ID: 1085295662

View in Genome Browser
Species Human (GRCh38)
Location 11:75430318-75430340
Sequence GGCCAGCGCCGCCGCCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 3, 2: 14, 3: 121, 4: 724}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085295657_1085295662 6 Left 1085295657 11:75430289-75430311 CCCGCTCCGTACACGTAGTCGAG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG 0: 1
1: 3
2: 14
3: 121
4: 724
1085295654_1085295662 26 Left 1085295654 11:75430269-75430291 CCTCCGCGCGCAGCCGCACGCCC 0: 1
1: 0
2: 2
3: 37
4: 434
Right 1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG 0: 1
1: 3
2: 14
3: 121
4: 724
1085295659_1085295662 0 Left 1085295659 11:75430295-75430317 CCGTACACGTAGTCGAGCACCAC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG 0: 1
1: 3
2: 14
3: 121
4: 724
1085295656_1085295662 13 Left 1085295656 11:75430282-75430304 CCGCACGCCCGCTCCGTACACGT 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG 0: 1
1: 3
2: 14
3: 121
4: 724
1085295658_1085295662 5 Left 1085295658 11:75430290-75430312 CCGCTCCGTACACGTAGTCGAGC 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG 0: 1
1: 3
2: 14
3: 121
4: 724
1085295655_1085295662 23 Left 1085295655 11:75430272-75430294 CCGCGCGCAGCCGCACGCCCGCT 0: 1
1: 0
2: 2
3: 10
4: 145
Right 1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG 0: 1
1: 3
2: 14
3: 121
4: 724

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085295662 Original CRISPR GGCCAGCGCCGCCGCCGCCC CGG Exonic
900092019 1:924719-924741 GGCCACCGCGGCCGCGGCCCCGG + Intergenic
900120154 1:1045415-1045437 GGCCAGTGCTCCTGCCGCCCAGG + Exonic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
901045411 1:6393111-6393133 GGCCTTCCGCGCCGCCGCCCCGG - Intronic
901109836 1:6785644-6785666 GCCCGGCGCCGCCGATGCCCGGG - Intronic
901433995 1:9235079-9235101 CGCCGGCCCCGCCGCCGCCCCGG + Intronic
901489416 1:9589090-9589112 GGCCCGCCCCCGCGCCGCCCCGG + Intronic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
903115532 1:21176303-21176325 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903446160 1:23424176-23424198 CGCCATCGCCGCCGCTCCCCGGG + Intronic
903466858 1:23558101-23558123 GACCAGCTCTGCCGCCGCCTTGG + Exonic
903614757 1:24643556-24643578 GGCCACCGTCGCCGCCGCGTAGG - Intronic
903950673 1:26994300-26994322 GGCCCGCGCCGCGGCCGCCGCGG + Exonic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904724879 1:32539662-32539684 TCCCAGCACTGCCGCCGCCCGGG - Intronic
904744453 1:32702571-32702593 GGCCCGCGTCGCCGCCCCGCTGG - Intronic
904772211 1:32886634-32886656 CCCCAGCGCCCCCGCCACCCGGG - Intronic
904822667 1:33255997-33256019 GGCCACGGCCGCCGGGGCCCCGG + Intergenic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905416667 1:37808581-37808603 GGCCACCCCCACAGCCGCCCCGG + Exonic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905881565 1:41467486-41467508 GGCCAGCCCAGCTGCAGCCCCGG - Intergenic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906365422 1:45205978-45206000 CGCCGGCGCCGGGGCCGCCCCGG + Exonic
906532816 1:46533203-46533225 GCCCGGCGCGGCCGCCACCCTGG + Intergenic
906534519 1:46544177-46544199 GCCCATCGCTGCCGCCGCCGGGG - Intergenic
906615621 1:47231201-47231223 GGGCAGAGCAGCCGCCGACCGGG + Intronic
906615824 1:47232213-47232235 GGGCCGGGCCGCCGCCGCTCAGG - Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
907231355 1:53002106-53002128 TGCAAGCTCCGCCGCCTCCCAGG - Intronic
908527581 1:65002685-65002707 CGCCTCCGCCGCCGCCGGCCAGG - Intergenic
908714299 1:67053782-67053804 GGCCTGGGCCGCCGCCGCCTCGG + Intronic
910200150 1:84690559-84690581 GGCCTGCGGCGCCGGCGCGCGGG - Intronic
910759106 1:90718023-90718045 GGCCCGCGCCCCCGCCACCGAGG + Intergenic
910936405 1:92486592-92486614 GGCCCGCGGTGCCGCCGGCCTGG + Intronic
911498828 1:98661685-98661707 CGCCACCGCCGCCGCCAGCCCGG - Intronic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
913250850 1:116910669-116910691 CGCCATAGCCGCCGCCGGCCGGG + Intronic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913615720 1:120558171-120558193 AGCCGCCGCCGCCGCCGCCTCGG - Intergenic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914574556 1:148952731-148952753 AGCCGCCGCCGCCGCCGCCTCGG + Intronic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914702810 1:150149929-150149951 GCCCAGCGCGGCCGCTCCCCCGG - Intronic
915225031 1:154405670-154405692 GGCCAGCGCCGCTCCCGGCGCGG - Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915511346 1:156388564-156388586 TGCGCCCGCCGCCGCCGCCCAGG + Intergenic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916651769 1:166839898-166839920 CGCCACCGCCGCCGCGCCCCCGG - Intronic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
919070689 1:192751496-192751518 GGGCAGCTCCGCCGCAGCCCTGG + Intergenic
919826483 1:201506971-201506993 TGCCAGCCCCGCCGCAGCCCCGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920535215 1:206732690-206732712 GGCCAGAGCCGCAGCCTCCAGGG - Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924415211 1:243850445-243850467 GCCCAGAGCCGCCGCCCCGCCGG - Intronic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1063450064 10:6145123-6145145 GGGCGGCACCGCCGCAGCCCGGG - Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065589781 10:27252570-27252592 CGCCCCCGCCGCCGCCGCCAGGG + Intergenic
1067337056 10:45374500-45374522 GGCCCTCGGCGCCCCCGCCCAGG - Intronic
1067520178 10:46994405-46994427 TGCAAGCTCCGCCGCCTCCCAGG + Intronic
1067686109 10:48466758-48466780 GGCCAGCGCCGCCCCAGGCCCGG + Intronic
1069495682 10:68901358-68901380 GGCCACCGCCGCCTCCCTCCGGG - Exonic
1070147005 10:73781920-73781942 ACCCAGCGTCGCCGCAGCCCCGG + Intergenic
