ID: 1085283721

View in Genome Browser
Species Human (GRCh38)
Location 11:75346714-75346736
Sequence GCCTGGGTATGGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 1, 2: 6, 3: 91, 4: 554}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085283721_1085283728 0 Left 1085283721 11:75346714-75346736 CCCTCTTCTCTCCATACCCAGGC 0: 1
1: 1
2: 6
3: 91
4: 554
Right 1085283728 11:75346737-75346759 ACTGGTGCTCTCCAAGGCCCTGG 0: 1
1: 1
2: 4
3: 34
4: 240
1085283721_1085283727 -6 Left 1085283721 11:75346714-75346736 CCCTCTTCTCTCCATACCCAGGC 0: 1
1: 1
2: 6
3: 91
4: 554
Right 1085283727 11:75346731-75346753 CCAGGCACTGGTGCTCTCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085283721 Original CRISPR GCCTGGGTATGGAGAGAAGA GGG (reversed) Intronic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
900825232 1:4920932-4920954 GCCTGGATGCTGAGAGAAGAGGG - Intergenic
900933762 1:5752690-5752712 GACTGGGTACAGAGACAAGAAGG + Intergenic
901951121 1:12747603-12747625 GCTTTGGTATGGGGAAAAGAAGG + Intronic
902816158 1:18917946-18917968 GCCAGGTTATGGGGAGAAGTGGG - Intronic
903681326 1:25099216-25099238 CCTTGTGTATGGAGAAAAGATGG - Intergenic
903929450 1:26854008-26854030 ACCTGGGTTTGGGGAGCAGAGGG - Exonic
904226998 1:29029945-29029967 TCAGGGGTATGGAGAGAAAAAGG + Intronic
905920433 1:41715429-41715451 GCCTGGGGAGGGTGGGAAGATGG + Intronic
906070581 1:43013518-43013540 GCCTGGGGATGGAGAGAGGGAGG + Intergenic
908131688 1:61081684-61081706 GCGGGGGTCTGGAGAAAAGAAGG - Intronic
909419770 1:75450719-75450741 GCCTGGGCATGGGGTGGAGAGGG - Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909836402 1:80260580-80260602 GCCTGGGTGTGGAGTGGAAAGGG - Intergenic
910080261 1:83333419-83333441 GCCTGGATATGAAGAATAGAGGG - Intergenic
910649481 1:89550209-89550231 GCCTGAGTGTGAAGAGAAGAGGG - Intronic
910979952 1:92950191-92950213 GAATGGGTATGGAGAGCAAATGG + Intronic
911028538 1:93460768-93460790 GGCTGGGTGTGGGGAGAAGTGGG + Intronic
911660919 1:100500331-100500353 GCCTGCTTCTGTAGAGAAGAGGG + Intronic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
912040433 1:105383376-105383398 GCCTGGGCATGGAGTAGAGAGGG + Intergenic
912075717 1:105873132-105873154 GCCTGGGTGTGGAGCAAAGAAGG + Intergenic
912164963 1:107032137-107032159 GAATGAGTATAGAGAGAAGAAGG - Intergenic
912458735 1:109817406-109817428 GCCTGGGTGTGGGGTGAAGCTGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
913116788 1:115704882-115704904 GACTGGGAATGGAGTGATGAGGG + Intronic
915460925 1:156070245-156070267 GCCTGGCCCTGGGGAGAAGAGGG + Exonic
915581420 1:156815298-156815320 GGCTGGGTATGAGGAAAAGAAGG - Intronic
915849566 1:159306715-159306737 GCCTGTGTATTGAGGGAGGAGGG + Intronic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916070736 1:161168232-161168254 GGTGGGGTATGAAGAGAAGAGGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
916933640 1:169605298-169605320 AGCTGGGTCTGGAGAGAACAGGG - Intronic
917732665 1:177891740-177891762 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
917732734 1:177892078-177892100 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
917821669 1:178769472-178769494 GCCTGGGTATGAAGCAGAGAGGG + Intronic
918064639 1:181090868-181090890 GCCTGGGTTGGGAGGGAAGTGGG + Intergenic
918395537 1:184110430-184110452 GACTGGGTATGCAGAGAACAGGG + Intergenic
918424601 1:184395517-184395539 GCCTGGGACTGGAGAGATGCTGG + Intronic
919593883 1:199537951-199537973 ACCTGAGTATGGAGTGTAGAGGG - Intergenic
919802002 1:201359726-201359748 GCCTGGGGATGGGGAGAAGGGGG + Intronic
920096908 1:203492307-203492329 CCCAGGCTGTGGAGAGAAGATGG + Intergenic
920430353 1:205914792-205914814 TCCTGGGTGTGGAGAGCACATGG + Exonic
920710138 1:208287200-208287222 GCCTAGGTATGGGGAGATGTAGG - Intergenic
920721234 1:208388896-208388918 AGCTGGGGAAGGAGAGAAGATGG + Intergenic
920753234 1:208702691-208702713 ACCTGGGTGTGGAGCCAAGATGG + Intergenic
920818239 1:209355579-209355601 TCCAGGGAATGAAGAGAAGAGGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921287741 1:213624104-213624126 GCCTGGGTAAGCAGACAAGGAGG + Intergenic
921440644 1:215182201-215182223 GCCTGGGTGTGGAGCAGAGAGGG + Intronic
921579119 1:216874534-216874556 GCCTCTGTATGGAAGGAAGAAGG - Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922068853 1:222170839-222170861 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
922507282 1:226133868-226133890 GCCTGGGGAGGGAGAGGAGCTGG + Intergenic
923339538 1:232995882-232995904 GCCTGGGTGGGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923521148 1:234735789-234735811 GCCTTGGTATGGAAGGCAGAAGG - Intergenic
923549023 1:234946748-234946770 GGCTGGCTTTAGAGAGAAGAAGG + Intergenic
923628421 1:235633268-235633290 GGCTGGGGATGGAGACAAGCAGG + Intronic
924617351 1:245623240-245623262 TCCTGGGTCTGGAGACAGGAAGG - Intronic
1063300170 10:4843825-4843847 GCCTGAGAAAGGAGAGGAGAAGG - Intronic
1064958430 10:20937450-20937472 GCCAGGGGGTGGAGACAAGATGG + Intronic
1066122700 10:32305877-32305899 GCAGGTGTATGGCGAGAAGAGGG - Exonic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1067566324 10:47340253-47340275 GCCTGGGTGGGGAGTGATGAAGG + Intergenic
1067702575 10:48584340-48584362 GCCAGGGTATGGATGGAAGAGGG - Intronic
1068192316 10:53667698-53667720 GCCTGGGCATGGAGTGCTGAGGG - Intergenic
1068530846 10:58184887-58184909 GCTTGGGAATGGAGACAGGAAGG + Intergenic
1068619685 10:59167705-59167727 AACTGGGTATGGAAAGAAAATGG - Intergenic
1069346488 10:67476529-67476551 GCCTGGGTATGGATTGGAAAGGG - Intronic
