ID: 1085287325

View in Genome Browser
Species Human (GRCh38)
Location 11:75372106-75372128
Sequence CCCCTTCCTTCTCTTTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085287320_1085287325 2 Left 1085287320 11:75372081-75372103 CCTGAGTCCTGGGGTCTGGACTT No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data
1085287313_1085287325 12 Left 1085287313 11:75372071-75372093 CCTGCCCAGCCCTGAGTCCTGGG No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data
1085287316_1085287325 8 Left 1085287316 11:75372075-75372097 CCCAGCCCTGAGTCCTGGGGTCT No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data
1085287321_1085287325 -5 Left 1085287321 11:75372088-75372110 CCTGGGGTCTGGACTTTACCCCT No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data
1085287319_1085287325 3 Left 1085287319 11:75372080-75372102 CCCTGAGTCCTGGGGTCTGGACT No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data
1085287311_1085287325 15 Left 1085287311 11:75372068-75372090 CCTCCTGCCCAGCCCTGAGTCCT No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data
1085287317_1085287325 7 Left 1085287317 11:75372076-75372098 CCAGCCCTGAGTCCTGGGGTCTG No data
Right 1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085287325 Original CRISPR CCCCTTCCTTCTCTTTATTG GGG Intergenic
No off target data available for this crispr