ID: 1085295423

View in Genome Browser
Species Human (GRCh38)
Location 11:75428967-75428989
Sequence AAACTGAGGCTCACATACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085295420_1085295423 -6 Left 1085295420 11:75428950-75428972 CCCTTTCTCAGGGGAGGAAACTG 0: 1
1: 9
2: 105
3: 1011
4: 4753
Right 1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG 0: 1
1: 0
2: 3
3: 31
4: 261
1085295419_1085295423 -5 Left 1085295419 11:75428949-75428971 CCCCTTTCTCAGGGGAGGAAACT 0: 1
1: 0
2: 14
3: 182
4: 1494
Right 1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG 0: 1
1: 0
2: 3
3: 31
4: 261
1085295421_1085295423 -7 Left 1085295421 11:75428951-75428973 CCTTTCTCAGGGGAGGAAACTGA 0: 1
1: 5
2: 20
3: 247
4: 1103
Right 1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG 0: 1
1: 0
2: 3
3: 31
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085295423 Original CRISPR AAACTGAGGCTCACATACCA TGG Intronic
901098402 1:6701297-6701319 GAACTGAGTCTCACCCACCAAGG - Intronic
901535552 1:9880720-9880742 AAACTGAGGCTCAAAGTCCCTGG + Intronic
901807892 1:11749471-11749493 AAACTGAGGCCCACATCCTTTGG + Intronic
902502344 1:16919353-16919375 AAACTGAGGCTCAGAGACATTGG - Intronic
903386814 1:22932416-22932438 AAACTGAGGCTCACAGAGATGGG + Intergenic
906809121 1:48808463-48808485 TAACTGAGCCTGACTTACCAGGG - Intronic
907130162 1:52090208-52090230 AAACTGAGGCTCAGAGAGCAAGG - Exonic
907453066 1:54559607-54559629 AAACTGAGGTTCACATGAGATGG - Intronic
907485937 1:54778195-54778217 AAACTGAGGCCCAAAGAGCAGGG - Intergenic
908436726 1:64114113-64114135 AAGATGAGCCTCACCTACCAGGG + Intronic
909341749 1:74539969-74539991 AAACTGAGGCTCAGAAAGGATGG + Intronic
910235220 1:85028694-85028716 AAACTAAGGCTCAGAAGCCAGGG - Intronic
910576260 1:88767783-88767805 AAACTCAGGTTAATATACCATGG - Intronic
910847749 1:91619631-91619653 AAACAGAGGCTCTCTAACCATGG + Intergenic
914968132 1:152279411-152279433 AAACTAAGCCTCATATACGAAGG + Intergenic
915741370 1:158121070-158121092 AAACTGAAGCTCACTTACACAGG + Intergenic
918112898 1:181473244-181473266 TAACTGAGGCTGGCCTACCAGGG + Intronic
919209652 1:194464308-194464330 AACCTAAGGCTGACATTCCATGG + Intergenic
920033311 1:203049889-203049911 ACACTGAGGCTCAGATAACTTGG + Intronic
921713773 1:218398240-218398262 AAAGTGAGGCTCCCAGCCCACGG - Intronic
1062769593 10:88258-88280 AAACTGAGGCTCAGAGACCTGGG + Intergenic
1064768748 10:18701644-18701666 CAACTGAGGCTGAAATTCCAGGG + Intergenic
1065882779 10:30050968-30050990 AAACTGAGGCTGACAGTCCAAGG + Intronic
1067529377 10:47059408-47059430 AGACTGAGGCTCACATGCACAGG + Intergenic
1068882844 10:62068085-62068107 AATCTGAGGCCCACATATCAAGG - Intronic
1069719429 10:70540226-70540248 CAACTGAGACACACACACCACGG - Intronic