1069346579 10:67477100-67477122 GCCTGGGTGTGGAGTGTAAAGGG - Intronic
1069616632 10:69810722-69810744 GCCTGGGTCTGGGGAGACTAGGG + Intronic
1069827104 10:71261025-71261047 GCGTGGGAATGGGGAGAGGATGG + Intronic
1069916633 10:71790681-71790703 GCCTGCGCATGGGGAGATGACGG - Intronic
1071507448 10:86241239-86241261 GCCTGGGTGAGGTGAGGAGAGGG - Intronic
1071525043 10:86353693-86353715 GCCTGGGCCTGGAGAGCTGAGGG - Intronic
1071894576 10:90051589-90051611 GCCTGGATGTGGAGAAGAGAGGG + Intergenic
1072374829 10:94803894-94803916 GCCTGGATATGGAGCAGAGAGGG + Intronic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072898009 10:99383703-99383725 GACTGGGTAGAGAGAGAAGCTGG + Intronic
1072968004 10:99991427-99991449 GCCTAGGGCTGGAGAGGAGAGGG - Intronic
1073821792 10:107272678-107272700 GACTGGGAAAGGAGAGAAGTTGG - Intergenic
1074836578 10:117301868-117301890 TCCGGGGGAGGGAGAGAAGAGGG - Intronic
1075199664 10:120392063-120392085 TACTGGCTATGGACAGAAGAGGG + Intergenic
1075462132 10:122623877-122623899 GCCTGAGAATGGAGAAAAAATGG - Intronic
1076652814 10:132001589-132001611 ACTTGGGTGTGGAGAGATGAGGG - Intergenic
1077629033 11:3798154-3798176 GCATGGGTCAGGAGAGAATAGGG - Intronic
1078451864 11:11446520-11446542 TCCTGGGTCTGGAGAGGAGCTGG - Intronic
1078989596 11:16633018-16633040 GCCTGGGCATGAAGTGGAGAGGG + Intronic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079258395 11:18852867-18852889 ACCTGGGCATGGAGCAAAGAGGG - Intergenic
1079407125 11:20156839-20156861 GTCGGGGTGGGGAGAGAAGAGGG + Intronic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080815519 11:35752647-35752669 GCATGGGGATGGAGAGAGGTAGG - Intronic
1080895086 11:36442185-36442207 GCCTGGCCATGCAGTGAAGAAGG - Intronic
1081301192 11:41454092-41454114 CCCTGTGCATGGAGAGAACAGGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081690546 11:45074951-45074973 GGCTGGGTGTGGGGAGGAGAAGG - Intergenic
1081846055 11:46241285-46241307 GCCAGGGTATTGGGTGAAGAGGG - Intergenic
1082774847 11:57237005-57237027 GCTGGGGAGTGGAGAGAAGACGG + Exonic
1082778761 11:57269795-57269817 GCCTGGGAATGGAGGGAGCAAGG + Intergenic
1082948702 11:58788197-58788219 GCCTGGGCAAGGAGTGGAGAGGG - Intergenic
1084089370 11:66870173-66870195 GACTGGGGATGGGGAGAAGAGGG - Intronic
1084273382 11:68040389-68040411 GCCTGGGAAAGGAGAGAAGGAGG - Intronic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085746415 11:79118558-79118580 GCCAGGGTCTGGAGGGAAGGGGG - Intronic
1086277685 11:85150505-85150527 GCCTAGGGCTGGAGAGATGAGGG - Intronic
1086499120 11:87434173-87434195 GCCTGAGGATGAAGAGAAGAGGG + Intergenic
1087562076 11:99802960-99802982 GCCTAGGCATGGAGTGGAGAGGG + Intronic
1088425478 11:109696932-109696954 GCCTGGGTGTGGGGTGGAGAGGG - Intergenic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1088917513 11:114238753-114238775 CCCTGGGGATGGAGACAAGCTGG - Intronic
1089004009 11:115075557-115075579 GCCGGGGGAGGGAGAGATGAGGG + Intergenic
1089680969 11:120118712-120118734 GCCTGGGGCAGGAGAGAAGATGG - Intronic
1090237261 11:125158521-125158543 CCCTGGGTACAGGGAGAAGAGGG + Intergenic
1091070447 11:132558137-132558159 AGCTGGGTATGAAGAGATGAAGG - Intronic
1091467954 12:702032-702054 GCCTGGGCCTGGAGGGAGGAAGG + Intergenic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1092259235 12:6943789-6943811 GTATGTGTTTGGAGAGAAGATGG - Intronic
1092289352 12:7149896-7149918 GCCAGGCTATGGAGAGGAGCAGG - Intronic
1092592241 12:9962918-9962940 GGCTTGGTATGGAGAGATAACGG + Intronic
1093809254 12:23472523-23472545 GCCTGGGGCTGGAGTGAAGTGGG - Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093809338 12:23472978-23473000 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1094325518 12:29233793-29233815 GCCTAGCTCTGGAGGGAAGAAGG - Intronic
1095400918 12:41814056-41814078 GCCTGGGAATGGAGTGTAGAGGG + Intergenic
1095640010 12:44476803-44476825 CCCTTGGTTTGGAGAGAACATGG + Intergenic
1095878774 12:47109708-47109730 GCCTGTGCAAGGAGAGAAGGGGG + Intronic
1095915689 12:47475488-47475510 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1096620028 12:52858699-52858721 GCCTGGGTATGGGGTAGAGAAGG - Intergenic
1096775307 12:53960071-53960093 GCCTGGGTCTGAATAGAGGAGGG + Intergenic
1097161306 12:57048434-57048456 GCCAGGGTAGGAAGAGAGGAAGG - Intronic
1097529588 12:60781313-60781335 GCCTGGGAATGGGGTGAAGATGG - Intergenic
1097952191 12:65443863-65443885 GCCAGGGGATGGTGGGAAGATGG - Intronic
1098555160 12:71810458-71810480 GCCTGGGTTGGGAGAGAGCATGG + Intergenic
1098664321 12:73141480-73141502 GCATGGTTATTGGGAGAAGAAGG + Intergenic
1098805252 12:75014657-75014679 CCCTGGGGAAGGACAGAAGAAGG - Intergenic
1098917207 12:76269862-76269884 GCCTGGGGATGGGGACAATATGG + Intergenic
1100003054 12:89860519-89860541 GCCTGGGGATGGAGTGAGGAAGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100677393 12:96882132-96882154 GTAGGGGTTTGGAGAGAAGAGGG + Intergenic
1100931904 12:99619226-99619248 GCCTGGGCATGGTGTGGAGAGGG - Intronic
1102546927 12:113664068-113664090 CCCTGGGTAGGGAGAGACCAGGG + Intergenic
1102649336 12:114427026-114427048 GCCTGTGCATGGTGAGATGAAGG + Intergenic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1102957128 12:117066050-117066072 GCCGGTGTGTGAAGAGAAGAGGG - Intronic
1103360082 12:120348173-120348195 GCCTGTGTCTGAAGAGGAGATGG - Intronic
1103735212 12:123056747-123056769 GGCTGGGTATGGAGAGAGCCAGG - Intronic
1104868924 12:131980261-131980283 GCTTGTGTATGAAGAGAGGAAGG - Intronic
1105623822 13:22093980-22094002 GCATGGGGGTGGAGAGAGGATGG + Intergenic
