ID: 1085285781

View in Genome Browser
Species Human (GRCh38)
Location 11:75359665-75359687
Sequence AGCAACATTTCTTATTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085285781_1085285788 30 Left 1085285781 11:75359665-75359687 CCTGCAGAATAAGAAATGTTGCT No data
Right 1085285788 11:75359718-75359740 GCAATTTGGGAAGCCAATGAAGG No data
1085285781_1085285786 16 Left 1085285781 11:75359665-75359687 CCTGCAGAATAAGAAATGTTGCT No data
Right 1085285786 11:75359704-75359726 TCGCAGTCATCTCAGCAATTTGG No data
1085285781_1085285787 17 Left 1085285781 11:75359665-75359687 CCTGCAGAATAAGAAATGTTGCT No data
Right 1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085285781 Original CRISPR AGCAACATTTCTTATTCTGC AGG (reversed) Intergenic
No off target data available for this crispr