1069919906 10:71810235-71810257 AAACTGAGGCCCAGAGACCTGGG - Intronic
1070802169 10:79250235-79250257 AAACTGAGGCTCAGACAGAAGGG - Intronic
1071436768 10:85654755-85654777 GTACTGAGGCTCCCACACCAAGG + Intronic
1073917598 10:108424723-108424745 AAACTGAGGCTCAGAGAAAATGG + Intergenic
1073989603 10:109247635-109247657 AAAATGAGGCAGATATACCATGG - Intergenic
1076197500 10:128529962-128529984 AAAATGAGGCACAAATACAAGGG - Intergenic
1076548488 10:131261834-131261856 CAATTGAGGCCCACACACCAAGG - Intronic
1077187949 11:1243812-1243834 ACACTGGGGCTCACAGCCCATGG - Exonic
1077188375 11:1245483-1245505 ACACTGGGGCTCACAGCCCATGG - Exonic
1077341191 11:2027135-2027157 AAACCGAGGCCCACAGACCCTGG + Intergenic
1077854348 11:6107760-6107782 AGACTGAGGCACCCATTCCATGG + Exonic
1079102421 11:17549862-17549884 GGACTGAGGCTCATGTACCAGGG + Intronic
1079535006 11:21503502-21503524 AAATTGAGGCTCACATAGATAGG - Intronic
1080904395 11:36526441-36526463 AAAATGTGGCACATATACCATGG - Intronic
1082215222 11:49560624-49560646 AAACAGATGCTCACATGGCAAGG - Intergenic
1083305883 11:61761767-61761789 AAACTGAGGCTCAGAAAGGATGG - Intronic
1084076266 11:66779793-66779815 AAAATGTGGCACATATACCATGG + Intronic
1084911266 11:72391384-72391406 AATATGAGGGTCACCTACCATGG - Intronic
1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG + Intronic
1085304726 11:75478861-75478883 AAACTGAGGCTCAGAGAACAAGG + Intronic
1085657956 11:78333884-78333906 AAACTGAGGGTGAAATCCCAGGG - Intronic
1085837946 11:79976361-79976383 AAACTAAGGCTCAGAAAACAGGG + Intergenic
1087572794 11:99951234-99951256 AAAGTGGGGCGCACAGACCAAGG + Intronic
1087641614 11:100760908-100760930 TAACTGAGGCTAACATACTGAGG + Intronic
1089344777 11:117784141-117784163 AGACAGAAGCTCACATCCCAGGG - Intronic
1089616660 11:119698646-119698668 AAACTGAGGCTCACAGGGTAAGG - Intronic
1089747809 11:120629281-120629303 AAACTGAAGCTCACATAGGAAGG - Intronic
1090056379 11:123428457-123428479 AAACGGGGGCTGACATTCCAGGG + Intergenic
1202824176 11_KI270721v1_random:82324-82346 AAACCGAGGCCCACAGACCCTGG + Intergenic
1092096858 12:5849990-5850012 AATCTGAGGCTCTGATCCCAGGG - Intronic
1092585615 12:9898425-9898447 AAATTGGGGTTTACATACCAGGG - Intergenic
1092808199 12:12247130-12247152 ATACTGAGTCTCTCATACTATGG + Intronic
1094391357 12:29954095-29954117 AAAATGTGGCACATATACCATGG + Intergenic
1094432599 12:30386657-30386679 AGACTGAGGATGACATACCTCGG + Intergenic
1098003720 12:65972379-65972401 AAACAGAGGCACACAACCCAAGG + Intergenic
1098533219 12:71565328-71565350 AAATTGAGGCTCAGACACCTTGG - Intronic
1099174552 12:79405789-79405811 AAACAGAGGCCAACATACTAAGG - Intronic
1099395271 12:82130908-82130930 TAACTGAAGGTCACTTACCATGG - Intergenic