1106061369 13:26295854-26295876 GGCTGGGGGTGGGGAGAAGATGG + Intronic
1106101597 13:26698139-26698161 GGCTGGCTTTGGAGAGAAGAGGG - Intergenic
1106506871 13:30378165-30378187 GAGCGGGTTTGGAGAGAAGATGG + Intergenic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1106837611 13:33651873-33651895 GCCTTGGTGGGGAGAGAGGAAGG - Intergenic
1107158543 13:37198196-37198218 GCCTGGGGGTGGAGTGGAGAGGG + Intergenic
1107297160 13:38921640-38921662 GCCTGGGTTTGGGATGAAGAGGG - Intergenic
1109095426 13:58107861-58107883 GCCTGGGTATGGTGTGGAGAGGG + Intergenic
1110491764 13:76118083-76118105 GCCTGGGGATGGAGCAGAGAGGG - Intergenic
1110638233 13:77790998-77791020 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1110742996 13:79019154-79019176 GCCTGGGGATGGAGCAGAGATGG + Intergenic
1110763111 13:79252385-79252407 GCCTGGGTCTGGGGAGGACAAGG + Intergenic
1111152291 13:84270647-84270669 GGCTGGGGAGGGAGAGAAAAGGG - Intergenic
1112223470 13:97514514-97514536 GCCTGGGAATGGAGCGGAGAAGG + Intergenic
1113294069 13:108938621-108938643 GCCTGGGCATGGAGCAGAGAGGG + Intronic
1113866923 13:113532519-113532541 GCCTCTGTGTGGAGAGCAGATGG + Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114832731 14:26164401-26164423 GCCTGGGTGTGGAGTGTAGACGG + Intergenic
1117294072 14:54362863-54362885 GCATGGGAATGGACAGAAGGAGG + Intergenic
1117411096 14:55451901-55451923 GCCTGGGTTTAGAGATTAGAGGG - Intronic
1117788932 14:59317879-59317901 GCCTGGGGGTGGGGAGAAGGTGG - Intronic
1117824441 14:59687317-59687339 GCCTAGGCATGGAGTGGAGAGGG - Intronic
1118145416 14:63129436-63129458 GCCTCCGTGTGGAGAGAATAAGG + Intergenic
1118480460 14:66159686-66159708 CCCTGGGGTTGGAGAGAACATGG + Intergenic
1118723454 14:68609915-68609937 GCACGGGGATGGAGAGAAAATGG - Intronic
1119275050 14:73347818-73347840 GCCTAGGGAAAGAGAGAAGATGG - Intronic
1120121038 14:80680406-80680428 TCCTGGGCATGGAGCGCAGAGGG - Intronic
1120279405 14:82420074-82420096 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1122903736 14:104792551-104792573 GCCTGGGGAGGGAGAGATGGGGG - Intronic
1124630143 15:31331527-31331549 GCCTGGGAAAGCAGAGCAGAGGG + Intronic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1125130505 15:36279044-36279066 GCCGGGGCATGGAGCCAAGAGGG + Intergenic
1125130544 15:36279254-36279276 GCCTGGGTATGGAATGGAGAGGG + Intergenic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125383852 15:39115458-39115480 GCCTGAGCATGGAGTGGAGAGGG - Intergenic
1125531418 15:40415957-40415979 GCAGGGGCATGGAGAGGAGATGG - Intronic
1126714450 15:51499688-51499710 GACTGGGTATCAAAAGAAGATGG - Exonic
1127256773 15:57299605-57299627 GGCTGGGAATGGAGAGAGAAAGG + Intergenic
1127494111 15:59493449-59493471 GCAAGGGTAGAGAGAGAAGAGGG - Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1129319406 15:74765954-74765976 GCCTGGGGCTGGGGAGAAGGGGG + Intergenic
1130659826 15:85822349-85822371 GCCTTCGCATGGAGAGAAAAGGG - Intergenic
1130715479 15:86329536-86329558 GCCTGGGCATGAAGTGGAGAGGG - Intronic
1130715533 15:86329874-86329896 GCCTGGGCATGGAGCAAAGAAGG - Intronic
1130956171 15:88629027-88629049 CCCTGGGTATAGACAGTAGAAGG + Intronic
1131284399 15:91045121-91045143 CCCTGGGTTTGGAGAGCAGGAGG + Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1131585093 15:93684435-93684457 GCCTGGGTATGGAGCAGAGAGGG - Intergenic
1132294136 15:100722973-100722995 CCCTGGGTAGAGGGAGAAGAGGG - Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1133303210 16:4795541-4795563 GGCTGGGCAAGGAGAGAAGCTGG + Intronic
1135353217 16:21747930-21747952 GTTTGGCTATGGAGAAAAGATGG - Intronic
1135451704 16:22564053-22564075 GTTTGGCTATGGAGAAAAGATGG - Intergenic
1135775077 16:25250469-25250491 GCTTGGGTAAGGGGAGATGATGG + Intronic
1137398788 16:48136241-48136263 GCCTGGAGGTGGAGATAAGAGGG - Intronic
1137430110 16:48411766-48411788 GCTTGGGTGTAGACAGAAGAAGG + Intronic
1137532065 16:49284037-49284059 GCCTCAGCATGAAGAGAAGAGGG - Intergenic
1137762624 16:50952827-50952849 GCCTGGGTATGGAAAGCAAAGGG + Intergenic
1138202423 16:55100204-55100226 GCCTGGGTCAGGAGAGCAGCAGG + Intergenic
1138429618 16:56960560-56960582 GGCTGGGCCTGGAGAGAAAAGGG - Intergenic
1138506379 16:57480294-57480316 GCCTGGGGCTGGAGAGAAACAGG - Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1138558365 16:57785963-57785985 GCCTGGCCATGGAGAGAGGCTGG - Intronic
1139342563 16:66278024-66278046 GCCTGGGTGTGGAGAAGAGAGGG - Intergenic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139342642 16:66278463-66278485 GCCTTGGCATGGAGGGGAGAAGG - Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139581300 16:67875353-67875375 GTCAGAGTTTGGAGAGAAGATGG - Intronic
1140122896 16:72098842-72098864 GCCTCGGCAGGGAGAGCAGATGG + Intronic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1141210307 16:81973517-81973539 GCCTGGGCATGGAGCGGAGAGGG - Intergenic
1141826212 16:86482177-86482199 GCCTGGGCCTGCAGGGAAGAGGG + Intergenic
1142126299 16:88412196-88412218 GCCTGGGACTGGAGAGGGGATGG - Intergenic
1142598677 17:1042055-1042077 GCTTGGGTCTGGAGAGAAGGAGG + Intronic
1143484989 17:7249234-7249256 GCCTAGGTATGCACTGAAGAGGG - Intronic
1143622073 17:8086448-8086470 AGCTGGGGATGGAGAGAAGGAGG - Intronic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1144043396 17:11432885-11432907 GCCTGGGGCTGGAGAGCAGGAGG + Intronic
1144399980 17:14886742-14886764 GCCTGAGTATGGAGTGGAGAGGG + Intergenic
1144802910 17:17943465-17943487 ACTTGGGTATGGAGAGAATGTGG + Intronic