1070333099 10:75431764-75431786 GGCCAGCCCCGCCTCCGCCCGGG + Intronic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1072421106 10:95291067-95291089 GGGCGGAGCCGCCCCCGCCCTGG - Intergenic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1072891606 10:99329723-99329745 GGGCCACGCCGCCACCGCCCGGG - Exonic
1073196436 10:101695145-101695167 AGCCGCCACCGCCGCCGCCCCGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074865456 10:117542237-117542259 GGCCGGCGCCGCCTCCGCTGCGG - Intergenic
1074866130 10:117545347-117545369 GGCCGGCTCCGCAGCCGCCCTGG - Intronic
1074995424 10:118754188-118754210 GGCCAGCGCCTGAGCGGCCCTGG - Intronic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1075485442 10:122818765-122818787 GGCCAAAGCGGCCGCGGCCCGGG - Intergenic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076750092 10:132538070-132538092 GCCCAGCGCCCGCGCCGCCCGGG + Exonic
1076792536 10:132784927-132784949 CCCCCGCGCCGCCGCCGCACGGG + Exonic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076878678 10:133229845-133229867 CGCCCCCGCCGCCCCCGCCCGGG - Intergenic
1076895407 10:133308987-133309009 AGGCAGCGGCTCCGCCGCCCCGG - Exonic
1076916003 10:133423442-133423464 GGCCGCTCCCGCCGCCGCCCCGG + Exonic
1076993818 11:289055-289077 AGCGACCGCCCCCGCCGCCCAGG + Intergenic
1076996536 11:299827-299849 GGCCAGAGCCCCCTCCGTCCAGG + Intergenic
1077188072 11:1244323-1244345 GGCCACCGCCTCCTCCACCCAGG + Exonic
1077188609 11:1246420-1246442 GGCCACCGCCTCCTCCACCCGGG + Exonic
1077189027 11:1248094-1248116 GGCCACCGCCTCCTCCACCCAGG + Exonic
1077189590 11:1250278-1250300 GGCCACCGCCTCCTCCACCCAGG + Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077360415 11:2138177-2138199 AGCCCGCGCCGCCCCAGCCCCGG + Intronic
1077404114 11:2375196-2375218 GGCCAGCCCCCCTGCCTCCCAGG + Intergenic
1077470828 11:2759809-2759831 GGCCAGCCCCTCCTCCACCCTGG + Intronic
1077916059 11:6612126-6612148 GGCCTCCGCCGCCTCGGCCCCGG - Exonic
1079237104 11:18698868-18698890 AGCCGCCGCCGCCGCCGCCATGG + Exonic
1079815377 11:25050378-25050400 TGCAAGCTCCGCCGCCTCCCGGG + Intronic
1080012328 11:27472003-27472025 ACCCCGCCCCGCCGCCGCCCGGG - Intronic
1080515547 11:33016178-33016200 GGCCAACGCCCCCGCCGAGCGGG + Intronic
1081465392 11:43312062-43312084 GACCGGCGCCACCGCCGCCTCGG - Exonic
1081549092 11:44095867-44095889 CGCCCGCCCGGCCGCCGCCCTGG - Intronic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1081896837 11:46593984-46594006 ACCCGGCGCCGCCGCCGCTCAGG + Intronic
1082807725 11:57461028-57461050 GGGCCGCGCCCCCGCCGCCAGGG + Intronic
1083457170 11:62786933-62786955 GGCCGCCTCCGCCGCTGCCCCGG - Exonic
1083753629 11:64777844-64777866 GCCCAGGGGCGCCTCCGCCCGGG + Intronic
1083772982 11:64878672-64878694 GGCTAGCGCCGCCGCGGCGGGGG + Exonic
1083880867 11:65547657-65547679 ACCCAGGGCCGCCTCCGCCCTGG + Intronic
1083965738 11:66042677-66042699 GGCCGGCGCCGCCGCCGGGCAGG + Exonic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084265616 11:68003872-68003894 GGCCCGCCCCGCCCCCGCCGGGG + Intronic
1084395032 11:68903936-68903958 GGCCATCGCCGCCGCCGGCCTGG - Exonic
1084521818 11:69667801-69667823 GGCCATTGCCGCAGCGGCCCCGG + Intronic
1084892613 11:72244008-72244030 GGCCCCCGCCCCCGCCCCCCGGG - Exonic
1084893765 11:72250611-72250633 GGCCAGCGCCGCTGCCTCTTGGG - Intergenic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085511900 11:77092598-77092620 GGCCAGGGCAGCCGCTGACCCGG - Intronic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1087241824 11:95789538-95789560 CCCGAGAGCCGCCGCCGCCCGGG + Exonic
1088579136 11:111299349-111299371 GGTCAGGGCCGGAGCCGCCCCGG + Exonic
1089273359 11:117316128-117316150 TGCCCGCGCCGCCGCCCGCCGGG - Exonic
1089499922 11:118925842-118925864 GCCGCGCGCCGCCGCCTCCCCGG + Intronic
1089694915 11:120211062-120211084 GGGCAGCGCCGTCTCCGCCTCGG + Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1091616101 12:2052625-2052647 GGCCACCGCGGCTGGCGCCCGGG + Intronic
1091625031 12:2115269-2115291 GGCCAGCCCCGCTGCCGCATTGG - Exonic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1092743145 12:11649482-11649504 GGCGAGCGGCGCAGCCCCCCAGG - Intergenic
1093465070 12:19440200-19440222 TGCCGCCCCCGCCGCCGCCCTGG - Exonic
1094199227 12:27780129-27780151 GGGCAGGGCCGCCGCCTCGCGGG + Exonic
1094375371 12:29783650-29783672 GGCCAGCAGCGCCGCGGCCCCGG + Exonic
1094411168 12:30170068-30170090 TGCCAGCAGCGCCGCGGCCCCGG + Intergenic
1094466036 12:30754767-30754789 GGCCGCCGCTGCCGCAGCCCGGG + Intronic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1096541248 12:52308528-52308550 CGCCTGCGCCCCCTCCGCCCGGG + Exonic
1096598671 12:52714390-52714412 TGCCGCCGCCGCCGCCACCCCGG + Intergenic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1096776373 12:53966811-53966833 AGGCAGCGCCGCAGCCGGCCCGG + Intergenic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097057441 12:56258343-56258365 CGCCACCGCAGCCGCCGCCTGGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101371884 12:104138027-104138049 CGCCAACGCCGCCGCGGCCGGGG - Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101592985 12:106139465-106139487 GGCCGGGGCCGCCGCGGGCCTGG + Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101702061 12:107183409-107183431 GGCCAGCGCAGCCTCCCCCAGGG + Intergenic
1101910501 12:108857442-108857464 GCCCAGCGCCGCCTCCTCCTCGG - Exonic
1101910518 12:108857543-108857565 CGCCACCGCCACCGCCGCCCGGG + Exonic
1101935372 12:109052689-109052711 GGTCATCGCCGCCTCGGCCCGGG - Exonic
1101941418 12:109101978-109102000 GGCCTGTTCCGCCTCCGCCCAGG + Exonic
1101965678 12:109280376-109280398 GGCCAGAGTCGCAGCAGCCCCGG + Intronic
1102003572 12:109573850-109573872 TGCCGCCGCCGCCGCCTCCCCGG - Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1103188630 12:118981844-118981866 GGACAGCGCCCCGGACGCCCCGG + Exonic
1103363864 12:120368920-120368942 GGCCCGCGCCCCCTGCGCCCTGG - Intronic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103526635 12:121573661-121573683 AGCAAGCTCCGCCGCCTCCCAGG + Intronic