1102008393 12:109603153-109603175 ACACTCAGGCTCACAGAGCAGGG + Intergenic
1102015384 12:109644814-109644836 AAACTGAGGCTTATATGTCAAGG + Intergenic
1102527293 12:113520946-113520968 AAACCGAGGCTCACAGAACGAGG + Intergenic
1102657167 12:114491802-114491824 AAACTGAGGCTCAGAAAGAAGGG + Intergenic
1104135164 12:125930942-125930964 AAAGTCAGGCTCAGAAACCAGGG + Intergenic
1105329620 13:19403266-19403288 AAACTCAGGATGACAGACCAGGG + Intergenic
1105862216 13:24425772-24425794 AAACTCAGGATGACAGACCAGGG - Intronic
1106486267 13:30175277-30175299 AAACTGAGGCTCACACAGGCTGG - Intergenic
1106492861 13:30244288-30244310 AAAATGTGGCACATATACCATGG - Intronic
1106839539 13:33672148-33672170 AAAATGTGGCACATATACCATGG + Intergenic
1107677883 13:42816007-42816029 AAACTGAGGCACAGAGACCAAGG - Intergenic
1108194051 13:47973721-47973743 AAAATGCGGCACATATACCATGG + Intronic
1108811128 13:54224653-54224675 AAAATGTGGCACATATACCATGG + Intergenic
1108887124 13:55200128-55200150 ACACTGAGGGTTACATACCCAGG + Intergenic
1109686538 13:65829300-65829322 AAGCTGAGGCACACATATGATGG + Intergenic
1110208730 13:72947867-72947889 AAAATGAGGCACATACACCATGG + Intronic
1111491877 13:88988663-88988685 TAACTCATGCTAACATACCAGGG + Intergenic
1111903075 13:94223708-94223730 AAACTTAGGCTCAGATAGCTGGG + Intronic
1113049797 13:106198535-106198557 AAACTGTGATTCAAATACCAAGG + Intergenic
1114409343 14:22486105-22486127 AAACTGAGCCTCACAGACCCAGG + Intergenic
1115165198 14:30440268-30440290 TATCTGAGTCTCAAATACCATGG - Intergenic
1116047743 14:39764880-39764902 AAACCTATGCACACATACCAAGG + Intergenic
1116860188 14:49988945-49988967 AAACAGAGGCTCATTTTCCAGGG - Intronic
1117196000 14:53340754-53340776 AAACTGAGGCACAGAGTCCAAGG - Intergenic
1117445135 14:55797043-55797065 AAACTGAGGGGAACATAGCAAGG + Intergenic
1117771206 14:59136170-59136192 AAACTCTGGTGCACATACCATGG - Intergenic
1118485660 14:66212434-66212456 CCAGTGAGGCTCACATAGCAAGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120969116 14:90192647-90192669 AAACTGAAGCTCAGAGAGCAGGG - Intergenic
1121832206 14:97062269-97062291 AGACTGATGCTCAAAGACCAGGG - Intergenic
1122089264 14:99327483-99327505 AAACTGAGGCTCAGAGAGGAAGG + Intergenic
1122770782 14:104096745-104096767 AAACTGAGGCTTACAGGCTAGGG + Intronic
1122814872 14:104307415-104307437 AAACTGAGGGCCACCCACCAGGG - Intergenic
1129326239 15:74801643-74801665 AGACTGGGGCTCCCATAGCAGGG - Intronic
1130277321 15:82488032-82488054 AAAAGGATCCTCACATACCATGG + Intergenic
1130469688 15:84215376-84215398 AAAAGGATCCTCACATACCATGG + Intergenic
1130477176 15:84329938-84329960 AAAAGGATCCTCACATACCATGG + Intergenic
1130494589 15:84458192-84458214 AAAAGGATCCTCACATACCATGG - Intergenic
