ID: 1085291097

View in Genome Browser
Species Human (GRCh38)
Location 11:75399988-75400010
Sequence TCAACTTGAAGGGTTGCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085291087_1085291097 21 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1085291087 11:75399944-75399966 CCTTAACTGGTCGTTTCTGGGTA 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1085291097 11:75399988-75400010 TCAACTTGAAGGGTTGCTGACGG 0: 1
1: 0
2: 0
3: 4
4: 110
1085291090_1085291097 -6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1085291090 11:75399971-75399993 CCGCTGGCCCCAGGACCTCAACT 0: 1
1: 0
2: 2
3: 21
4: 331
Right 1085291097 11:75399988-75400010 TCAACTTGAAGGGTTGCTGACGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085291097 Original CRISPR TCAACTTGAAGGGTTGCTGA CGG Intronic