1103528051 12:121580480-121580502 CGCAGGCGCCGCCGCCGCCCGGG + Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103764652 12:123271622-123271644 GCCCGGCGCGCCCGCCGCCCGGG - Exonic
1104376287 12:128267425-128267447 GCACAGCGGCGCCGCCGGCCCGG - Exonic
1105578038 13:21671023-21671045 AGGTAGCGCCGCCGCAGCCCGGG - Intergenic
1105943640 13:25171580-25171602 TGACAGCCCCGCCGCCGCCGCGG + Exonic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106719933 13:32427327-32427349 GGCCACTGCCACGGCCGCCCCGG + Intronic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1107468048 13:40666712-40666734 GGCATGCGGCACCGCCGCCCGGG + Intergenic
1107548961 13:41457728-41457750 GGGCAGCCCCGCGGCCGCCGCGG + Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1109789721 13:67230631-67230653 TGCGAGCGCCGCTTCCGCCCGGG - Intergenic
1109866600 13:68272737-68272759 GGCCAGCGACTCCTCTGCCCAGG + Intergenic
1110596504 13:77326487-77326509 GTCCAGCGCTGCCGCCCCCCTGG + Exonic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112402249 13:99086857-99086879 GGTCGGGGCCGCCTCCGCCCCGG + Intergenic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1112652704 13:101416287-101416309 GGTCACCGCCGCCGGTGCCCGGG - Intronic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1113919436 13:113898835-113898857 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919447 13:113898889-113898911 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919458 13:113898943-113898965 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919469 13:113898997-113899019 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919480 13:113899051-113899073 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919491 13:113899105-113899127 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919555 13:113899429-113899451 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919566 13:113899483-113899505 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113919577 13:113899537-113899559 GACCAGAGCAGCCGCCGTCCTGG + Intergenic
1113940395 13:114015838-114015860 GACCAGCTCTGCCTCCGCCCCGG - Intronic
1114120775 14:19668778-19668800 CGCCACAGCCGCCACCGCCCCGG - Intergenic
1114522405 14:23347625-23347647 GGCCAGCGGCACCGCAGCCCTGG - Exonic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1115755015 14:36520751-36520773 GGCCAGCGCTCCAGCCGCCGGGG - Intronic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117875893 14:60249620-60249642 GGCTGCCGCCGCCGCCGCCTCGG + Intronic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118206506 14:63728115-63728137 GCCCAGCCCCGCCCCCACCCGGG + Intergenic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118722392 14:68603811-68603833 GGCCAGCGCGGCCGCAGGGCTGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118971506 14:70641918-70641940 AGCCGCCGCCGCCGCCGCCTCGG - Exonic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1119286380 14:73458339-73458361 CGCCCCCGCCGCCTCCGCCCTGG + Intronic
1119325921 14:73759576-73759598 CGCCCGCTCCACCGCCGCCCAGG + Intronic
1121352560 14:93184994-93185016 GGCCAGCCCGCCCGCCGTCCCGG - Exonic
1122082279 14:99274263-99274285 GCCCAGCGCCGCCGGCGGTCCGG + Intergenic
1122108761 14:99480799-99480821 CGCCACCGCCGCCACCGCCTGGG - Exonic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122631683 14:103110129-103110151 GGCCTCCGCACCCGCCGCCCCGG - Exonic
1122975460 14:105168943-105168965 GCCCCGTGCCCCCGCCGCCCGGG - Intergenic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG + Exonic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1123709979 15:22980190-22980212 TCCCGGCCCCGCCGCCGCCCTGG + Intronic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124484433 15:30102499-30102521 TGCCACCGCCGCCGCCACCAGGG + Intergenic
1124519150 15:30394725-30394747 TGCCACCGCCGCCGCCACCAGGG - Intergenic
1124539506 15:30571496-30571518 TGCCACCGCCGCCGCCACCAGGG + Intergenic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1124759144 15:32436076-32436098 TGCCACCGCCGCCGCCACCAGGG - Intergenic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125957514 15:43800531-43800553 GGCCAGCCCCGCCTCCTCCCCGG + Exonic
1126467689 15:48975925-48975947 CGCCAGCTCCGCGGCCGCCCCGG + Intergenic
1126724976 15:51622728-51622750 CTCGACCGCCGCCGCCGCCCGGG + Intronic
1127577101 15:60302578-60302600 TGCAAGCTCCGCCGCCTCCCAGG + Intergenic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128374414 15:67065401-67065423 AGCCAGGACTGCCGCCGCCCGGG + Intronic
1128453381 15:67819924-67819946 GGCCAGGGCCGCCGCCGCGCCGG + Intronic
1129116454 15:73367934-73367956 TGCCGCCGCTGCCGCCGCCCCGG + Exonic
1129274032 15:74433783-74433805 GGCGGCCGCCGCCTCCGCCCAGG - Exonic
1129692221 15:77720336-77720358 GGCCAGTCCCGCCGCCCGCCAGG + Intronic
1129703545 15:77781859-77781881 GGCCAGAGCTGCTGCCTCCCAGG + Intronic
1129710728 15:77819214-77819236 GGCCTGCGCCCCTGCGGCCCTGG + Intronic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1130115786 15:81002939-81002961 GGCCAGCAGCGCCGACGCGCTGG - Exonic
1130305355 15:82709488-82709510 CCCCAGCGCCGGCCCCGCCCCGG - Intronic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1131160566 15:90102310-90102332 TGTCAGGGCCGCCGGCGCCCAGG + Exonic
1131568168 15:93505560-93505582 GGCCAGCAGCGCCTCCGCCTGGG + Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132252077 15:100341688-100341710 GGCCCGCGCCTCCTCCGCTCGGG + Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132519822 16:381951-381973 GGTCCCCGCCGCCGTCGCCCCGG + Exonic
1132527627 16:425604-425626 AACTAACGCCGCCGCCGCCCAGG - Exonic
1132549893 16:550005-550027 GGCCAGCTCCAGCCCCGCCCAGG - Intronic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132781301 16:1627582-1627604 GGCCAGGGTCGCTCCCGCCCTGG + Intronic