1130591979 15:85220004-85220026 AAAAGGATCCTCACATACCATGG + Intergenic
1132458724 16:38804-38826 AGACTGAGGCTCAGAGACCTAGG + Intergenic
1132691788 16:1184865-1184887 GAAGTGAGGTTCACGTACCATGG + Intronic
1132855109 16:2041211-2041233 AAACTGAGGCTCAGAGCCCCAGG - Intronic
1134865978 16:17607509-17607531 AAGCTGAGGCGCACCTTCCAGGG + Intergenic
1135876642 16:26206592-26206614 CAACTGAAGCTCAGATGCCATGG - Intergenic
1137390137 16:48074508-48074530 AATCAGAGGGTCACATATCAGGG - Intergenic
1137648702 16:50099251-50099273 AAGCTGCTGCTTACATACCAGGG - Intronic
1137712816 16:50578454-50578476 AAAAGGAGGCTCAGGTACCAAGG - Intronic
1137736036 16:50724340-50724362 TAACTGATGCTCTCATAACAAGG - Intronic
1139588125 16:67917330-67917352 GTGCTGAGGCACACATACCAGGG - Intronic
1140657501 16:77155638-77155660 AAAATGTGGCACATATACCATGG + Intergenic
1141035619 16:80622972-80622994 AAACTGAGGCTCAGAGAGAAAGG + Intronic
1141565071 16:84895905-84895927 AAACTGAGGCTCAGAGAAAAGGG + Intronic
1142125115 16:88406342-88406364 AAACTGAGGCACACATACACAGG - Intergenic
1142323308 16:89399016-89399038 AAACTGCGTCTCACAGAGCATGG - Intronic
1146704989 17:34994770-34994792 AGACTAAGGCTTATATACCAGGG + Intronic
1146933039 17:36791531-36791553 CAGCTCAGGCTCACATACCAGGG + Intergenic
1147877181 17:43629914-43629936 AAAGTGAGGCTCAGAAACAACGG + Intergenic
1149161706 17:53701526-53701548 AAACTGAGGCACACATACTAAGG - Intergenic
1151336818 17:73444733-73444755 AAACTGAGGCTCAGGGACCATGG + Intronic
1152477562 17:80528053-80528075 AAACTGAGGCTCAGAGAGAAAGG + Intergenic
1152962655 18:89052-89074 AAACTGAGGCTCAGAGACCTGGG + Intergenic
1153881824 18:9427804-9427826 AAACTGAGGCACATGTACCCAGG + Intergenic
1155693195 18:28652188-28652210 AAACTGGTGCTGACAGACCAGGG - Intergenic
1155742281 18:29303354-29303376 AAGCTGAGGCTTGCATACCCAGG - Intergenic
1155745303 18:29349291-29349313 AAACTGAGGCTCAGAGAAGAGGG + Intergenic
1156766045 18:40656814-40656836 AAAATGTGGTTCATATACCATGG + Intergenic
1158371720 18:56813823-56813845 TAACTGAGGCTGAAAGACCAGGG - Intronic
1159397804 18:67886479-67886501 AAAATGTGGCACATATACCATGG - Intergenic
1160749290 19:726418-726440 AAACTGAGGCTGGCATTCCCTGG + Intronic
1160878714 19:1309954-1309976 AAACTGAGGCTCAGAGAACAGGG - Intergenic
1161248340 19:3267430-3267452 GAATTGAGGCTCAGATTCCAGGG + Intronic
1161768553 19:6219547-6219569 AAACTGAGGCTGACATAGGACGG - Intronic
1162040968 19:7970962-7970984 AAGGTGAGGCTCCCATCCCAGGG - Intronic
1162378374 19:10317937-10317959 AAACCGAGGCTCAAATAAAATGG - Intronic
1162514968 19:11142408-11142430 AAACTGAGGCACACAGGACAAGG - Intronic
1163781462 19:19251432-19251454 AAACTGAGGCTCAGATATAAAGG + Exonic
1165087486 19:33361193-33361215 AAGCTGTGGTGCACATACCATGG - Intergenic