1145404297 17:22571679-22571701 GCCAGGGTAAGGGGAAAAGACGG + Intergenic
1146058227 17:29591608-29591630 GCCTGGGACTGGAGATAAAAGGG + Intronic
1146269813 17:31477385-31477407 GCCTGGGCTTGGGGAGAAGCTGG + Intronic
1146485713 17:33240820-33240842 GGCTGGCTATGGAGAGGACAGGG - Intronic
1146709998 17:35032721-35032743 GTCTGGGTCAGAAGAGAAGAAGG + Intronic
1147945368 17:44077549-44077571 GCCTGGGCAAGGGGAGAAGGTGG - Exonic
1148218600 17:45847375-45847397 ACCTGAGCATGGAGAGAAGATGG - Intergenic
1148813344 17:50309036-50309058 GCCGGTGTCTGGAGAGAAGCAGG + Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149005763 17:51803429-51803451 GCCGGGATTTGGAGAGAAGAGGG - Intronic
1149149075 17:53537271-53537293 CCCTGGGTATGGAGAGTAATGGG + Intergenic
1149796767 17:59528186-59528208 GCCTGGTTTTGGAGACAAGTAGG - Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150197877 17:63319860-63319882 GGCTGCCTGTGGAGAGAAGATGG - Intronic
1150483827 17:65530759-65530781 GCCTGGAAATGGGGAGAAGAGGG - Intronic
1151145236 17:72034407-72034429 GCCTGTGGATGGGGAGAGGAGGG - Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1154036207 18:10804932-10804954 GCAGGGGTATGTAGAGAAGTGGG - Intronic
1154126778 18:11698729-11698751 TCCTGGGGATGAAGAGAAGAGGG + Intronic
1154157552 18:11955839-11955861 GCCTGGGGAGGGAGAGGGGAAGG + Intergenic
1156203196 18:34857218-34857240 TCGTGGGTGTGGTGAGAAGATGG - Intronic
1156426554 18:37019788-37019810 GCCTGGGCATGGAGTGTAGAGGG + Intronic
1156520785 18:37720935-37720957 GATTGGGTATGAAGAGCAGAGGG - Intergenic
1156886453 18:42141163-42141185 GCCTGGGCATGGAGTGGAAAGGG - Intergenic
1156905587 18:42348550-42348572 GCTTGACTTTGGAGAGAAGACGG + Intergenic
1157124643 18:44944626-44944648 GCCTGGGTATGGAGCAATGAGGG - Intronic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157523336 18:48360573-48360595 GCCAGGGGAGGGAGAGAACACGG + Intronic
1157574683 18:48735781-48735803 GCCTGGGTCTGGTGAGAAGGAGG + Intronic
1157799958 18:50611021-50611043 GCCAGGGACTGCAGAGAAGAAGG + Intronic
1157859656 18:51129417-51129439 GCCTGTGCACTGAGAGAAGAGGG + Intergenic
1157940345 18:51921706-51921728 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1158086853 18:53661650-53661672 CCCTGGCAATGGAGAGAACATGG - Intergenic
1159188254 18:65007085-65007107 GCCAGGTTATTGAGATAAGAAGG + Intergenic
1159304015 18:66616262-66616284 GCCTGGGTGCGGAGTGAAGAGGG - Intergenic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160675009 19:385560-385582 CCTTGGGTATGGGGAGAAAAAGG + Intergenic
1160905807 19:1451285-1451307 GCCTGGGTTTGGGGAGCAGGAGG + Exonic
1161440981 19:4291518-4291540 GCCTGGAGGTGGGGAGAAGAAGG - Intergenic
1164658345 19:29940900-29940922 GGCTGGGGATGGAGAGAGGATGG + Intronic
1165660008 19:37569801-37569823 GACTGAGGATAGAGAGAAGAGGG - Intronic
1165914132 19:39247648-39247670 GCCTGAGGATGCAGAGAAGCTGG + Intergenic
1165916739 19:39265290-39265312 GCCTGAGGATGCAGAGAAGCTGG - Intergenic
1167715164 19:51138302-51138324 TCCTGGGAGTGGGGAGAAGAGGG - Intergenic
1168080751 19:54008456-54008478 TCCAGGGTCTGGAGAGAAGGCGG + Intronic
1168183567 19:54681566-54681588 GCAGGGGTAGGGAGAGGAGAGGG + Intronic
1168507118 19:56945694-56945716 GCCAGGGTAACGACAGAAGATGG + Intergenic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925171291 2:1751737-1751759 GCCCAGGAGTGGAGAGAAGAGGG + Intergenic
925363319 2:3294734-3294756 GCATGTGTATAGAGAGAGGATGG - Intronic
925413425 2:3653385-3653407 GGCAGGGTTTGGAGAGGAGAGGG + Intergenic
925692168 2:6536639-6536661 ACCTATGTATGGAGAGGAGATGG - Intergenic
925768447 2:7259712-7259734 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
925862214 2:8190249-8190271 GCTTGGGCAAGGAGAGAAGATGG - Intergenic
926288712 2:11511450-11511472 GCCAAGGCATGGAGACAAGATGG + Intergenic
927404881 2:22755544-22755566 GCTTGGGTAGGGAGACTAGAGGG - Intergenic
928053390 2:28025369-28025391 GCCACAGTATGGAGAGAACATGG + Exonic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928921865 2:36535063-36535085 TCATGTGTATGGAGAGAGGAAGG + Intronic
929131871 2:38583297-38583319 GCATGTGTATGCATAGAAGAAGG - Intronic
929326811 2:40623477-40623499 GCCTGGGGATAGAGAGTACATGG + Intergenic
930188701 2:48436133-48436155 GCTTAGGTATGCAGAGAAAATGG + Intergenic
930210811 2:48635098-48635120 GCCTGGGCATGGAGTGGAGAGGG + Intronic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
930942416 2:57028500-57028522 GCCTGGGTATGAAGAAGAGAAGG + Intergenic
932531101 2:72533542-72533564 GACTGGGTAGTGAGAGATGATGG - Intronic
932652581 2:73574927-73574949 GCCGGGGGCTGGTGAGAAGAGGG - Intronic
932852699 2:75201654-75201676 CCCTGAGTGAGGAGAGAAGAGGG + Intergenic
933336745 2:80968119-80968141 GCCTGGGCATGGAGTGGAGATGG - Intergenic
934706278 2:96483958-96483980 GCCTGGGAAAGGAGAGGGGAAGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
936533364 2:113292101-113292123 GCCTGGGGATGGAGAGGAACTGG - Intergenic
936820205 2:116510868-116510890 GCCTGGATGTGGAGTGGAGAGGG + Intergenic
937202059 2:120210090-120210112 GGCTTGGTGTGGAGAGAAGAAGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
939004774 2:136773734-136773756 GCCTGCCTATTGACAGAAGAGGG + Intronic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
940404375 2:153283929-153283951 GCCTGGGTGTGGAGCTGAGAGGG + Intergenic
940408453 2:153332703-153332725 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
941188026 2:162341740-162341762 GGTTGGGGATGGAGAGAAAAGGG + Intronic
941409921 2:165142131-165142153 CCCTGGGTGTGAAGAGAAGTAGG - Intronic