1132793408 16:1706314-1706336 GGCCACCGCCGCCGCCAGCGCGG - Exonic
1132869904 16:2111317-2111339 GGCCAGCCCCGCCGGCCACCTGG - Exonic
1132871492 16:2117541-2117563 GGCCTGGGCCGGGGCCGCCCTGG - Exonic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1132889546 16:2196913-2196935 GCCCCGCGCCGCCGCCGCGTCGG - Intergenic
1133029684 16:3004467-3004489 GGCCCGAGCCGCTGGCGCCCTGG + Intergenic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1133784441 16:8963617-8963639 GGCCCGCGGCCCCGCAGCCCCGG - Intronic
1134163951 16:11915553-11915575 GGCCTCGGCCGCCGCCGCCAGGG + Exonic
1134441550 16:14302173-14302195 GGCCGGCCCAGCCCCCGCCCCGG + Intergenic
1134550536 16:15136619-15136641 GGCCTGGGCCGGGGCCGCCCTGG - Intronic
1134715925 16:16358038-16358060 GGCCTGGGCCGGGGCCGCCCTGG + Intergenic
1134717518 16:16364284-16364306 GGCCAGCCCCGCCGGCCACCTGG + Intergenic
1134957234 16:18387875-18387897 GGCCAGCCCCGCCGGCCACCTGG - Intergenic
1134958831 16:18394121-18394143 GGCCTGGGCCGGGGCCGCCCTGG - Intergenic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136784284 16:32925520-32925542 AGCCCCCGCCGCCGCCGGCCCGG - Intergenic
1136885500 16:33928286-33928308 AGCCCCCGCCGCCGCCGGCCCGG + Intergenic
1137617703 16:49856950-49856972 AGCCGCCGCCGCCGCTGCCCAGG - Intronic
1137683092 16:50368448-50368470 GGGCGGCGCCGCCGCACCCCCGG - Intronic
1137696973 16:50468167-50468189 CGCCAGCCCCGCCGCCAGCCTGG - Intergenic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138425961 16:56932226-56932248 CGACACCGCCGCCGCCGCCATGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1140224431 16:73066729-73066751 GCCCAGGGCCCACGCCGCCCAGG + Intergenic
1140477414 16:75245777-75245799 GGCCAGGGCCCCCGCCTCTCCGG + Intronic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141835775 16:86538317-86538339 TGCCACTGCCGCCGCCACCCTGG - Intronic
1141840129 16:86568576-86568598 CGCCTGCGCCGCGGCGGCCCCGG - Exonic
1142393093 16:89815767-89815789 GGCCACCGCGCCCGCCGCCTCGG + Intronic
1203086941 16_KI270728v1_random:1189526-1189548 AGCCCCCGCCGCCGCCGGCCCGG - Intergenic
1203104393 16_KI270728v1_random:1345715-1345737 TGCCGCCGTCGCCGCCGCCCCGG - Intergenic
1203129121 16_KI270728v1_random:1616653-1616675 TGCCGCCGTCGCCGCCGCCCCGG + Intergenic
1142640994 17:1285931-1285953 GGCCAGCTCCGAGGCCGCTCAGG + Intronic
1142759908 17:2036111-2036133 TGCCAGCCCCGCCACCGTCCAGG - Intronic
1142764080 17:2056123-2056145 TCCCCGCGCGGCCGCCGCCCGGG + Intronic
1142764669 17:2058489-2058511 CGCCAGCGCCCCGGCCGCGCCGG - Exonic
1143078490 17:4365474-4365496 GGCCGACCCGGCCGCCGCCCCGG + Intronic
1143492944 17:7294519-7294541 GGCCACAGCCGCCACCGCCCCGG + Exonic
1143528268 17:7484698-7484720 AGCCTGCGCCGCCTCCGCCTAGG - Exonic
1143583918 17:7842119-7842141 GCGCAGCGCCGCAGCCGCGCGGG - Intronic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1143862562 17:9901598-9901620 TGCCAGCGACGCTGCTGCCCTGG - Intronic
1144586744 17:16491930-16491952 AGCCAGCCCCGGCGCCGCGCCGG - Exonic
1144756186 17:17681839-17681861 GCCTCGCGCCGCCCCCGCCCCGG - Intronic
1144786859 17:17836876-17836898 AGGGAGCGCCGCCGCGGCCCCGG + Exonic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1146353147 17:32112664-32112686 GGCCAGCGCTGAGGCCGCCGCGG + Intergenic
1146433660 17:32822631-32822653 GGCCCGCGCGGCCACCCCCCGGG - Intronic
1147142261 17:38466425-38466447 AGCCAGCCCCGCCCCAGCCCTGG + Exonic
1147144575 17:38477667-38477689 AGCCCCCGCCGCCGCCGGCCCGG - Exonic
1147193231 17:38748911-38748933 GGCCAGCGCCCCTGCCGCCGAGG - Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147720378 17:42536271-42536293 GGCCACCGCCACCGCCTCCATGG - Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148388548 17:47253863-47253885 TGCGAGCGCGGCCGCGGCCCCGG + Intergenic
1148566016 17:48633513-48633535 TGCCGGCACCGCCGCCGCCCAGG - Intronic
1148664098 17:49361919-49361941 CGCCTCCGCCTCCGCCGCCCCGG + Intronic
1148945758 17:51260493-51260515 GGCCGCCGCCGCCGAAGCCCCGG - Intergenic
1149430653 17:56593886-56593908 GCCCTGCGCCGCCGCCGGCCCGG + Exonic
1149461539 17:56833694-56833716 TGCCGGCGCCGCCGCCGCCGGGG - Exonic
1150060683 17:62065695-62065717 GGACATCGCCGCTGCCGCGCCGG - Intergenic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1150217211 17:63477357-63477379 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
1150423167 17:65056596-65056618 TGCCGCCGCCGCCGCCGCCTCGG + Exonic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1150830078 17:68511734-68511756 GGCCAGCGCCGCCCGGGCCCCGG - Intergenic
1151572827 17:74935815-74935837 GGACTGCGCAGCCGCCGCTCGGG - Exonic
1151703157 17:75753904-75753926 CGCCCGCGCCGCCGTCGTCCGGG - Exonic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152240214 17:79157052-79157074 GGCCACCTCCACCGCCTCCCTGG - Intronic
1152321250 17:79609905-79609927 GGCGAGCCCCACCACCGCCCGGG + Intergenic
1152353635 17:79796791-79796813 TGCCGCCGCCGCCGCCGCCACGG + Intronic
1152354147 17:79798467-79798489 CCCCAGCGCCGCCCCCGCCACGG - Intronic
1152360800 17:79832280-79832302 GGCCACCGCCGCCGCGTTCCCGG + Intergenic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152659808 17:81537005-81537027 GGCCCGAGGCGCCGCCGCGCAGG - Exonic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1152834453 17:82520143-82520165 CGCCATGGCCGCCGCCGCCCGGG - Exonic
1152879150 17:82805487-82805509 GGCCACCACTGCCACCGCCCAGG - Intronic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153565610 18:6414728-6414750 GCCCACGGCCGCCGCCGCGCGGG - Intronic
1153565648 18:6414879-6414901 GGGCAGCGGCGCCGCAGCCTGGG - Intronic
1153805311 18:8705333-8705355 CGCCAGCGCCGCCGCGGCACCGG + Intergenic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1157752711 18:50193837-50193859 CGGCAGCGCTGCAGCCGCCCGGG - Intronic