1166554338 19:43688154-43688176 GACCTCAGGCTCACACACCAGGG + Intergenic
1167133685 19:47604004-47604026 AAACTGAGGCTCGCAAACCGAGG + Intergenic
1167604542 19:50474942-50474964 AAACTGAGGCTCAGAGAGCCGGG - Intronic
925235717 2:2275651-2275673 TAAGTGATGCTCACATTCCATGG - Intronic
925547651 2:5035532-5035554 ATACTGAGCCTCACAGAACAAGG + Intergenic
927324061 2:21782696-21782718 AAACTGACGCTCACCTCTCATGG - Intergenic
930905252 2:56558505-56558527 AAACTGAAGCCTACATATCATGG - Intergenic
931077619 2:58734286-58734308 AAACTGAGAATCAAATCCCAAGG + Intergenic
931793782 2:65690122-65690144 AGACTGAGGCACACAGGCCAAGG - Intergenic
932441338 2:71737592-71737614 AAACTGAGGCTCAGAGAGCATGG - Intergenic
933380734 2:81540380-81540402 AAACTGTGGATCAAATATCAAGG - Intergenic
936396844 2:112138174-112138196 AGACTGAGGCTCAGTCACCAAGG - Intergenic
940100533 2:150033087-150033109 AAACTGAGGCTCAAAGATTAAGG + Intergenic
941638264 2:167959968-167959990 AAATTGAGGCTCACAAAGCGTGG - Intronic
941949435 2:171138377-171138399 GCACAGAGGCTCCCATACCAAGG + Intronic
941958902 2:171234178-171234200 AAACTGAGGCTCAGAAGCAAAGG + Intergenic
942826361 2:180181602-180181624 AAACTGAGGGTAACTTAGCAAGG + Intergenic
943923204 2:193737759-193737781 AAACTGGGGCCCACACACTAAGG + Intergenic
944294033 2:198041945-198041967 AAATTGAGGTTCACTTATCAAGG - Intronic
944767418 2:202878549-202878571 AAAATGAGGACCACATACCAGGG + Exonic
946428427 2:219612214-219612236 CAACTGGGACTCAAATACCAGGG - Intronic
946551590 2:220807431-220807453 AAACTGAGCTCCACATTCCAAGG - Intergenic
947226764 2:227847988-227848010 AAATTGAGGCACAGATACAAAGG + Intergenic
948888623 2:240896384-240896406 ACACAGAGGCTCCCATCCCAGGG - Intronic
1168946199 20:1760296-1760318 ATGCTGAGGCTCACAGTCCATGG - Intergenic
1170030321 20:11937549-11937571 GAACTGAGGCTCAGATATCCTGG + Intergenic
1172178597 20:32987247-32987269 AAACTGAGGCTCAAAGAGCCAGG - Intronic
1176954193 21:15081674-15081696 AGAATGATGCTAACATACCAAGG - Intergenic
1178826628 21:36022726-36022748 AAACTGAGGCCCAGAGAGCAGGG - Intergenic
1180565296 22:16658792-16658814 AAACTCAGGATGACAGACCAGGG - Intergenic
1180590126 22:16930370-16930392 AAACTGAGGCACAGAGTCCAGGG - Intergenic
1181415417 22:22755488-22755510 AAACTGAGGGTCTCAACCCAAGG - Intronic
1181861231 22:25820156-25820178 AAACTGAGACTCAGGTAACATGG - Intronic
1181910810 22:26236812-26236834 AAGCTGAGGCTCAGAGGCCATGG - Intronic
1182051184 22:27314040-27314062 AAACTGAGGCTCAGAGGCAAGGG - Intergenic
1182053492 22:27331276-27331298 AAACTGAGGCTCAAAGAACTTGG - Intergenic
1182074916 22:27488735-27488757 AAACTGAGGCCCACCCAGCAGGG - Intergenic
1182102930 22:27670534-27670556 AAACTGAGGCTCAGAGAGGAGGG + Intergenic
1182508049 22:30799518-30799540 AAACTGAGGCCCAAAGACAAAGG + Intronic
