGAGAGAGGGGGCGGG - Intergenic
989986879 5:50711382-50711404 TAGGGGAGGAGGGAGAAGGCAGG - Intronic
990048611 5:51466976-51466998 AAGGGAGGGAGGGAGGGAGCGGG - Intergenic
990295472 5:54397646-54397668 AAGGGAAGGAGGGAGGGAGGAGG - Intergenic
990297924 5:54421368-54421390 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
991564334 5:67989215-67989237 TAGGGAAAACGGGCTGGGGCAGG + Intergenic
991594405 5:68288300-68288322 TAGGGATTTCGGGAGGGGGAGGG - Intronic
992074266 5:73176455-73176477 GAGGGCAGGAGGGAGGGGCCTGG + Intergenic
992444042 5:76818937-76818959 CAGGGAAGGGGGCCGGGGGCGGG + Intronic
992738799 5:79751801-79751823 TAGTGAAGAATGGAGGGGGCAGG + Intronic
992837525 5:80655019-80655041 TGGGTAAGGCGGGCGGAGGCGGG + Intronic
993498713 5:88639246-88639268 TGGGGAAGGCAGGAAGGGGCAGG + Intergenic
993901145 5:93584915-93584937 AGGGGAAGGGGGGAGGGGGAGGG - Exonic
995354659 5:111224201-111224223 GAGGGAAGGAGCGAGGGGGAGGG + Exonic
995354801 5:111224861-111224883 GAGGGAAGGTGGGAGGGAGTCGG - Intronic
995428483 5:112049489-112049511 GGGGGATGGGGGGAGGGGGCGGG + Intergenic
995483885 5:112619595-112619617 TAGGGATGGCAGTGGGGGGCAGG + Intergenic
996137679 5:119865145-119865167 CAGGGAAGGTGGTAGGGAGCAGG - Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996339214 5:122417710-122417732 GAGGGAAGGAGGAAGGGGGAAGG - Intronic
996936378 5:128953340-128953362 TGGGGGAGGGGGGAGGGGGGAGG + Intronic
997013356 5:129904429-129904451 TCGGGAAGGAGGGAGGAGGGAGG + Intergenic
997385377 5:133468165-133468187 TGGGGAAGGCTGGGGGAGGCAGG + Intronic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
998002203 5:138634250-138634272 TAGGAAAGAGGGGAGGAGGCCGG + Intronic
998205280 5:140153199-140153221 GAGAGGAGGAGGGAGGGGGCTGG - Intergenic
998256705 5:140594043-140594065 CATGGAAGGTGGGAAGGGGCCGG - Intergenic
998541410 5:142985647-142985669 TAGGGTGGGGGGGAGGGGGGAGG - Intronic
998583344 5:143403184-143403206 GAAGCGAGGCGGGAGGGGGCCGG - Intronic
998740544 5:145195720-145195742 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
999141832 5:149367506-149367528 TAGACAGGGCGGGAGTGGGCAGG + Intronic
999507485 5:152213169-152213191 GTGGGGAGGCGGGAGGGGGGAGG + Intergenic
1000113863 5:158135191-158135213 TAGGGAAGGAGAGAGGGGATGGG + Intergenic
1001309131 5:170598248-170598270 AAGGGAAGCTGGGAGGAGGCAGG + Intronic
1001506642 5:172284598-172284620 TAGGGAAGACGGGGGTGGGCAGG - Intergenic
1001646686 5:173287329-173287351 TTGAGAAGGAGGGAAGGGGCTGG + Intergenic
1001868976 5:175133891-175133913 TGGGGGAGGGGGGAGGGGGGAGG - Intergenic
1002140013 5:177132799-177132821 GAGGGATGGGGGGAGGGGGAAGG + Intergenic
1002447133 5:179296482-179296504 TAAGGGAGGAGGGATGGGGCTGG + Intronic
1002487867 5:179551667-179551689 TATGGGAGGGGGGTGGGGGCGGG - Intronic
1002552965 5:180010730-180010752 TAGGGAAGGGGGAAGGAGGGAGG + Intronic
1002843085 6:922759-922781 CAGGGAAGGCTGCAAGGGGCAGG + Intergenic
1002888743 6:1316943-1316965 GAGGGGGGGCGGGAGGGGGGTGG - Intergenic
1002929845 6:1625459-1625481 TGGGGAAAGCGGGAGGAGGAAGG - Intronic
1002951440 6:1816136-1816158 TAGGGTAGGCGGTAGAGGGTGGG + Intronic
1003443517 6:6164838-6164860 GAGGGAAGGAGGGAGGGGAAGGG - Intronic
1003872230 6:10412483-10412505 AAGGGAGGGAGGGAGGGGGAGGG + Intronic
1004009065 6:11663920-11663942 TAGGGGAGGCGGGCGGGGGGCGG + Intergenic
1004174544 6:13328429-13328451 GCGGGAAGGAGGGAGGCGGCGGG + Intronic