1157794249 18:50560040-50560062 AGCCTGCGCCGCCGCCGCCTCGG - Intergenic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158137641 18:54224334-54224356 GGCCACAGACGCCGCCGCCCCGG + Exonic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1158976691 18:62716436-62716458 GCCCGGAGCCGCCGCCGCCCGGG + Exonic
1159947842 18:74457260-74457282 GGCCAGCCCTGCCCGCGCCCGGG + Exonic
1159952623 18:74496315-74496337 GGCCCGCCCCGCGGTCGCCCTGG - Exonic
1160455246 18:78994805-78994827 GGACAGCCCAGCCGCCGCCCCGG + Exonic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160710569 19:549237-549259 GGCCAGGGCAGCCGCCGGGCAGG + Intronic
1160710817 19:550216-550238 GGCCAACGCCGCCCCCTCCTGGG - Intergenic
1160745552 19:709388-709410 GGCCCGAGCCGCCGCTGCCCGGG - Intronic
1160765304 19:804953-804975 GGCCAGGGCGGGCGCCGTCCCGG - Intronic
1160807873 19:1000587-1000609 CGCCCGCGCCCGCGCCGCCCTGG + Exonic
1160858895 19:1229385-1229407 GGTCGTCGCCGGCGCCGCCCAGG + Exonic
1160858933 19:1229500-1229522 GGCCAGGGCCGGGGCCGCGCGGG + Exonic
1160862129 19:1241916-1241938 TGCCGAGGCCGCCGCCGCCCCGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930758 19:1568446-1568468 GCCCGGCGCCGGCCCCGCCCCGG - Intergenic
1160991702 19:1862911-1862933 GGCCGGCGCGGCGGCGGCCCGGG + Intronic
1160991703 19:1862913-1862935 CGCCCGGGCCGCCGCCGCGCCGG - Intronic
1161022161 19:2015595-2015617 CGCCAACGCCGCCGCCACCCCGG - Exonic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161171207 19:2813303-2813325 GGCCTGCGCTCCCGCCGCCCTGG + Exonic
1161210440 19:3062650-3062672 GGCCCGGCCCGCCCCCGCCCCGG + Intronic
1161314102 19:3609868-3609890 GGCCAGCTCCACCGCCGATCAGG - Intergenic
1161384246 19:3982578-3982600 GGCCAGCCCCTCCACCACCCAGG + Intronic
1161388087 19:4007591-4007613 GGCGCGCGCGGCCACCGCCCGGG - Intergenic
1161461539 19:4400484-4400506 TGCCAGCTCCGCGCCCGCCCCGG + Exonic
1161802641 19:6424563-6424585 CGCCGGGACCGCCGCCGCCCCGG + Exonic
1161854239 19:6754383-6754405 GCCCAGCACCGCCAGCGCCCCGG + Exonic
1161886289 19:6998588-6998610 TGCAAGCTCCGCCGCCTCCCGGG - Intergenic
1161959615 19:7516365-7516387 GGCCAGGGCCGGCGGCGCGCAGG - Intronic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162145589 19:8610905-8610927 GACCAGCGCCCCCGCCGCGTGGG + Intergenic
1162344415 19:10111127-10111149 GGCCGGGGCCGGGGCCGCCCAGG + Exonic
1162577097 19:11505488-11505510 GGCCAGCGGAGCGGCCGCCACGG - Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162896017 19:13765026-13765048 GGCCCGCGCCGCCCGCGACCTGG + Exonic
1162909795 19:13842703-13842725 TGCCGGCGCCGCTGCCGCCGAGG + Intergenic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163158105 19:15449797-15449819 GGCCGGCGGCGCCGCCTCCCCGG - Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163490796 19:17616286-17616308 GGCCTGCAGGGCCGCCGCCCAGG - Intronic
1163583710 19:18153202-18153224 GGCCACCGTCGCCGCAGCCGCGG - Exonic
1163585485 19:18161376-18161398 GGCCAGCCGCGCCCCGGCCCTGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163607083 19:18281424-18281446 TGCCACTGGCGCCGCCGCCCAGG + Exonic
1163612763 19:18309681-18309703 GGCCAGCGCCGCCCATGCCGCGG + Exonic
1163662995 19:18589557-18589579 GGCCTTCGCCGCCGCCTCGCGGG + Exonic
1163695152 19:18760203-18760225 GGCCGGCGCCACCGATGCCCAGG - Exonic
1163708621 19:18832368-18832390 CTCCCGCGCCGCCACCGCCCGGG - Exonic
1163708631 19:18832392-18832414 CGCCCGCGCCCGCGCCGCCCGGG - Exonic
1163793303 19:19320885-19320907 AGCCTGGGCCGCCGCCGCCTGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1164189521 19:22901656-22901678 GGCCCGCGCCGCCACCCCCTGGG - Intergenic
1164615140 19:29663197-29663219 TGCCAGCTCCGCCACCTCCCTGG - Intergenic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165113721 19:33516450-33516472 GGCCAGGACCCCCGCTGCCCTGG + Intronic
1165242988 19:34482062-34482084 GGCCCCCGCCGCCCCCGACCGGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166366566 19:42281113-42281135 GGCCGTCGCCGACGCCGCCCGGG + Intronic
1166802812 19:45468691-45468713 ACCCACCGCCGCCGCCTCCCAGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166857970 19:45792627-45792649 TGCGAGCGGCGCCGTCGCCCGGG + Exonic
1167612050 19:50512413-50512435 AGCCAGGGCAGCCGCCGCCATGG + Exonic
1168064056 19:53909423-53909445 GGCCGCCGCCGCCGCCACCGGGG - Exonic
1168154580 19:54465566-54465588 GGTCAGCGCGGCCCCAGCCCGGG + Intronic
1168315152 19:55481868-55481890 GCACGGCGCCGCCCCCGCCCCGG + Exonic
1168339113 19:55613773-55613795 GGGCAGGGCCGCCACCGCCTTGG - Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
926101711 2:10122436-10122458 GGTCGGGGGCGCCGCCGCCCAGG - Exonic
926422931 2:12716832-12716854 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
926724221 2:15984727-15984749 GGCCAGGGCAGCAGCCGGCCGGG - Intergenic
927596574 2:24402959-24402981 GGCCAGGGCCGCCAGCGCCGGGG + Intergenic
927809370 2:26173115-26173137 GGCGAGCGCCGCGGCGGCCCCGG + Exonic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
927904525 2:26847659-26847681 GGGCAGCGCGGCCGCAGCCCGGG + Intergenic
927904618 2:26847943-26847965 GCCGCGCGCCGCCGCCGCCTGGG - Intronic
927935022 2:27071550-27071572 GGCCAGCCCCGCCGTGGCCGTGG - Intronic
929857762 2:45650871-45650893 GCCCAGCGCCGCCGCACCCCGGG + Intergenic
929983223 2:46699578-46699600 GGCCGGCGCTGCCTCCGCCGCGG - Intronic
930529320 2:52571468-52571490 GGCCGGCGCCGCTGATGCCCAGG - Intergenic
930700834 2:54456689-54456711 TCCCCGCGCCGCCCCCGCCCGGG - Intronic
931052305 2:58428487-58428509 GGCGCGCGCGGCGGCCGCCCCGG - Intergenic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
932621866 2:73269444-73269466 GGCCGCCGCCGCCGCTGCCTCGG - Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933667053 2:84971838-84971860 GCCTAGCGCTCCCGCCGCCCCGG + Intronic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935653184 2:105399194-105399216 GGCCGGGACCGCCGCAGCCCGGG - Intronic
935692680 2:105745071-105745093 GCGCAGCGCGGCCACCGCCCCGG + Exonic