1183580979 22:38726578-38726600 AAACTGAGGCTCAGAGCCCAGGG + Intronic
1183797002 22:40127475-40127497 ACACAGAGGCACACATACCCAGG + Intronic
950198519 3:11026577-11026599 AAACTGAGACTCACCTCCTAAGG + Intronic
950486856 3:13278930-13278952 AACCTGAGGCTCAGAAATCATGG - Intergenic
950491754 3:13309524-13309546 AAACTGAGGCTCAAACATGAAGG + Intergenic
950675042 3:14549619-14549641 AAACTGAGGCTCAGAGAAAATGG + Intergenic
951582956 3:24185537-24185559 AAACTGATTCTCAGATACCCAGG - Intronic
952859570 3:37801829-37801851 AAACTGAGGCTCAGAAACTGTGG + Intronic
953185133 3:40630496-40630518 AAACTGAGGACAACAGACCAGGG - Intergenic
955403888 3:58613248-58613270 AAACTGAGGCTGAGAGATCAAGG + Intronic
955903319 3:63780347-63780369 AAAATGTGGCACATATACCATGG - Intergenic
956638331 3:71389297-71389319 AAACTGAGGCTTTCCTACAAGGG + Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
959554277 3:107698907-107698929 AAACAGAGGGTCACAGAGCAGGG + Intronic
961047127 3:123716830-123716852 AAAATGAGGCTCAAATTCTATGG + Intronic
962564721 3:136646074-136646096 AAACTGAGGAGCAGATGCCATGG - Intronic
962985911 3:140535747-140535769 AAACTGAGGCTCAGAGATGAAGG + Intronic
968909677 4:3471312-3471334 AAACTGAGGCCAAGATCCCAAGG + Intronic
968952224 4:3701160-3701182 AAACAGGGGCTCATAGACCAGGG - Intergenic
969223831 4:5781359-5781381 AAACTGTGGCTTAGATACCCTGG + Intronic
969491991 4:7504794-7504816 AAATTGTGGCAGACATACCATGG - Intronic
969506370 4:7590624-7590646 AAACTGAGGCCCAGAGACAAAGG + Intronic
970321649 4:14880759-14880781 AAAAGGAGGCTGCCATACCAGGG + Intergenic
970602653 4:17652686-17652708 AATCTCAGGCTCACAGGCCAGGG - Intronic
974424604 4:61725254-61725276 AAACTGAGGCACAAATACCATGG - Intronic
975787820 4:77911577-77911599 AAATTGAGGCTCAGAGAGCAAGG - Intronic
976168449 4:82279726-82279748 AAAATGTGGCACATATACCATGG + Intergenic
978136285 4:105264974-105264996 AAACTGAAGCTCTAATTCCATGG - Intronic
978804381 4:112785252-112785274 AAACTGAGGCACACATATTAAGG - Intergenic
978926936 4:114257854-114257876 AAAATGTGGCATACATACCATGG + Intergenic
979191177 4:117860481-117860503 AAACTGGGTCTCTCATATCAGGG + Intergenic
980154782 4:129091421-129091443 AAACTGAGATCCAAATACCAGGG - Intronic
980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG + Intronic
981076918 4:140601569-140601591 GAAATGAGGCTCACATACCGTGG - Intergenic
981463635 4:145039931-145039953 AATCTGAGGCTAACATTCCAAGG + Intronic
981748664 4:148073387-148073409 AAACTAAGCCCCACATTCCAAGG - Intergenic
982445234 4:155483323-155483345 AAACTGAGGGTCAGTTAGCAAGG + Intergenic
982679975 4:158417647-158417669 AAACTAAGCCTCACATATGAGGG - Intronic
982692100 4:158560356-158560378 CACCTGAGGCTCAGATAGCATGG + Intronic