1004250788 6:14021738-14021760 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1004640790 6:17513638-17513660 GAGGGGAGGCGGCAGGTGGCCGG - Intronic
1005000471 6:21235175-21235197 GAAGGAAGGAAGGAGGGGGCAGG - Intergenic
1005140465 6:22626181-22626203 CAGGAAAGGAGGGTGGGGGCTGG - Intergenic
1005618860 6:27601706-27601728 GAAGAAAGGCGGGAGGGGGTGGG + Intergenic
1006052415 6:31355083-31355105 TAGGGAAGGGGTGAGGGGTGGGG - Intronic
1006184906 6:32176023-32176045 AAGGGAGGGAGGGAGGGTGCTGG - Intronic
1006303741 6:33207310-33207332 GAGAGCAGGAGGGAGGGGGCTGG + Intergenic
1006362183 6:33592868-33592890 GAGGAAAGGCTGTAGGGGGCGGG + Intergenic
1006391791 6:33763009-33763031 AAGATAAGGAGGGAGGGGGCAGG - Intergenic
1006401601 6:33821031-33821053 TGGAGGAGGAGGGAGGGGGCAGG + Intergenic
1006402507 6:33826051-33826073 AAGGGAGGGGAGGAGGGGGCAGG - Intergenic
1006466404 6:34197159-34197181 TCGGGGAGGTGGGGGGGGGCGGG - Intergenic
1006814352 6:36840224-36840246 TAGGGGTGGTGAGAGGGGGCGGG - Intergenic
1006827209 6:36944363-36944385 AAGGGAAGGAGGGAGGGAGAAGG + Intergenic
1006863897 6:37192859-37192881 TCGGGAAGCGGGGAGGGGGCAGG + Intergenic
1006902564 6:37512642-37512664 GAGGAAAGGCGGGAGGAGGCTGG - Intergenic
1006913475 6:37579235-37579257 TAGGGAAGGTGGCAGAGGTCAGG - Intergenic
1006964500 6:37968695-37968717 GCGGGAAGGCGGAAGGGGGAAGG - Intronic
1007764439 6:44152514-44152536 CAGGGAAGGAGGGAGGGGGAAGG - Intronic
1007784569 6:44272320-44272342 TAGGATGGGAGGGAGGGGGCTGG - Intronic
1007816780 6:44530566-44530588 TGGGGAAGGGGAGAGGGAGCAGG + Intergenic
1007967453 6:46015740-46015762 GAGCGAAGCCGGGAGGAGGCGGG + Intronic
1008055389 6:46940450-46940472 TAGATAAGGCAGGAGGAGGCTGG - Intronic
1008218421 6:48824552-48824574 TTGGGAAGCCGGGCGGGGGGCGG + Intergenic
1008427755 6:51379388-51379410 GAGGGAGGGAGGGAGGGGGCGGG + Intergenic
1008449663 6:51635849-51635871 TGGTGAAGGTGGGGGGGGGCGGG + Intronic
1009642935 6:66361807-66361829 TTGGGATGGGGGGAGGGGGGAGG - Intergenic
1009977722 6:70690849-70690871 TGGGGAAGGGGGGAAGGGGGAGG - Intronic
1010298684 6:74232234-74232256 AAGGGAAGGAGGGAGGGGGAAGG - Intergenic
1010445211 6:75941924-75941946 TAGGGGAGGCAGGAGTGGGTAGG + Intronic
1010781225 6:79947630-79947652 TAGGGAGGGAGGGAGGGAGGAGG - Intergenic
1011087048 6:83552463-83552485 TGGGGTGGGGGGGAGGGGGCAGG + Intergenic
1011709127 6:90033206-90033228 TTGGGGAGGAGGGAGGGGGGAGG + Intronic
1012140890 6:95625298-95625320 TAAGAAAGGCAGGAGGGGCCAGG - Intergenic
1012422339 6:99078662-99078684 GAGGGAAGGAGGGAAGGGGGGGG + Intergenic
1012642487 6:101636876-101636898 AAGGAAAGGCTGTAGGGGGCAGG - Intronic
1013109511 6:107053896-107053918 GAAGGAAGGGGGGAGGGGGAAGG - Intergenic
1013720393 6:113019293-113019315 TGTGGAAGGCTAGAGGGGGCTGG - Intergenic
1013895097 6:115078636-115078658 AAGGGAAGGCTAGAGGGAGCTGG - Intergenic
1013993892 6:116284654-116284676 TGGGGGAGGGGGGAGGGGGGAGG - Intronic
1014359252 6:120455290-120455312 TGGGGGAGGGGGGAGGGGGGAGG + Intergenic
1014806316 6:125833588-125833610 AAGGGAGGGGGGGAGGGGGAGGG + Intronic
1015298655 6:131628233-131628255 TACGGAAGACGGGAAGGGCCCGG + Intergenic
1015323037 6:131897349-131897371 TAGGCATGGCGGGAGGTGGGTGG - Intergenic
1015771162 6:136769797-136769819 GAGGGAGGGAGGGAGGGGACGGG + Intronic
1016814459 6:148290726-148290748 TGCGGAAGGCGGAAGGCGGCAGG + Intronic
1016863831 6:148747301-148747323 GAGGGCAGCCGGGTGGGGGCGGG - Intergenic
1016869196 6:148799643-148799665 AAGGGAAGGAGGGAGGGAACGGG - Intronic
1016924911 6:149335018-149335040 GAGGGAAGGAGGGAGGCGGAAGG - Intronic