937237986 2:120442153-120442175 TGGCAGCGCCGCGGCCTCCCTGG - Intergenic
937815983 2:126251280-126251302 GGCCAGTGCTGCTGCAGCCCTGG - Intergenic
938152866 2:128901946-128901968 CGCCAGCGCCACCCCCACCCTGG + Intergenic
938277343 2:130038037-130038059 GGCCGCCGCCGCCACAGCCCTGG + Intergenic
938438041 2:131299343-131299365 GGCCGCCGCCGCCACAGCCCTGG - Intronic
939629633 2:144516842-144516864 TGCCACCCCCGCCCCCGCCCCGG + Intronic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
940775180 2:157876642-157876664 GGCCTGCCCCGCCGCCTCCGAGG - Intergenic
941020853 2:160407274-160407296 TGCCCTCGCCGCCGCCGCCCGGG - Intronic
941951496 2:171160835-171160857 GCCCGCCGCCGCCGCCTCCCGGG - Intronic
942046552 2:172102430-172102452 GGCCGGCGCCGCCGCCGCTCGGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942278193 2:174337443-174337465 CGCCGCCGCTGCCGCCGCCCGGG - Exonic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942560357 2:177212842-177212864 GGCCGTCGCCGTCGCCGCCGGGG + Exonic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
943046416 2:182866733-182866755 AGCCACCGCCCCTGCCGCCCAGG + Exonic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
943580122 2:189674588-189674610 GGCCAACACTGCCGCCGCCCGGG - Intronic
944183896 2:196926804-196926826 GGCCAGAGGCGCCGCGGACCTGG - Intronic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
945905284 2:215586177-215586199 AGCCAGCGCCTCCTTCGCCCTGG + Intergenic
946191646 2:218010687-218010709 TGCTGCCGCCGCCGCCGCCCCGG - Intergenic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946378962 2:219331775-219331797 GCCCAGCGCCGCCGCCACGCTGG - Intronic
946865594 2:224039052-224039074 GGGCAGCGCCGGCCGCGCCCGGG + Intronic
947506747 2:230713330-230713352 GGCCGGGGCCGCCGCCACCCAGG - Intronic
947518747 2:230828503-230828525 GCCCAGCGCCGCGGCGGGCCCGG + Intergenic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
947566671 2:231198611-231198633 GGCAACCGCCGCCGCCACCCCGG - Exonic
947605434 2:231482913-231482935 TGGCAGCGCCGCGGCAGCCCGGG + Intronic
947919017 2:233853966-233853988 GGCTGGCGCCGCCTCCTCCCGGG - Intronic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948478194 2:238234653-238234675 GTTCAGCACCGCCGCCCCCCGGG - Intergenic
948805710 2:240452815-240452837 GGGCAGCGCCGCAGCCGCACTGG - Intronic
948831094 2:240598608-240598630 GGCGAGTGCCACCGCTGCCCGGG + Intronic
1168760818 20:348191-348213 GGCCAGCGCGGTACCCGCCCCGG - Intronic
1169065833 20:2693609-2693631 AGTGAGCGCCCCCGCCGCCCCGG - Intronic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1169278558 20:4249133-4249155 GGGGAGCCCGGCCGCCGCCCGGG - Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1172201739 20:33131836-33131858 GGCCAGCGCCTCCACCTCCAGGG - Intergenic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1173576639 20:44116291-44116313 GGCCCGCTGCGCCGGCGCCCCGG + Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1174317413 20:49713534-49713556 GGCCAGAGCGGCAGCCGCCGCGG + Intronic
1174317463 20:49713761-49713783 GGCCGCCGCCGCCACCGCCTGGG + Exonic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1175992248 20:62795454-62795476 GGCAAGCGCCGCCCCCAACCCGG - Intergenic
1176014936 20:62926221-62926243 GGTCAGAGCCGCCGCGGCCTGGG - Intronic
1176105662 20:63384665-63384687 GGCCTGGGCCGCGTCCGCCCAGG - Intergenic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176270208 20:64232332-64232354 GGCCAGAGCCGTCACAGCCCGGG - Exonic
1177011025 21:15730257-15730279 GGACAGCGCCCCCGCCAGCCAGG - Exonic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177580250 21:23013064-23013086 TGCAAGCTCCGCCGCCTCCCGGG + Intergenic
1177834083 21:26170693-26170715 CGCCACCGCCGCCGTCTCCCGGG + Intronic
1178485858 21:33019950-33019972 GGCCAGCGCCGCAAACTCCCAGG - Intergenic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179908701 21:44436986-44437008 GGCCAGCCCCGCCGCGGCGCAGG + Intronic
1179912462 21:44457373-44457395 GCCCAGCGCCCCCGCCTCCAAGG + Exonic
1179999098 21:44987088-44987110 GGTCAGCACGGCCACCGCCCCGG - Intergenic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180159711 21:45993599-45993621 GGCCAGAGTCGCCGCCACCGAGG + Intronic
1180559227 22:16601981-16602003 GGCCGCCGCCGCCGCTGCTCGGG - Intergenic
1180769465 22:18370528-18370550 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1180776864 22:18492149-18492171 CGCCAGCGAGGACGCCGCCCAGG + Intergenic
1180809594 22:18749515-18749537 CGCCAGCGAGGACGCCGCCCAGG + Intergenic
1180827396 22:18873426-18873448 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1180827403 22:18873453-18873475 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1180876649 22:19178070-19178092 GGCCCTCGGTGCCGCCGCCCTGG + Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181084196 22:20431771-20431793 GGCGAGTGCCGCTGCCGCCACGG - Exonic
1181085151 22:20436469-20436491 GGCCAGGCCGGCCCCCGCCCCGG + Intronic
1181195585 22:21183461-21183483 CGCCAGCGAGGACGCCGCCCAGG + Intergenic
1181195592 22:21183488-21183510 CGCCAGCGAGGACGCCGCCCAGG + Intergenic
1181195683 22:21183866-21183888 CGCCAGCGAGGACGCCGCCCAGG + Intergenic
1181213856 22:21309285-21309307 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182236912 22:28883501-28883523 GGCCTCCGCAGCCGCCGCCGTGG - Intergenic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1182296829 22:29315054-29315076 GGCCAGCGACGTCGCCGTCGCGG + Exonic
1182692859 22:32175973-32175995 CGCCAGCGCCTCCCCCTCCCCGG - Intergenic
1183095794 22:35551611-35551633 GGGCAGCTCCGCCGCCTCCTTGG - Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183417564 22:37691289-37691311 GCCCAGCGCCGCCGTCTCACAGG + Exonic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183517104 22:38272948-38272970 GGCGGGCGGCGCCGCAGCCCCGG + Exonic
1183578252 22:38706153-38706175 AGCGCCCGCCGCCGCCGCCCGGG - Intronic