941587600 2:167379918-167379940 GCCTGTGCATGTAGAGGAGAGGG + Intergenic
941684834 2:168437846-168437868 TGCATGGTATGGAGAGAAGAAGG + Intergenic
941878927 2:170462106-170462128 TCCTGGGTTTAGAAAGAAGAGGG - Intronic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
942814794 2:180039829-180039851 GCCTTGGGCTGGAGAGCAGATGG - Intergenic
943141870 2:183993056-183993078 GCCTTGGTTTGGAGTGGAGAAGG + Intergenic
943141887 2:183993169-183993191 GCCTGGGCATGGAGCAATGAGGG + Intergenic
943149786 2:184097706-184097728 GCCTGGGCATGGGGAGAATGGGG + Intergenic
943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG + Intronic
943912284 2:193584183-193584205 GCCTGAGTGTGGATGGAAGAGGG - Intergenic
943912297 2:193584295-193584317 GCCTGGGTGTGGAGCAGAGATGG - Intergenic
944605356 2:201347336-201347358 GCAGGGGTGTGGAGAGAGGAGGG - Intronic
945494934 2:210498785-210498807 GCCTGGGTGTGGAGTGTAGAGGG + Intronic
945494951 2:210498898-210498920 GCCTGTGCATGGAGTAAAGAGGG + Intronic
945495012 2:210499238-210499260 GCCTGGGAGTGGAGTGGAGAGGG + Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946338346 2:219053427-219053449 GCCTTGGGATGGAGAGATGGAGG + Intergenic
947716188 2:232339951-232339973 GGCTAGGTATGGAGAGAGCAGGG + Intronic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948790804 2:240375913-240375935 ACCTGAGTGTGGAGAGAACAAGG + Intergenic
1168748504 20:265453-265475 GCCTTGGAAAGGAGAGAAGGAGG + Intergenic
1168863088 20:1060197-1060219 GCATGGGTATGTAGACCAGAAGG + Intergenic
1169534289 20:6520952-6520974 GACTGGGGATGGGGAGAAAAGGG - Intergenic
1170174379 20:13452733-13452755 GCCTCAGGATGGAGAAAAGAAGG + Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171254623 20:23680088-23680110 GCCTGGTTGTGGAGTGAAGAGGG + Intergenic
1171261105 20:23735361-23735383 GCCTGGTTGTGGAGTGAAGAGGG + Intergenic
1171264908 20:23763356-23763378 ACCTGGGTATGGAGTACAGAGGG - Intergenic
1171264926 20:23763469-23763491 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1171270226 20:23811203-23811225 GCCTGGTTGTGGAATGAAGAGGG + Intergenic
1171274554 20:23845047-23845069 ACCTGGGTATGGAGTACAGAAGG - Intergenic
1172357458 20:34290212-34290234 GCAGGGGGATGGGGAGAAGAGGG - Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1173585921 20:44183099-44183121 ACCTTGGTTTGAAGAGAAGAGGG + Intronic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1174404806 20:50296209-50296231 GCCTGTGTGTGGAGATGAGAGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175702269 20:61148208-61148230 TGCTGGGAATTGAGAGAAGAGGG + Intergenic
1177247717 21:18551482-18551504 GACTGGGGATGGAAACAAGAGGG - Intergenic
1177294854 21:19160888-19160910 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
1177966564 21:27735224-27735246 GCCTCTGTATGCAGAGAACATGG + Intergenic
1178405062 21:32316973-32316995 GCCTGGGGAGGCAGAGGAGATGG - Exonic
1179461091 21:41535900-41535922 GGCTGGATTTGGAGAGGAGAGGG + Intergenic
1180161461 21:46000310-46000332 TCCTGGGGAGGGAGAGACGAGGG - Exonic
1180709783 22:17831923-17831945 GCCTGGGAATGAAGAGGAGGAGG - Exonic
1181570794 22:23767021-23767043 ACCTGGGTGTGGGGAGAACAGGG + Intronic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1181979091 22:26753293-26753315 GCCTGGTTAAGGGGAGTAGAGGG + Intergenic
1183353517 22:37346393-37346415 GCCTGGGTTGGGAGGGAAGGAGG - Intergenic
1183564143 22:38601217-38601239 GCCAGGGTATGGAGAGTGGTAGG + Intronic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1184406603 22:44304142-44304164 GCCTGGTCAGGGAGAGCAGAGGG + Intronic
1185315330 22:50176556-50176578 GGCTGTGTGTGGATAGAAGAAGG + Intronic
949231683 3:1757363-1757385 GCCTGGACATGGAGTGAAGAGGG - Intergenic
949441698 3:4088227-4088249 ACCTGAGTATGGAGAGTGGAAGG - Intronic
950030544 3:9849741-9849763 CCCTGGGAATGGGGAGAAAAAGG - Intronic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
950863220 3:16168876-16168898 CCTTGGGTATGGAGAGCAGGTGG + Intergenic
951193956 3:19803702-19803724 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951325409 3:21296894-21296916 GCCTGGGTGTGGAGTGGAGGGGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951704060 3:25526132-25526154 GCACAAGTATGGAGAGAAGAGGG + Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
954160159 3:48715592-48715614 GCCTGGGTAGGGAGGGAGCAAGG - Intronic
954208320 3:49077332-49077354 GCTTGGCTCTGCAGAGAAGATGG - Intronic
954578724 3:51691460-51691482 GCCTGGGTGTGGGGAGGGGAGGG + Intronic
954618791 3:51984148-51984170 GCCTGACTATGGTGAGAAGACGG + Exonic
955195396 3:56801257-56801279 GCCTGGGTTGTGAGAGCAGAGGG - Intronic
958049147 3:88322069-88322091 CCCTGGCTATGGATAGGAGAGGG + Intergenic
959300481 3:104593386-104593408 GCTTGGTTATGATGAGAAGATGG - Intergenic
959378204 3:105610689-105610711 GCCTGGGTATTGAGAACAGGTGG - Intergenic
959430648 3:106251332-106251354 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
959754087 3:109875639-109875661 GCCTGGGCATGGAGCACAGAGGG - Intergenic
960427628 3:117528351-117528373 TCCTGGAGATGGAGAGTAGAAGG - Intergenic
960629724 3:119717679-119717701 GCCAGGGTGGGGAGAGAAAAGGG - Intronic
960864940 3:122190047-122190069 GACTGGGTAGGAAGAGAAGTGGG + Intronic
961657708 3:128452518-128452540 GCCTGGGAAGGGACACAAGATGG + Intergenic
962421751 3:135235002-135235024 TTCCAGGTATGGAGAGAAGAGGG - Intronic
962931442 3:140041383-140041405 TCCTGGATATGGAGAGACAAGGG - Intronic
963522062 3:146367469-146367491 GGTTGGGTATGGAGAGATAATGG - Intergenic
963546980 3:146671964-146671986 GCCCGGGCGTGGAGTGAAGAAGG + Intergenic