1016981711 6:149860733-149860755 TAGGGAAGGCGGGAGGATGCAGG - Intronic
1017520045 6:155194177-155194199 CAGAGAAGCCGGGAGGAGGCCGG + Intronic
1017541767 6:155409850-155409872 TAGTAGAGACGGGAGGGGGCAGG + Intronic
1017764115 6:157593100-157593122 AATGGGAGGCGCGAGGGGGCCGG - Exonic
1017811317 6:157985815-157985837 CAGGGAGGGAGGGATGGGGCAGG + Intronic
1018136115 6:160779833-160779855 TAGGGAAGCGGGGTGGGGGGGGG - Intergenic
1018903525 6:168062828-168062850 TGGGGAAGGGAGGAGGGGGTGGG + Intronic
1019082774 6:169446355-169446377 CAGGGAAGGTGGGCAGGGGCCGG + Intergenic
1019082791 6:169446399-169446421 CAGGGAAGGTGGGCAGGGGCCGG + Intergenic
1019159073 6:170057611-170057633 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159097 6:170057658-170057680 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019187778 6:170230949-170230971 TAGGGAAGGAGGGTGGAGTCTGG + Intergenic
1019197000 6:170288941-170288963 TAGGGAAGGTGAGAGCAGGCAGG - Intronic
1019274964 7:171473-171495 TCGGGGAGCCGGGAGGGGGTCGG - Intergenic
1019274974 7:171492-171514 TCGGGGAGCCGGGAGGGGGTCGG - Intergenic
1019274984 7:171511-171533 TCGGGGAGCCGGGAGGGGGTCGG - Intergenic
1019313923 7:376019-376041 TAGGGGAGGAGGGAGGGCACCGG + Intergenic
1019334861 7:478313-478335 GAGGGAGGGAGGGAGGGGGGAGG + Intergenic
1019398040 7:834038-834060 GAGGGAAGGTGGGCAGGGGCTGG + Intronic
1019478367 7:1254930-1254952 GTGGGAGGGCGGGTGGGGGCTGG + Intergenic
1019512091 7:1422721-1422743 TGGGGCAGGGGGCAGGGGGCAGG - Intergenic
1019512337 7:1424022-1424044 GAGGGTGGGCGGGATGGGGCTGG - Intergenic
1019519451 7:1454166-1454188 TGGGGAGGGCGGGGGGGTGCAGG + Intronic
1019557209 7:1638534-1638556 GAGGGAGGGAGGGAGGAGGCAGG + Intergenic
1019563828 7:1670171-1670193 GAAGGGGGGCGGGAGGGGGCAGG + Intergenic
1019578150 7:1747360-1747382 TAGGGATGGGGGGTGGGGGTGGG + Exonic
1019631922 7:2053997-2054019 GAGGCAGGGCGGGAGGGGTCAGG + Intronic
1020007289 7:4789504-4789526 TGGGGAGGCCGGCAGGGGGCTGG + Intronic
1020080344 7:5283161-5283183 CCGGGCGGGCGGGAGGGGGCGGG - Intronic
1020128914 7:5548788-5548810 AAGGGAAGGAGGGAGGAGGGAGG + Intronic
1020369589 7:7417489-7417511 AAGGGAAGGAGGGAGGGGGAGGG + Intronic
1020369598 7:7417507-7417529 GAGGGAAGGAGGGAGGGGGGAGG + Intronic
1020369611 7:7417526-7417548 GAGGGAGGGAGGGAGGGGGGGGG + Intronic
1020785466 7:12568029-12568051 AAGGGAAGGTGGAAGGGTGCAGG + Intergenic
1021099851 7:16575136-16575158 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1021329945 7:19324023-19324045 GAGGGAAGGAGGGAGGAGGGAGG + Intergenic
1021943575 7:25703645-25703667 TGGGGGAGGGGGGAGGGGGGAGG + Intergenic
1022105406 7:27192996-27193018 TGGGGAGGGCGGGGCGGGGCCGG + Intergenic
1022113640 7:27245672-27245694 GAAGGAAGGAGGGAGCGGGCTGG + Intronic
1023230683 7:38024992-38025014 AAGGGAAGGCTAAAGGGGGCTGG + Intronic
1023632651 7:42179358-42179380 GAGGGAAGGCGTGGGTGGGCAGG + Intronic
1023638685 7:42237536-42237558 AAGGGAAGGAGGGAGCGCGCGGG - Intronic
1023911236 7:44558460-44558482 GAGGGGAGGGGGGAGGGGGGAGG - Intergenic
1024002164 7:45197281-45197303 TGGGGAAGGCTGTGGGGGGCTGG + Intergenic
1025010014 7:55388963-55388985 TAGGGAAACCTGGAGGGGGCTGG + Intronic
1025290806 7:57720859-57720881 TGGGGTAGTGGGGAGGGGGCAGG - Intergenic
1025872633 7:65449193-65449215 AAGGGAAGGGGGGAGGGGGGAGG - Intergenic
1025935817 7:66035883-66035905 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1026141622 7:67711825-67711847 TAGGGAAGGTGAGTGGGAGCCGG + Intergenic
