ID: 1085290580

View in Genome Browser
Species Human (GRCh38)
Location 11:75396369-75396391
Sequence GAGAGATAACAGATGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085290570_1085290580 30 Left 1085290570 11:75396316-75396338 CCCACTCTATAGACAGACCAAGG No data
Right 1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG No data
1085290575_1085290580 13 Left 1085290575 11:75396333-75396355 CCAAGGAGTTGGATGAAGAGGCA No data
Right 1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG No data
1085290572_1085290580 29 Left 1085290572 11:75396317-75396339 CCACTCTATAGACAGACCAAGGA No data
Right 1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085290580 Original CRISPR GAGAGATAACAGATGGATGG GGG Intergenic
No off target data available for this crispr