964919182 3:161875339-161875361 GCCTAGGCATGGAGTGGAGAAGG - Intergenic
965560524 3:170057850-170057872 GCCTGGGAAGGGAGAGAGGAGGG + Intronic
965940095 3:174169080-174169102 GCCTGGGCATGGAGCAGAGAGGG + Intronic
966217421 3:177517986-177518008 GCCTGGGTCTGCAGATTAGATGG + Intergenic
966459924 3:180165518-180165540 GCCTGGGTGTGGAGTGGAAAGGG + Intergenic
966459977 3:180165843-180165865 GCCTGGGTATGAAGCAGAGAGGG + Intergenic
967409592 3:189153996-189154018 GGCTGGCTTTGGAGAGATGATGG - Intronic
968107869 3:196015126-196015148 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
968464156 4:742148-742170 GCCTGGGGAGAGAGAGAGGAGGG - Intronic
968575985 4:1366421-1366443 GCCTGAGTATGGTGAGCAGTGGG + Exonic
969717350 4:8874143-8874165 GCCTGGGATGGGAGCGAAGAGGG + Intergenic
969858958 4:10020968-10020990 CCCTGGGGAGGGTGAGAAGAGGG + Intronic
970469656 4:16364336-16364358 GCGAGGGTATGCTGAGAAGAAGG - Intergenic
970806206 4:20037002-20037024 GCCTGGGACTGGAAAGGAGAGGG - Intergenic
971531306 4:27692687-27692709 GCCTGGGCATGCAGTGTAGAGGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
971855810 4:32042172-32042194 GGCTGTGTATTGGGAGAAGAGGG - Intergenic
972043964 4:34639960-34639982 GCCTGGGAATGGAGTAGAGAAGG - Intergenic
972050926 4:34732299-34732321 GCCTGCTTATGGAGATAGGAGGG - Intergenic
972182097 4:36479768-36479790 GCCAGGGGCTGGAGAGAAGGAGG - Intergenic
972335835 4:38106668-38106690 GCAGGGGAATGAAGAGAAGAAGG - Intronic
973737704 4:53888798-53888820 GCCAGGGGATGGAGGGCAGAGGG + Intronic
974180650 4:58380067-58380089 TCCTGGGCATGGAGTGGAGAGGG + Intergenic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
975710458 4:77156678-77156700 GCCTGGGTGTGCAGCGGAGAAGG - Intergenic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
976307021 4:83570199-83570221 GCCTGGGGCCAGAGAGAAGAAGG - Intronic
976606502 4:86988309-86988331 GGCGGGGTATGGAGAGAGGTTGG - Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977764100 4:100777098-100777120 GCCTAGGCATGGAAAGTAGATGG + Intronic
977764184 4:100777655-100777677 GCCTGGGCATGGAGTAGAGAGGG + Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
979092010 4:116495272-116495294 GCCTATGAATGGAGAGAAAAAGG + Intergenic
979139429 4:117153276-117153298 GCCTGGGTATGCAGAAAAGAGGG + Intergenic
979139462 4:117153501-117153523 GCCTGGGTGTTGAGTAAAGAGGG + Intergenic
979505057 4:121485870-121485892 GCCTGGGCATAGAGCAAAGATGG + Intergenic
979737408 4:124104562-124104584 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
980167165 4:129242827-129242849 GCCTAGGGATGGAGACAGGAAGG + Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981055202 4:140353167-140353189 GTCTGGGTACAGAGAGAAGGAGG + Intronic
981362402 4:143862865-143862887 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981373132 4:143983633-143983655 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981382227 4:144086908-144086930 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981679615 4:147381674-147381696 GCCTGAGTGTGGAGTGAAGAGGG - Intergenic
981739246 4:147985118-147985140 GCTTGGGTATGGAGCAGAGAGGG + Intronic
981739286 4:147985343-147985365 GCCTGGGGGTGGAGTGTAGAAGG + Intronic
981987399 4:150874745-150874767 GCCTGGGCATGGAGCAAAGAGGG - Intronic
982405636 4:155016718-155016740 GCAGGGATGTGGAGAGAAGATGG + Intergenic
982498740 4:156127435-156127457 GCTGGGGTATGGGGAGAAGGAGG + Intergenic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983474345 4:168196029-168196051 GCCTGGGCATGAAGCAAAGAGGG - Intergenic
984099624 4:175469579-175469601 GCCAGAGTATGGAGTGAAAATGG - Intergenic
984883548 4:184430405-184430427 GCCAGGGAATGAAGAGCAGAGGG - Intronic
984915193 4:184717357-184717379 GCCTGGGTATGGGAAGATGTGGG - Intronic
985469805 5:33193-33215 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
985999113 5:3616323-3616345 GTCTACGAATGGAGAGAAGAAGG + Intergenic
986557385 5:9025381-9025403 GCCTGGGTATGGGGTGAAGAGGG + Intergenic
987459459 5:18190783-18190805 GCCATTATATGGAGAGAAGAAGG + Intergenic
987601488 5:20078020-20078042 GCCTGTGCATGGAGAAAATATGG + Intronic
987669772 5:20991183-20991205 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
987866683 5:23549882-23549904 GCTTGGGTCTGGGGAGAATAAGG - Intergenic
988220146 5:28334006-28334028 GCCTGAGTGTGAAGTGAAGAGGG + Intergenic
988553480 5:32217259-32217281 GCCTGGGTGTGGGGAGAAGGAGG + Intergenic
988646938 5:33105209-33105231 GCCTGGATGTGGAGAAGAGATGG + Intergenic
988966605 5:36424939-36424961 GCCTGGGGATGGGGACCAGAGGG - Intergenic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994399725 5:99264072-99264094 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
994824734 5:104698692-104698714 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
995148332 5:108811276-108811298 GCCTGGGTATGGAGTGGAGTGGG + Intronic
995388685 5:111615622-111615644 GCCTCGGTATGGAGCAAAGAGGG + Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997158360 5:131581394-131581416 GCCTGAGTAAGAAGAGAAGGAGG - Intronic
997221388 5:132168842-132168864 GTCTGGGAATGGAGAGTAGTTGG - Intergenic
997625591 5:135328689-135328711 GCCTGGGAATGGAGAAAGGAGGG - Intronic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
997792673 5:136775524-136775546 GACTTGGTATGGGGACAAGATGG - Intergenic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998703916 5:144737531-144737553 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
998860724 5:146441060-146441082 GGCTGGGTATGGAAAACAGATGG + Intergenic