1026222246 7:68410397-68410419 AAGGGAAGGAGGGAGGGGGGAGG + Intergenic
1026359737 7:69591973-69591995 TGGGGGAGCCGGGAAGGGGCAGG - Intergenic
1026545885 7:71321826-71321848 GAAGGAAGGAGGGAGGGAGCTGG - Intronic
1026871034 7:73852030-73852052 AAGGGAAGGAGGAAGGGGGAAGG - Intergenic
1026974766 7:74490545-74490567 TCTGGAAGGCGGGCGGGGGGGGG - Intronic
1028013144 7:85675086-85675108 TGGGGAAGGCGGATGGGGGAGGG - Intergenic
1028894563 7:96026813-96026835 TAGGGAGGGGGAGAGGAGGCTGG - Intronic
1028981985 7:96977374-96977396 TATGGAAGGTGGTGGGGGGCAGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029492715 7:100881126-100881148 TAGGGATGGCGGGGGGCGGGGGG + Intronic
1029598163 7:101548662-101548684 CAGGGAGGGTGGGAAGGGGCCGG + Intronic
1029616839 7:101664611-101664633 CTGGGAAGGCGTGAAGGGGCTGG - Intergenic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029708301 7:102286752-102286774 AAGTGGGGGCGGGAGGGGGCGGG + Intronic
1030174358 7:106636045-106636067 GAGGGAGGCGGGGAGGGGGCAGG + Intergenic
1031008434 7:116499673-116499695 TAGGCGAGGCGAGGGGGGGCGGG + Exonic
1031021888 7:116638124-116638146 GAGGGAGGGAGGGAGGGGGGGGG - Intergenic
1031051504 7:116950341-116950363 AAGGGAAGGAGGGAGGGAGGCGG - Intergenic
1031101582 7:117486874-117486896 TGGGGTGGGGGGGAGGGGGCGGG + Intronic
1031540627 7:122990883-122990905 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1031914805 7:127552942-127552964 GTGGGATGGCGGGAGGGGGGAGG + Intergenic
1031944869 7:127829205-127829227 TGGGGGAGGGGGCAGGGGGCAGG - Intronic
1031993027 7:128210165-128210187 GAGGGGAGGTGGGAGGGGGAGGG + Intergenic
1032012311 7:128354670-128354692 AAAGGAAGGAGTGAGGGGGCTGG + Intronic
1032091846 7:128915229-128915251 GAGGGGAGGGGGGAGGGGGGCGG - Intergenic
1032181031 7:129677988-129678010 GGGGGAAGGGGGGAGGGGGCGGG + Intronic
1032257048 7:130305824-130305846 TGGGAAAGGCGTGAGGCGGCCGG + Exonic
1032274263 7:130440818-130440840 CCCGGAAGGCGGGAAGGGGCCGG - Intronic
1032653640 7:133905065-133905087 TGGGGAAGGAGGAAGGGAGCAGG + Intronic
1033033380 7:137847337-137847359 TAGGGGAGGGGGGAGGTAGCAGG + Intergenic
1033368803 7:140690841-140690863 TGGGGAAGGTGGGACGGGGCAGG + Intronic
1033478658 7:141716355-141716377 TAGGGAAGAAGGGAGGAGGGAGG - Intronic
1033729299 7:144158924-144158946 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
1033801803 7:144910635-144910657 GAGGGAGGGAGGGAGTGGGCTGG - Intergenic
1034128989 7:148698791-148698813 CAGGGAAGGCGAGAGGGCGGAGG + Intronic
1034182711 7:149150700-149150722 GAGGGGAGGCGGGGGGGCGCGGG - Intronic
1034263307 7:149770336-149770358 AAGGGAGGGAGGGAGGGGGGAGG + Intronic
1034266982 7:149785802-149785824 TGTGCAAGGTGGGAGGGGGCGGG + Intergenic
1034418779 7:150978360-150978382 CGCGGCAGGCGGGAGGGGGCCGG - Intergenic
1034441007 7:151086206-151086228 GAGGCAATGCGGGTGGGGGCTGG + Intronic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034584208 7:152074860-152074882 ACAGGAAGGCTGGAGGGGGCTGG + Intronic
1034628688 7:152514045-152514067 GAGGGAAGGAGGGATTGGGCAGG - Intergenic
1035153854 7:156896520-156896542 CAGGGGAGGCGGGAGAGGGTGGG + Intergenic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035471802 7:159114836-159114858 AAGGGAGGGAGGGAGGGAGCGGG + Intronic
1035767466 8:2118812-2118834 CAAGGAAGGCTGGAGGTGGCAGG + Intronic
1036290303 8:7482003-7482025 GGGGGAAGGGGGGAGGGGGGAGG + Intergenic
1036565349 8:9933745-9933767 GAGCAGAGGCGGGAGGGGGCGGG - Intergenic