986777868 5:11035345-11035367 AAACAGAGGGTTACATGCCAAGG - Intronic
988794038 5:34635820-34635842 AAACTGAGGCTAACAGACAAAGG - Intergenic
989181960 5:38587257-38587279 AAACTGAGGAGCATATACCAGGG + Intronic
990839002 5:60054315-60054337 AAAATGTGGCATACATACCATGG + Intronic
990857470 5:60285824-60285846 AAACTGCCACTCACATGCCAGGG - Intronic
990858297 5:60296724-60296746 AAAATGTGGCACATATACCATGG + Intronic
991010856 5:61881780-61881802 GCACTGAGGCACAGATACCATGG - Intergenic
991402330 5:66264973-66264995 AAACTGATGCACAAATACAAAGG - Intergenic
991656409 5:68908470-68908492 AAAATGTGGCACATATACCATGG - Intergenic
995734898 5:115289378-115289400 CCACAGAGGCTCACACACCAGGG - Intronic
999410656 5:151347050-151347072 AAACTGAGGCTCAATTACCCTGG - Intronic
1000206431 5:159064443-159064465 AAACTGAGGCACACAGCCTAAGG - Intronic
1000430192 5:161142504-161142526 ACACTGAAGTTCACAGACCAGGG + Intergenic
1002302949 5:178267925-178267947 AAACTGAGGCCCACACAGCCCGG + Intronic
1004514631 6:16312036-16312058 ATAATGTGGCTCACACACCAAGG - Intronic
1005458174 6:26041877-26041899 AAACTGAGGGGGACATAGCAAGG + Intergenic
1006101515 6:31688868-31688890 AAACTGAGGCCCCCAGACAAAGG + Intronic
1006784734 6:36658638-36658660 AAACTGAGGCTCAGGTAACTTGG - Intergenic
1008730789 6:54480613-54480635 AAAATGTGGCACATATACCATGG - Intergenic
1010844009 6:80682235-80682257 AAACTGATGTTCAATTACCATGG - Intergenic
1012602923 6:101119928-101119950 AAACTGAGGCTTAGAAACAATGG + Intergenic
1014529036 6:122537538-122537560 AAAATGTGGCACATATACCATGG - Intronic
1016062085 6:139641475-139641497 AAACTGAGCCCTACATAGCAAGG - Intergenic
1017743298 6:157426082-157426104 AATCTGAGGCTGCCAGACCAGGG + Intronic
1022009312 7:26294827-26294849 AAACTGAGGCACAAAGCCCAAGG + Intronic
1022263782 7:28733337-28733359 AAACTGAGGCTCAGGTACCTTGG - Intronic
1022593945 7:31693517-31693539 AAACTGAGGCTCAGAAAGCCAGG - Intronic
1022959655 7:35414404-35414426 AAACTAAGGCTCAGATATCAGGG + Intergenic
1026533684 7:71222316-71222338 AATCTGAGCCTCACACACCCAGG + Intronic
1026928575 7:74210388-74210410 AAACCGAGGCTCCCAGGCCAGGG - Intronic
1026953885 7:74364717-74364739 AAACTGAGGCTCAGAGACCAAGG + Intronic
1028487685 7:91377911-91377933 AATCCAAGGCTCAAATACCAAGG - Intergenic
1028758310 7:94464048-94464070 AAACTGAGGTCCACAGACTAAGG - Intergenic
1030387527 7:108883373-108883395 GAACTGAGAGTCACATGCCAAGG + Intergenic
1031982966 7:128141077-128141099 AATATGAGGCTCACATCTCATGG - Intergenic
1033638588 7:143237878-143237900 AAACTGAGGCCTACCTACCTGGG - Intergenic
1033669876 7:143481627-143481649 AAACTGAGGCTCAGAGAGCAAGG + Intergenic
1042373408 8:68018995-68019017 ACACTTTGGCTCACATATCAGGG + Intronic
1043451245 8:80369165-80369187 AACATGAGTCTCACATAGCATGG - Intergenic