999301254 5:150491948-150491970 GCCTGGGAAGGGGGAGAGGATGG + Intronic
999323139 5:150626923-150626945 GACTAGGGGTGGAGAGAAGATGG - Intronic
999591141 5:153148055-153148077 GCCAGGGCATGGAGCAAAGAGGG - Intergenic
1000419582 5:161023041-161023063 GACTAGGAAAGGAGAGAAGAGGG + Intergenic
1000592989 5:163181305-163181327 GCCTGCCAATGCAGAGAAGATGG - Intergenic
1001071249 5:168587172-168587194 GCATGGGTATGGGGAAAAGGAGG + Intergenic
1002338719 5:178500042-178500064 ACCTGGGAATGGAGAGAGGGTGG + Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002917431 6:1540596-1540618 CCCTGGGTATGCAGAGCACAAGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003519017 6:6841871-6841893 GCCAGGGTCTGGGGAGATGAAGG - Intergenic
1004843656 6:19614706-19614728 CCCAGGGTATGGAGATATGAGGG - Intergenic
1004853804 6:19728480-19728502 GCCTGGACATGAAGTGAAGACGG + Intergenic
1005232831 6:23724115-23724137 GCCTGGGAATGGAGAAATCAAGG - Intergenic
1005781988 6:29201879-29201901 CCCTGGCTATGGAGAGGAGCGGG + Intergenic
1006067804 6:31474958-31474980 GCCTGAGCAGGGAGAGGAGATGG + Intergenic
1006162666 6:32047302-32047324 GCTTGGCTATGGAAAGACGATGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007370209 6:41421940-41421962 GGCTGGGTTTGGAGAGATTAAGG + Intergenic
1007835993 6:44674176-44674198 GGCTGGGGGTGGGGAGAAGAAGG + Intergenic
1007982250 6:46171114-46171136 GCCTGGGTTTGGAGGGTGGAGGG + Intergenic
1008004695 6:46398760-46398782 GCCTGGGTACTGAGAGCTGAGGG - Intronic
1009656911 6:66558847-66558869 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1009787582 6:68358877-68358899 GCCTGTGGATGGAGTGGAGAGGG + Intergenic
1010083394 6:71888071-71888093 TCCTGGTGATGGGGAGAAGATGG + Intronic
1010475039 6:76276405-76276427 GCCTGGGCATGGAGTAGAGAGGG + Intergenic
1010475056 6:76276516-76276538 GCCTGGGTATGAAGCAGAGAGGG + Intergenic
1010806819 6:80246794-80246816 GCATGGGGCTGGACAGAAGATGG - Intronic
1010948388 6:82005645-82005667 GCTTGGGTGTGGAGTGGAGAGGG - Intergenic
1010989016 6:82458572-82458594 GCCTGGGGGTGGAGCAAAGAGGG + Intergenic
1011123398 6:83979841-83979863 TCCTGGAGATAGAGAGAAGAAGG - Intergenic
1011697642 6:89926987-89927009 ACCTGGGGAGGAAGAGAAGAGGG + Exonic
1011957141 6:93037384-93037406 GCTTGGGCATGGAGTGTAGAGGG + Intergenic
1011957198 6:93037708-93037730 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1013255403 6:108380005-108380027 GCCTGGGCATGGAGCAGAGAGGG + Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014159694 6:118153875-118153897 GTCTGGGAATGGACAGCAGATGG + Intronic
1014907186 6:127044077-127044099 GCCTGGGTATGACCAGCAGAGGG - Intergenic
1015306554 6:131715406-131715428 GCCTGGGCATGAAGTGGAGATGG - Intronic
1015306588 6:131715624-131715646 GCCTGGTTGTGGAGTGGAGAGGG - Intronic
1015350356 6:132210595-132210617 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1015502475 6:133948688-133948710 GACTGGGTATGGAGAAACCAGGG - Intergenic
1015572664 6:134637448-134637470 GCAGGGGGAAGGAGAGAAGAGGG + Intergenic
1015593213 6:134842445-134842467 GCCTGGGGAGGAAGAGAGGAGGG - Intergenic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1016007992 6:139108719-139108741 CCCTGCACATGGAGAGAAGAAGG - Intergenic
1016637714 6:146313858-146313880 GCCTGGGGATGGGATGAAGAGGG - Intronic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1017796550 6:157850046-157850068 GCCTGGGCAAGGAGAGAAGGTGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019912436 7:4108832-4108854 GCCAGGGGATGGGGAGAGGAGGG - Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020462825 7:8443293-8443315 GACTGGGTAGGGGGAGAAGTTGG - Intronic
1020564576 7:9778980-9779002 GCTTGACTTTGGAGAGAAGATGG - Intergenic
1021189420 7:17602811-17602833 GCCTGGTCATGGAGTGGAGACGG - Intergenic
1021558070 7:21941913-21941935 CCTTGGGTTTGGAGAGTAGAGGG - Intronic
1021644159 7:22771435-22771457 GCCAGGGGATGGGGAGAAAAGGG + Intergenic
1022673270 7:32475816-32475838 GCCTGAGAATGGAAAGAACAAGG + Intergenic
1023295195 7:38707761-38707783 GCCAGGGACTGGAGAGAGGAGGG + Intergenic
1024049407 7:45609327-45609349 GGCTGGGGATGGAGAGGAGGCGG + Intronic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1026521021 7:71118409-71118431 GCCTGGGTATGGCTTGAAGTGGG - Intergenic
1027298033 7:76798683-76798705 GCCTGGATATGAAGAGTAGAGGG - Intergenic
1027495134 7:78878771-78878793 GCCTGGGCATGGAGTGGAGAAGG - Intronic
1027704540 7:81511808-81511830 TACTGGTTATGGAGAAAAGATGG + Intergenic
1027934805 7:84589029-84589051 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028431194 7:90749179-90749201 GCCCGGGTGTGGAATGAAGAGGG - Intronic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028566450 7:92237709-92237731 TCCTCTGGATGGAGAGAAGATGG - Exonic
1028805181 7:95018053-95018075 GCCTGTGTATGGAGAGATTCAGG - Intronic
1029148765 7:98465498-98465520 GCAAAGGGATGGAGAGAAGAGGG - Intergenic
1029441625 7:100590009-100590031 GCTTGGGGTTGAAGAGAAGAGGG + Exonic
1029608737 7:101615334-101615356 GCCTGGAGAAGGAGAGGAGAGGG - Intronic
1030237958 7:107287638-107287660 GCCTGGGGATGGAGTGAGGAAGG - Intronic
1031237625 7:119196992-119197014 GCCTGGGTGTAGAGAGGAGAGGG - Intergenic
1031237652 7:119197189-119197211 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
1031237667 7:119197302-119197324 GCCTGTGTGTGGAGTGAAAAGGG - Intergenic
1032096548 7:128941069-128941091 GCATGGGTAAGGGGAGGAGAGGG + Intronic
1032191045 7:129766101-129766123 GCCTGAGTAGAGAGAGAAGGGGG - Intergenic
1032230721 7:130071186-130071208 GCCAAGTTAAGGAGAGAAGAAGG + Intronic