1036658893 8:10695076-10695098 GAGGGAAGGCTGGATGGGGGAGG + Intronic
1036758118 8:11485027-11485049 GAGGGAAGGAGGGAGGGAGAGGG + Intergenic
1036767295 8:11556976-11556998 GAGGGATGGAGGGAGGGGGAGGG + Intronic
1036827616 8:11990431-11990453 AAGGTAAGGTGGGAGGGGGTGGG - Intergenic
1037097963 8:15008557-15008579 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1037281395 8:17246608-17246630 TAGGGAAGTAGAAAGGGGGCGGG - Exonic
1037450756 8:19013871-19013893 TCGGGGAGGGGGGAGGTGGCTGG + Intronic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037791274 8:21944742-21944764 TGCGGAAGGCGGAAGGCGGCAGG - Intronic
1037815591 8:22110045-22110067 GCTGGAAGGAGGGAGGGGGCAGG + Intergenic
1037815602 8:22110070-22110092 TGGGGATGGCGGGAGGGGTCCGG + Intergenic
1037856532 8:22375112-22375134 TAAGGAAGGTGGCAGGAGGCTGG - Intronic
1038177645 8:25195511-25195533 AAGGGAAAGAGGGAGGCGGCAGG - Intronic
1038247351 8:25871164-25871186 CAGGGAAGTAGGGAGGGGGAGGG - Intronic
1038340351 8:26680684-26680706 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1038360806 8:26874039-26874061 AAGGCAAGGAGGGAGGGAGCTGG - Intergenic
1038596460 8:28890577-28890599 GAGGGAAGGCGGGAGGGGGAGGG - Exonic
1038675098 8:29616149-29616171 GAGGGAAGGAGGGAAGGGGAAGG + Intergenic
1039237020 8:35513025-35513047 GAGGGAAGGCGTGAGAGGGCAGG - Intronic
1039503175 8:38032556-38032578 TTGGGAAGTGGGGAGTGGGCAGG + Intronic
1039622341 8:39009889-39009911 TAGTGATGGGGGGGGGGGGCAGG + Intronic
1039658784 8:39439527-39439549 GAGGGGAGGGGGGAGGGGGAGGG - Intergenic
1039845463 8:41322424-41322446 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1039883967 8:41645275-41645297 TGGGGGAGGCGGGTGAGGGCTGG - Exonic
1040507489 8:48063139-48063161 AGGGGAAGGCGGCAGGGGGTTGG - Exonic
1040987600 8:53313617-53313639 CAGGGAAGGAGGAAGAGGGCTGG + Intergenic
1041017607 8:53607494-53607516 TAGGGAGGGTGGGAGGAGGAGGG + Intergenic
1041467678 8:58173448-58173470 TAGGGAAGATGGCAGGGGGATGG - Intronic
1041690043 8:60679220-60679242 GGGCGAGGGCGGGAGGGGGCCGG + Intronic
1042036587 8:64540450-64540472 GAGGGAGGGAGGGAGGGAGCTGG + Intergenic
1042217024 8:66437536-66437558 TGGGGGAGGGGGGTGGGGGCAGG - Intronic
1042750663 8:72154286-72154308 CATGGAAGGCGAGAGGGAGCTGG - Intergenic
1042781102 8:72491900-72491922 GAGGGAAGGAGGGAGGAGGAAGG + Intergenic
1042943148 8:74127743-74127765 AAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1043750375 8:83926664-83926686 GAGTCAAGGCGGCAGGGGGCTGG + Intergenic
1045412067 8:101929503-101929525 AAGGGAAGGAGGGAGGGGGGAGG + Intronic
1045447590 8:102283332-102283354 AGGGGAAGGCGGGGGGGGGGGGG + Intronic
1045541884 8:103094437-103094459 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
1045679286 8:104641970-104641992 AAGGGAAGGAGGGAAGGGGAAGG - Intronic
1045709543 8:104966991-104967013 TGGGGAAAGTGGGAGGGGGAGGG - Intronic
1045787044 8:105934166-105934188 TGGGGGAGGGGGGAGGGGGGAGG - Intergenic
1045995249 8:108354261-108354283 TAGTGAGTGAGGGAGGGGGCAGG + Intronic
1046456678 8:114474163-114474185 TAGGGCAGGAGGGAGGGGTGAGG - Intergenic
1046936147 8:119887427-119887449 GAGGGGAGGGGGGAGGGGGAGGG - Intronic
1047231295 8:123000345-123000367 AAGGGAAGGAGGGAGGGGCCGGG + Intergenic
1047907006 8:129483142-129483164 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1048163441 8:132041160-132041182 TAGGAAGGCCGGGAGGAGGCAGG + Intronic
1048480406 8:134785491-134785513 TGGCGGAGGGGGGAGGGGGCGGG - Intergenic
1049298173 8:141854913-141854935 CAGGGAAGGAGGGAAGGAGCAGG + Intergenic
1049469274 8:142768226-142768248 TGGGGTGGGGGGGAGGGGGCAGG + Intronic
1049615869 8:143575637-143575659 CAGGGAAGGCTGTTGGGGGCAGG + Exonic
1049659438 8:143813188-143813210 GAGGGCAGGCGGGTGGGAGCTGG - Intronic
1049664277 8:143836073-143836095 TGGGGAAGGCGGGAGCGTGGCGG - Intronic
1049988319 9:971856-971878 GAGGGCAGGCGGGTGGGGGAGGG - Intergenic
1050230995 9:3525997-3526019 GAGGGAAGAGGGGAGGAGGCGGG + Intronic
1050678970 9:8087587-8087609 TGGGGGAGGGGGGAGGGGGGAGG + Intergenic
1050924768 9:11249841-11249863 GTGGGATGGGGGGAGGGGGCAGG + Intergenic
1051350309 9:16192505-16192527 TGGGAAGGGAGGGAGGGGGCAGG - Intergenic
1051576119 9:18617495-18617517 TTTGGCAGGGGGGAGGGGGCTGG + Intronic
1052058358 9:23928335-23928357 CAGGGAAGGGGAGAGTGGGCAGG - Intergenic
1052283794 9:26761946-26761968 TTAGGAAGGAGGGAGGGAGCAGG + Intergenic
1052559744 9:30070050-30070072 TTGGGAAGCCGGGTGGGGGGAGG + Intergenic
1053014386 9:34653797-34653819 GAGGGAAGGAGGGAGGAGGCAGG + Intronic
1053337307 9:37286966-37286988 GAGGGAGGGAGGGAGGGGGGAGG - Intronic
1053354249 9:37432965-37432987 AAGGGAGGGCAGGAGGGAGCAGG - Intronic
1055505065 9:76939767-76939789 TGGGGTAGGAGGGAGGGGACTGG - Intergenic
1055639910 9:78311382-78311404 GTGAGAAGGTGGGAGGGGGCAGG + Intronic
1055725692 9:79226011-79226033 AAGGGAAGGAGGGAGGGGGTAGG - Intergenic
1056395359 9:86176529-86176551 TGGGGAAGGCGGTGGGGGGCAGG - Intergenic
1056583656 9:87914316-87914338 TCTGGAAGGCGGGAGGGTGAAGG + Intergenic
1056584148 9:87917785-87917807 TCTGGAAGGCGGGAGGGTGAAGG + Intergenic
1056612721 9:88135140-88135162 TCTGGAAGGCGGGAGGGTGAAGG - Intergenic
1056613218 9:88138630-88138652 TCTGGAAGGCGGGAGGGTGAAGG - Intergenic
1056646971 9:88421602-88421624 TTGGGGCGGGGGGAGGGGGCTGG - Intronic
1056975318 9:91247489-91247511 TCAGGGAGGAGGGAGGGGGCAGG - Intronic
1057165467 9:92921755-92921777 TAGGAAAGGAGGGAGGGAGGAGG - Intergenic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057397049 9:94689658-94689680 GTGGGAAGGCGGGAGGGGGAAGG - Intergenic
1057529639 9:95832468-95832490 CAGGAAAGGCGGGAGAGAGCGGG + Intergenic
1058915932 9:109565814-109565836 TGGGGTGGGGGGGAGGGGGCAGG - Intergenic
1059324755 9:113497441-113497463 CAGGAAAGGAGGGAGGGGGCAGG - Intronic
1059490806 9:114666018-114666040 AAGGGAAGGGGGAAGGGGGAAGG - Intergenic
1059499322 9:114737533-114737555 TAGGGAGGGAGGGAGGGGAAGGG - Intergenic
1059811301 9:117858449-117858471 TAGAGGAGACAGGAGGGGGCAGG - Intergenic
1060123998 9:121024234-121024256 GAGGGGAGGGGGGAGGGGGAGGG + Intronic
1060149026 9:121275599-121275621 GAGGGGAGGTGGGAGGGGGATGG - Intronic
1060283658 9:122229721-122229743 TAGGGAAGGCAGGAAGGCCCAGG + Intergenic
1060468683 9:123929997-123930019 GAGGGAAGGGAGGAAGGGGCGGG - Exonic
1060793118 9:126498807-126498829 GTGGGAAGGAGGGAGGAGGCTGG + Intronic
1060906858 9:127314554-127314576 GAGGGAGGGAGGGAGGGGGAGGG - Intronic
1060949071 9:127589333-127589355 TAGGGAAGGAGAGAGGGGGGAGG + Intergenic
1061048749 9:128181755-128181777 CAGGAAAGGCGGGGGGGGGGGGG + Intronic
1061159140 9:128883075-128883097 TTGGGAAGGAGGGATGGGTCGGG + Intronic
1061187184 9:129061360-129061382 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1061246073 9:129401814-129401836 GAGGGAAGGTGGGAGGGAGAAGG - Intergenic
1061255710 9:129453504-129453526 TAGGGATGGAGGGTGGGGGATGG + Intergenic
1061262657 9:129488602-129488624 CCGCGAGGGCGGGAGGGGGCCGG - Intergenic
1061339214 9:129965778-129965800 GAGGGAAGGAGGGAGGGAGGGGG + Intronic
1061396337 9:130345864-130345886 CAGGGTAGGGCGGAGGGGGCAGG + Intronic
1061396734 9:130347576-130347598 CAGGGAGGGCTTGAGGGGGCTGG + Intronic
1061520842 9:131116981-131117003 TAAGGATGGCAGGAGAGGGCTGG - Intronic
1061595338 9:131625209-131625231 TAGTGAAGCAGGGAGAGGGCGGG + Intronic
1061725558 9:132580407-132580429 TCGGGGAGGCGGGAGGGCGGGGG - Intergenic
1061772185 9:132934193-132934215 TAGGGAAGACGGGAGGTGCTTGG - Intronic
1061996710 9:134189884-134189906 GATGGAAGGAGGGAGGGAGCAGG - Intergenic
1062046205 9:134425609-134425631 GAGGGAGGGAGGGAGGGGCCAGG + Intronic
1062050598 9:134444623-134444645 GAAGGAAGGAGGGAGGGGGAAGG - Intergenic
1062085480 9:134645933-134645955 GAGGGAAGGATGGAGGGGGAAGG - Intronic
1062095184 9:134699471-134699493 AAGGGAGGGAGGGAGGGGGAGGG - Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062123628 9:134847881-134847903 AAGGGGAAGTGGGAGGGGGCTGG + Intergenic
1062345823 9:136114731-136114753 GACGGGAGGCGGGAGGGGGCTGG - Exonic
1062449091 9:136608113-136608135 GAGGGAAGGAGGGAGGGAGGAGG + Intergenic
1062449108 9:136608159-136608181 GAGGGAAGGAGGGAGGGAGGAGG + Intergenic
1062533629 9:137012231-137012253 TAGGCAGGGCGGGGCGGGGCGGG - Intronic
1062539950 9:137037182-137037204 CAGGGAAAGCGGGTGGGTGCAGG - Exonic
1062562601 9:137148354-137148376 GAGGGCAGGCAGGAGAGGGCAGG + Intronic
1062597179 9:137304615-137304637 ATGGGAAGGGGGGAGGGGCCGGG + Intergenic
1062637265 9:137498269-137498291 TAGGGTTGGAGGGATGGGGCAGG - Intronic
1062698662 9:137888105-137888127 TAGGGAAGGAGAGTGGGAGCCGG + Intronic
1203401016 Un_KI270519v1:97276-97298 TGGGGTGGGGGGGAGGGGGCAGG + Intergenic
1185464360 X:346077-346099 GAGGGGAGGAGGGAGGGGGGAGG + Intronic
1185889489 X:3811536-3811558 GAGGGGAGGCGAGAGGGGGAGGG + Intergenic
1186010450 X:5125791-5125813 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
1186295345 X:8142919-8142941 TAGGGAAGGAGTCAGGGAGCTGG - Intergenic
1186495768 X:10012207-10012229 TAAGGGAGGCGGGACCGGGCAGG + Intergenic
1186645023 X:11497543-11497565 GAGAGAAGGAGGGAGGGGGAAGG - Intronic
1186669952 X:11758189-11758211 GGGGGAGGGCGGGCGGGGGCGGG - Exonic
1186973596 X:14875381-14875403 TGAGGATGGCGGGTGGGGGCTGG - Intronic
1187132240 X:16514139-16514161 GAGGGAAGGAGGAAGGGGGGAGG + Intergenic
1187338651 X:18402212-18402234 CAGGGATGAGGGGAGGGGGCAGG + Intergenic
1187841170 X:23490065-23490087 AAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1188093126 X:25988421-25988443 TTGGGATGGGGGGAGGGGGGAGG - Intergenic
1188141475 X:26557635-26557657 TAGGGAAGGCCGGGCGGGGCTGG - Intergenic
1188522432 X:31053735-31053757 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1188645021 X:32554810-32554832 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1188798475 X:34496154-34496176 GAGGGGAGGGGGGAGGGGGGAGG + Intergenic
1188801919 X:34542840-34542862 TAGGGAAGGTGGGGGTGGGATGG + Intergenic
1189756640 X:44278621-44278643 TAGGGAAGGAGGAAGGGAGAAGG - Intronic
1189778047 X:44487815-44487837 AAGGGAAGGAGGGAGGGAGGGGG + Intergenic
1190064237 X:47229496-47229518 TGGGGATGGCGGGCGGGGGTAGG - Exonic
1190089694 X:47427018-47427040 AAGGGAAGGGGGAAGGGGGACGG - Intergenic
1190212757 X:48460946-48460968 TAGGGCTGGGGGGAGGGGGAAGG - Intronic
1190233131 X:48597652-48597674 AAGGGAAGGCGGAGGGCGGCGGG + Intronic
1190316931 X:49157163-49157185 AAGTGAAGGTGGCAGGGGGCAGG - Intergenic
1190317832 X:49163056-49163078 AAGTGAAGGTGGCAGGGGGCAGG + Intronic
1190392122 X:49942545-49942567 TGGGGTAGGGGGGAGGGGGGAGG - Intronic
1190739539 X:53280175-53280197 TAGGGAGGACGGGAGGGGAAGGG + Intronic
1190740941 X:53288386-53288408 TAGGGAAGGAGGGAGGGGGTGGG - Intronic
1190879634 X:54483319-54483341 TAGGGGAGCAGGGAAGGGGCTGG + Intronic
1190937225 X:55007881-55007903 AAGGGGAGGAGGGAGGGGGGAGG + Exonic
1192307318 X:69975471-69975493 GAGGGAAGGAGGGAGGGAGAGGG + Intronic
1192358657 X:70425096-70425118 TAGGGATGGAGGGGGGAGGCTGG + Intronic
1192534664 X:71917254-71917276 GAGGGAGGGAGGGAGGGGGGAGG - Intergenic
1192962664 X:76146758-76146780 GGGGGAAGGGGGGAGGGGGGAGG - Intergenic
1193369150 X:80672408-80672430 GAGGGAGGGAGGGAGGGGGGAGG + Exonic
1193667515 X:84340104-84340126 AAGGGAAGGTGGGAGGTGGAAGG + Intronic
1194674117 X:96773238-96773260 TGGGGAGGGCGGGAGGGGGGGGG - Intronic
1194849986 X:98858150-98858172 TAGGGAAACCTGGAAGGGGCTGG - Intergenic
1195654700 X:107323779-107323801 TAGGGAGGGTGGGCGGGGGCGGG - Intergenic
1195702316 X:107714849-107714871 GAGGGAAGGCTGGAGGGCCCTGG - Intronic
1195706629 X:107742344-107742366 TTAGGAAGGGGGGAGGGAGCGGG + Intronic
1195966628 X:110435060-110435082 GAGGGAAGGAGGGAGGGGGGAGG + Intronic
1195966640 X:110435091-110435113 GAAGGAAGGAGGGAGGGGGGAGG + Intronic
1196650072 X:118159340-118159362 GAGGGAAGGAGGGAGGGGGGGGG + Intergenic
1196784770 X:119412084-119412106 GAGGGAAAGCGGGAGCGGGGAGG - Intronic
1197789726 X:130241991-130242013 TTGGGAAGCCGGGGGGGGGCGGG + Intronic
1198254844 X:134915463-134915485 AAGGGGAGGCGGGAGGGGAGGGG - Intergenic
1198261045 X:134965181-134965203 TAGGGAATGGGGGAGTGGGGAGG - Intergenic
1198466553 X:136909322-136909344 TGGGGATGGCGGGGCGGGGCGGG + Intergenic
1198542710 X:137657017-137657039 ATGGGAAGGCAGGAGGGTGCTGG + Intergenic
1199317073 X:146393555-146393577 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1200063656 X:153494875-153494897 GAGGAAAGGAGGGAGGGGGCTGG - Intronic
1200097155 X:153669757-153669779 TGGGGAAAACTGGAGGGGGCTGG + Intronic
1200146101 X:153927119-153927141 TCGGGAAGGCGGGAGGCGGGAGG + Intronic
1200229636 X:154437537-154437559 TAGGGAAGATGGGAGGGCGCCGG - Intronic
1200684369 Y:6246095-6246117 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200687012 Y:6266419-6266441 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200992559 Y:9357669-9357691 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200995211 Y:9377947-9377969 CAGGGAAGGCGGGGGGGTGGGGG + Intronic
1200997876 Y:9398293-9398315 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201003047 Y:9487139-9487161 CAGGGAAGGCGGGGGGTGGGGGG + Intronic
1201005706 Y:9507422-9507444 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201008366 Y:9527752-9527774 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201048265 Y:9908291-9908313 CAGGGAAGGCGGGGGGTGGGGGG - Intergenic
1201317628 Y:12663162-12663184 TAGGGAAGGCGGGGGAGGCTAGG - Intergenic
1201358304 Y:13119074-13119096 GGGGGAAGGGGGGAGGGGGGAGG - Intergenic
1201480421 Y:14432718-14432740 GAGGGAAGGAGGGAGGGGAAGGG + Intergenic
1201622306 Y:15973528-15973550 TAGTGAGGGCGGCGGGGGGCGGG + Intergenic
1202022995 Y:20486953-20486975 GAGGGAAGGGGGAAGGGAGCAGG + Intergenic
1202251322 Y:22876401-22876423 GGGGGGAGGCGGGAGGGGGGAGG + Intergenic
1202404310 Y:24510150-24510172 GGGGGGAGGCGGGAGGGGGGAGG + Intergenic
1202466469 Y:25159932-25159954 GGGGGGAGGCGGGAGGGGGGAGG - Intergenic