1043889185 8:85637532-85637554 TAACTATGGCTCACCTACCATGG - Intergenic
1044107548 8:88230056-88230078 AAGCTAAGTGTCACATACCATGG + Intronic
1047443381 8:124899138-124899160 TAAATGATCCTCACATACCATGG + Intergenic
1047838961 8:128726840-128726862 AAACTGAGCCTCACTTTCAATGG - Intergenic
1049051658 8:140201902-140201924 GAGCTGAGCCTGACATACCAGGG - Intronic
1049203735 8:141353822-141353844 AAACTGAGGCTTGCCTATCAAGG + Intergenic
1049461718 8:142732667-142732689 TAAAGGATGCTCACATACCAGGG - Intronic
1056432881 9:86546129-86546151 AAACTGAGGCTCAAGGATCATGG - Intergenic
1056433937 9:86557072-86557094 AAAATGATGCACAAATACCATGG + Intergenic
1056434640 9:86563809-86563831 AAACTGAGACCAAGATACCATGG - Intergenic
1057753300 9:97809656-97809678 AAACTGAGGCTCAGAGAGTAAGG - Intergenic
1058615637 9:106824492-106824514 AAAATGTGGCACATATACCATGG + Intergenic
1058987232 9:110219600-110219622 AAACTCAGGCTTCAATACCATGG - Intergenic
1059795644 9:117693653-117693675 CAACTGAGGAGCACATGCCAGGG - Intergenic
1060210086 9:121704847-121704869 AAACTGAGGCACACAGTCAAAGG + Intronic
1060546442 9:124464432-124464454 AAACTGAGGCTCAGAAAGGAGGG - Intronic
1060978078 9:127777025-127777047 AAACTGAGGCCCAGAGTCCAGGG + Intronic
1061217821 9:129231885-129231907 AAACTGAGGCTCACAGAGGTGGG + Intergenic
1061772491 9:132936816-132936838 AAGCTGAGCCTCATATACTATGG + Intronic
1062026346 9:134342444-134342466 AAACTGAGGCACAGAGAGCAGGG + Intronic
1062735485 9:138135064-138135086 AAACTGAGGCTCAGAGACCTGGG - Intergenic
1185822985 X:3222438-3222460 CAACAGAGGCTGACCTACCATGG - Intergenic
1186676564 X:11823426-11823448 AACCTGAGGCTCACAGACATTGG + Intergenic
1186712412 X:12213114-12213136 AAACTGAGGCTCAGAAACACAGG - Intronic
1186780227 X:12904778-12904800 AAAGCGAGACTCACATACCCTGG - Intergenic
1186980257 X:14950981-14951003 AAACTGAGGCTCACAGAGGTCGG + Intergenic
1188593754 X:31871464-31871486 AAACTGAGGCTCACAGAGAGAGG + Intronic
1190788280 X:53675132-53675154 AAATAGAGGCTCCCATACCCAGG - Intronic
1193608003 X:83592324-83592346 AAACTGAGGCTCTAAAAACATGG - Intergenic
1195076194 X:101329049-101329071 AAACTGAGCTTCACATATGAAGG + Intergenic
1195152221 X:102083697-102083719 ACACTGAAGCTCACATAGAATGG + Intergenic
1196166271 X:112538652-112538674 ACAGAGAGGCTCACATAGCAAGG + Intergenic
1197063931 X:122216470-122216492 AAACTGAGGCTCAGAGAAAAAGG + Intergenic
1197961672 X:132013188-132013210 AAAATGAGCCTCAAACACCAAGG + Intergenic
1198195974 X:134362876-134362898 AAACTGAATCTCACAGTCCAGGG - Intergenic
1199165079 X:144662744-144662766 AAAATGTGGCACATATACCATGG - Intergenic
1200397705 X:156000917-156000939 AAACTGAGGCTCAGAGACCTGGG - Intronic
1202601672 Y:26600184-26600206 AAACTCAGGATGACAGACCAGGG - Intergenic