1032459727 7:132101755-132101777 GGCTGGGGCTGGAGAGATGAAGG + Intergenic
1032735693 7:134690941-134690963 GCCTGGCAATGGGGAGAAGTAGG - Intergenic
1032839887 7:135705421-135705443 TCCTAGGTATGGAGAGGAAATGG + Intronic
1033679844 7:143583569-143583591 GCCTGGTTGTGGAGTGGAGAGGG - Intergenic
1033691990 7:143745874-143745896 GCCTGGTTGTGGAGTGGAGAGGG + Intergenic
1033730961 7:144178876-144178898 GCCTGGTTGTGGAGTGGAGAGGG + Intergenic
1033730995 7:144179094-144179116 GCCTGGGCATGAAGTGGAGATGG + Intergenic
1035423836 7:158753686-158753708 GGCTGGGCCAGGAGAGAAGATGG + Intronic
1035468116 7:159092917-159092939 GCCTGAGTCTTGAGAGCAGAAGG - Intronic
1035540148 8:428282-428304 GCCTGGGTGTGGAGAGTTAAGGG + Intronic
1037086197 8:14853740-14853762 GCTTGGGAAAGGAGAGAGGAAGG + Intronic
1037443661 8:18943115-18943137 GCCTGGGTATAGAGACAGGGTGG + Intronic
1037673784 8:21037399-21037421 GGCAGGGAAAGGAGAGAAGAGGG + Intergenic
1037693879 8:21207170-21207192 GCCTGGGGCAGGAGAGAACAAGG + Intergenic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038455686 8:27670879-27670901 ACCTGAGGTTGGAGAGAAGATGG - Exonic
1040041648 8:42921824-42921846 GCTGGTGTATGGAGAGAAAATGG + Intronic
1040758054 8:50804797-50804819 GCCTGGGCATGGAGCGGAGGGGG - Intergenic
1041445645 8:57948539-57948561 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1042109700 8:65367596-65367618 GCCTGGGCATGGAGTGTAGAGGG - Intergenic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043171536 8:76972587-76972609 GCCTGGGTAGGGAGCAGAGAGGG - Intergenic
1043484177 8:80682666-80682688 GCATAGGTGTGGAGAGAAGGGGG - Intronic
1044308541 8:90666056-90666078 GCCTGGGTATGAAGCAGAGAGGG + Intronic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1044686430 8:94830318-94830340 GGCTGGGTGAGGAGAGAAAAAGG + Intronic
1044944629 8:97378941-97378963 GCCTGGGAATGGATAGGAGTGGG + Intergenic
1045078955 8:98603749-98603771 GCCTGGGAAGGAAGGGAAGAAGG + Intronic
1045094619 8:98784837-98784859 GCCTGGGCATGGAGCAGAGAGGG - Intronic
1045480277 8:102586265-102586287 GCCTGGGTACTGAGAGAGGAAGG + Intergenic
1045727090 8:105186419-105186441 GCCTGGGGGTGGAGTGGAGATGG + Intronic
1047369815 8:124247047-124247069 GATTGGATATGCAGAGAAGATGG - Intergenic
1047566204 8:126046856-126046878 GCCTGGGCATGGAGAAGAGAAGG + Intergenic
1048459742 8:134611569-134611591 GCCTGGGGAGGGGGAGAAGCTGG + Intronic
1049529497 8:143147302-143147324 GCATGAGTTTGGAGAGAAGGGGG + Intergenic
1049979647 9:892429-892451 GCCTGGGTGTGTAGAGCAGAGGG - Intronic
1050981442 9:12020844-12020866 GCCAAGGTATGGAAAGAAGAGGG - Intergenic
1050982267 9:12035640-12035662 GCTTGGGGATGGAGCCAAGATGG + Intergenic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1055818159 9:80231768-80231790 GCCAGGATGTGGAGTGAAGAGGG + Intergenic
1056711754 9:88997372-88997394 TCCCGGGAATGGAGAGAAGAGGG - Exonic
1058402096 9:104631432-104631454 ACATGGGTATGGACAGAAAAGGG - Intergenic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060683509 9:125586614-125586636 GCCTGGGTCTCAAGAGAACAAGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061237553 9:129351543-129351565 GCTGGGGTAAGGGGAGAAGAGGG + Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062138833 9:134944332-134944354 GGCTGGGGATGGGGAGAGGAAGG - Intergenic
1062511190 9:136907105-136907127 GCCTGGGTGTGGCGAGGAGCTGG + Intronic
1062539422 9:137035025-137035047 GCCTGGGTGGGGTGAGATGAGGG - Exonic
1186309987 X:8307434-8307456 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1187743609 X:22384295-22384317 GCTTAGGTAGGGAGAGTAGACGG - Intergenic
1187771205 X:22698944-22698966 GCCTTGGTCTGGAGAGAATGGGG + Intergenic
1188140035 X:26538624-26538646 GTATGGGTATGGACAGAAGGAGG + Intergenic
1188256202 X:27964566-27964588 ACCTGGATAAAGAGAGAAGAAGG + Intergenic
1189545477 X:42037964-42037986 GTCTAGGTATGGAGTGAAAAGGG + Intergenic
1189635618 X:43005294-43005316 GCCAGGTTATGGAGTGAAGGAGG - Intergenic
1191774067 X:64793352-64793374 GCTTGGGCATGGAGTGGAGAGGG - Intergenic
1191861553 X:65669545-65669567 TCCTGGGAATGGAGAGAGAATGG + Intronic
1191942480 X:66496361-66496383 ACATGGGTATAGAGAGTAGAAGG - Intergenic
1192212506 X:69136926-69136948 GCCTGGGGATGGGGAGGGGAGGG - Intergenic
1192440079 X:71167795-71167817 GACTGGGTAAGGAGAAAATAGGG + Exonic
1192498993 X:71636330-71636352 GCCTGGGTAGAAGGAGAAGAGGG + Intergenic
1192762081 X:74104451-74104473 GCCTGGGTATGAAGCAGAGAGGG - Intergenic
1193031839 X:76907120-76907142 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1193779211 X:85682658-85682680 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
1194024646 X:88736393-88736415 GCCTGGGTATGGAACAGAGAGGG + Intergenic
1194733718 X:97486924-97486946 GCCAGGGTCTGGGGAGAAGGAGG - Intronic
1194770246 X:97894362-97894384 GCCTGGATATAGAGAGTAGAAGG - Intergenic
1194923554 X:99796317-99796339 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195481055 X:105345713-105345735 CCCTGGGCATGAAAAGAAGATGG - Intronic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1196613694 X:117743226-117743248 TCCTGGGTATGAAGCGAAGAGGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1196773449 X:119318289-119318311 GGCTTGGTATGGAGAGAGAATGG + Intergenic
1197065321 X:122227238-122227260 GGCTTGGTATGGAGAGAGAATGG - Intergenic
1197390824 X:125861522-125861544 GCCTGGGTGTGAAGCAAAGATGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1198975680 X:142333217-142333239 GCCTGGGTATGTAGAAGACAGGG - Intergenic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic