ID: 1085285787

View in Genome Browser
Species Human (GRCh38)
Location 11:75359705-75359727
Sequence CGCAGTCATCTCAGCAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085285781_1085285787 17 Left 1085285781 11:75359665-75359687 CCTGCAGAATAAGAAATGTTGCT No data
Right 1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG No data
1085285780_1085285787 25 Left 1085285780 11:75359657-75359679 CCAGCAGACCTGCAGAATAAGAA No data
Right 1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085285787 Original CRISPR CGCAGTCATCTCAGCAATTT GGG Intergenic
No off target data available for this crispr