1183658989 22:39207344-39207366 GGCCAGCTCCGCCTTCACCCAGG + Intergenic
1184086834 22:42270466-42270488 GGCCCGCCCCGCCGCCGGCCCGG - Intronic
1184660383 22:45962951-45962973 GGCCAGCGCCTCGGCCTTCCTGG + Intronic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1184796874 22:46737985-46738007 GGTGAGTGTCGCCGCCGCCCGGG - Exonic
1185055204 22:48575680-48575702 AGCCCGCGCCTCCGCCGCCGCGG - Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185384506 22:50525697-50525719 GGCCCCCGCCTCCGCAGCCCTGG + Intronic
1185384695 22:50526400-50526422 GTCCAGCGCCGCGGCCACCCGGG + Exonic
1203231126 22_KI270731v1_random:111002-111024 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1203231183 22_KI270731v1_random:111218-111240 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1203231190 22_KI270731v1_random:111245-111267 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1203231197 22_KI270731v1_random:111272-111294 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1203231289 22_KI270731v1_random:111650-111672 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203277442 22_KI270734v1_random:99254-99276 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
1203277496 22_KI270734v1_random:99470-99492 CGCCAGCGAGGTCGCCGCCCAGG - Intergenic
1203277503 22_KI270734v1_random:99497-99519 CGCCAGCGAGGACGCCGCCCAGG - Intergenic
950000032 3:9649598-9649620 GGCCGCCGCCGCCGCTGCCTCGG + Exonic
950583488 3:13878166-13878188 CGCCGGCGCCGCGGCCTCCCCGG - Intronic
950670270 3:14521705-14521727 GGCCAGCCATGCCACCGCCCTGG - Exonic
951717527 3:25664849-25664871 AGCCGCCGCCGCCGCCGCCACGG + Intronic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952760012 3:36905210-36905232 TGCAAGCTCCGCCGCCTCCCGGG - Intronic
952816629 3:37452588-37452610 GGCCCGCGCGGCCACCGCCCCGG + Intronic
953921890 3:46957660-46957682 GGCATGAGCCACCGCCGCCCTGG - Intronic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
953982167 3:47418397-47418419 TCCCCGCGCCTCCGCCGCCCGGG + Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
957028634 3:75214592-75214614 GGCCGTCGCCGTCGCCGCCGGGG + Intergenic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
960702480 3:120451313-120451335 GGCCACCGCCGCAGCCCGCCCGG - Intergenic
961674404 3:128555844-128555866 GCCCAGCGCCGCAGCCGCTGCGG - Intergenic
961735858 3:129001823-129001845 GGCCGGCGCCGCGGCAGTCCAGG - Exonic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
962108456 3:132417475-132417497 CGCCTGCGTCGCCACCGCCCAGG - Intergenic
962318795 3:134374632-134374654 GGCCAGCAGCGCCGCCTCCCCGG - Intronic
963091451 3:141487082-141487104 AGCAGGCGCCGCCGCCGCCATGG - Exonic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963253367 3:143121130-143121152 GCCCAGGGCCGCCTCCGGCCGGG + Exonic
964801632 3:160565019-160565041 GGCCTGCTCCGCCTCCGCCGGGG - Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966869765 3:184282663-184282685 GGCCAGGGCCGCCATGGCCCTGG + Intronic
967055619 3:185826086-185826108 GGCTTTCGCCGCCGCCGCCCGGG - Intergenic
968093039 3:195909765-195909787 CGCCTGCGCCTGCGCCGCCCCGG + Intronic
968382389 4:107740-107762 TTCCCGAGCCGCCGCCGCCCGGG - Intergenic
968479274 4:826398-826420 GTCCACCCCCGCCCCCGCCCCGG - Intergenic
968479317 4:826465-826487 GTCCACCCCCGCCCCCGCCCCGG - Intergenic
968483799 4:849124-849146 GCCCAGAGCCGCTGCAGCCCCGG + Intergenic
968514883 4:1011795-1011817 GGCCCGAGCCGCCCGCGCCCAGG + Intronic
968541862 4:1172041-1172063 CCCCAGCCCGGCCGCCGCCCTGG - Exonic
968651930 4:1763585-1763607 GGCCAGCGCCACCGCAGGGCGGG + Intergenic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968697646 4:2040885-2040907 GGTCAGAGCCGCCCCTGCCCCGG - Intronic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
969113956 4:4859995-4860017 CCCCAGCGCCGCCGCGGCCACGG + Exonic
969873082 4:10116606-10116628 GGGCAGCGCGGCGGCCGCTCGGG + Intronic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970333086 4:15003951-15003973 AGCCGCCGCTGCCGCCGCCCGGG - Exonic
970394714 4:15654888-15654910 GGCCGGCCCCACCGCCGCGCTGG - Intronic
970456240 4:16226632-16226654 TGCCGCCGCCGCCGCCGCCACGG + Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
974047152 4:56907963-56907985 AGCGAGCGCCGCCGAGGCCCGGG + Exonic
974549287 4:63349845-63349867 GGCCAGTGCCGCCGCTGCTGCGG + Intergenic
975883607 4:78939397-78939419 CGCCAGCGCCGCGGCGGACCCGG + Exonic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
980541439 4:134201523-134201545 TGCAGGCGCCGCCGCCGCCGAGG + Intronic
980628843 4:135408392-135408414 GGGCAAAGCCGCCGCCGCCACGG + Intergenic
981057017 4:140373729-140373751 GGCCAGGCCCTCCGCTGCCCGGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981315587 4:143336956-143336978 GGCCGGCGCGCCCGCGGCCCCGG + Exonic
982745879 4:159103651-159103673 GGCTTGCGCAGCCGCCGCCCAGG - Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
983940128 4:173529064-173529086 TGCCAGCGGCGCCGCCGGCCTGG - Exonic
984167588 4:176320556-176320578 AGCCGGCGCCGCCGCCCGCCTGG + Intronic
984823625 4:183905820-183905842 GAGCAGCGCTGCCGCCGCGCGGG + Exonic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
987374011 5:17217831-17217853 GCCCCGCGCCGCCGCGGACCCGG + Intronic
989584813 5:43066507-43066529 GCCCAGCGCCGGCGTCGCCCGGG + Intronic
989591961 5:43120910-43120932 TGCCGGGGCCGCGGCCGCCCGGG + Intronic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
992515870 5:77492054-77492076 AGCCAGCCCCGCCTCCGCCCGGG + Intronic
992663731 5:78985395-78985417 GGCCCCCGCCGCCTCCGACCCGG + Exonic
993716556 5:91280651-91280673 GGCCTGGGCGGCCGCAGCCCGGG + Intergenic
994107323 5:95961738-95961760 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
995206588 5:109487803-109487825 GGGCAGCTCCGCCTGCGCCCTGG - Intergenic
996802875 5:127422742-127422764 GGCCATTGCCGCTGCCTCCCCGG + Exonic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997714027 5:136028969-136028991 TGAGAGCGCCTCCGCCGCCCGGG - Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
1001398473 5:171433112-171433134 GGCCACCCCCGCCACCTCCCTGG + Intronic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002889038 6:1317657-1317679 GCACAGCGGCGCCGCCGTCCCGG + Intergenic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003124573 6:3346202-3346224 GGCCAGCGCCACCTCTGCTCGGG + Intronic
1003279181 6:4677174-4677196 GGCCAGCGCCCCCACCTTCCAGG - Intergenic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004241329 6:13925002-13925024 GCCCTGGGCCGCCGCCGGCCAGG + Exonic
1004627975 6:17394092-17394114 CCCCAGCGCCGCCGCCCGCCCGG + Intronic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1004924052 6:20402373-20402395 CGCCGCCGCTGCCGCCGCCCCGG + Exonic
1005653128 6:27903258-27903280 GGCCAGCACCTCCGCCCCGCGGG + Intergenic
1005987657 6:30884497-30884519 GGCCCGAGCCGCCCCAGCCCTGG + Intronic
1006470161 6:34224099-34224121 GGCCGGCGCCGCGCCAGCCCGGG - Intergenic
1008092840 6:47309705-47309727 GCCCAGCGGCGCGGCCGCCCAGG + Exonic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1011100010 6:83709439-83709461 GGCCAACGCCCCCAACGCCCAGG - Intronic
1011607373 6:89118093-89118115 GGGCGGCGCCGGCGCGGCCCAGG + Intergenic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1013793674 6:113860399-113860421 GGCCAGCGCCGCCGCCTGCGAGG + Exonic
1013836548 6:114342201-114342223 CGCCCGCGCCGCCACCGCCGGGG - Exonic
1015220629 6:130801467-130801489 CGCCACCGCCGCCGCCACCCCGG - Intergenic
1015625870 6:135180995-135181017 GGTCGGCGCCGCCGCGACCCGGG + Intergenic
1016863960 6:148747768-148747790 ACCGCGCGCCGCCGCCGCCCCGG + Intronic
1017021448 6:150143231-150143253 GGCCAGCGGCGGCGGCGCACGGG + Exonic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017665908 6:156720060-156720082 GGCCCGCCCCGCCCCCGTCCTGG - Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017672416 6:156779293-156779315 CGCCCCCGCCGCCGCCGCCTGGG - Exonic
1018613270 6:165662820-165662842 GGCCTGCCCCTCCGCGGCCCGGG - Intronic
1018856561 6:167679087-167679109 AGCCAGCGCAGCCCCCGGCCAGG - Intergenic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019308237 7:346586-346608 AACCACCACCGCCGCCGCCCGGG + Intergenic
1019308257 7:346654-346676 AACCACCACCGCCGCCGCCCGGG + Intergenic
1019308276 7:346721-346743 AACCACCACCGCCGCCGCCCGGG + Intergenic
1019343058 7:517554-517576 CGCCAGGAGCGCCGCCGCCCCGG + Intronic
1019389307 7:776770-776792 GGACAGGGCCCCCGCCACCCAGG + Intronic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019743772 7:2688417-2688439 GCCCGTAGCCGCCGCCGCCCGGG - Intronic
1020020194 7:4861853-4861875 GACCTTCGCGGCCGCCGCCCGGG + Exonic
1020035068 7:4959441-4959463 GGCCAGGGCCGCCCCAGGCCTGG - Intergenic
1020274367 7:6615690-6615712 CGCCCGCCCCGCCCCCGCCCCGG + Exonic
1021015506 7:15526182-15526204 GGCCAGCAACGCCCCTGCCCAGG - Intronic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1022100248 7:27165146-27165168 GTCCGGCGCCGCCGCCGCCACGG + Exonic
1022100291 7:27165320-27165342 GGCCAGCGTCGCCGCCTGCCGGG + Exonic
1022446981 7:30478749-30478771 GGCCCGCGAGGCAGCCGCCCCGG - Exonic
1023881115 7:44322031-44322053 GGCCAGCACCGTCACGGCCCGGG - Intronic
1023955596 7:44884718-44884740 GGCCCCCGGCGCCGCCTCCCGGG + Exonic
1024163491 7:46705306-46705328 GGCCATCACCGCAGCAGCCCTGG - Intronic
1024579951 7:50793346-50793368 CGCCGGCGCTGCCGCCACCCAGG + Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025089694 7:56051889-56051911 CGCCAGCGCCGCCTGCGCTCGGG - Exonic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1025901857 7:65751182-65751204 CGCCAGCGCCGCCTGCGCTCCGG - Intergenic
1026968374 7:74454131-74454153 TGCCAGCGGCGCCCCGGCCCCGG - Exonic
1027151819 7:75738839-75738861 GCCCAGCGCCGACCCCGCGCCGG + Exonic
1027421154 7:78019488-78019510 CGCCGCTGCCGCCGCCGCCCGGG + Exonic
1027672457 7:81118826-81118848 GGCCAGCAACGCCCCCACCCAGG + Intergenic
1027795700 7:82691102-82691124 GGCCGGCGACGCCCCCGCCTGGG + Intergenic
1028871136 7:95772700-95772722 CACCAACGCTGCCGCCGCCCAGG + Exonic
1029110981 7:98212888-98212910 GGCCACCGCCACCCCCACCCAGG - Exonic
1029640258 7:101815903-101815925 GGCCGCCGCCGCCGCCACCGAGG - Intronic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1033159054 7:138981142-138981164 TGCGCCCGCCGCCGCCGCCCGGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034269626 7:149797315-149797337 GGCCAGTGCAGCAGCTGCCCCGG - Intergenic
1034342664 7:150368501-150368523 GGCCAGCCACGCGGTCGCCCGGG + Intronic
1034349124 7:150405165-150405187 TGCCAGCGCTGCGCCCGCCCGGG - Intronic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035289082 7:157825761-157825783 GGCCAGCGCTGCTGCTCCCCCGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035569801 8:665129-665151 GGCCGGCGCTGCCACTGCCCTGG - Intronic
1035719431 8:1780585-1780607 TGCCAGCTCTGCTGCCGCCCCGG - Exonic
1036032710 8:4991675-4991697 GCCCAGCGCCGACGCCCCCGGGG + Intronic
1036664680 8:10730720-10730742 GGCCCGCCCCTCCGCCGCCAGGG + Intronic
1036789498 8:11708666-11708688 GGCCGCCGCCGCCGCTGCCGCGG + Exonic
1037788953 8:21919890-21919912 GGCCCGCGCCGCCGCCACTCGGG + Intronic
1037910626 8:22741737-22741759 AGCCAGCGCCACCGTCCCCCCGG + Intronic
1038267581 8:26048225-26048247 GGCAAGCGCAGCTGCGGCCCCGG + Intergenic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1039493589 8:37965338-37965360 GCCCTGCGCCGCCGCCCGCCCGG - Exonic
1039608585 8:38901698-38901720 GGCCAAGGTCGCCGCCGCCAGGG + Intronic
1039887245 8:41661887-41661909 GTCCAGCGCCGATGCCGCCCAGG - Exonic
1039907630 8:41798189-41798211 GGCCGGCCCCTCCGCCCCCCGGG + Intronic
1040055950 8:43056716-43056738 GTCTCGCGCCGGCGCCGCCCTGG - Intronic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041167369 8:55102743-55102765 AGCCCGCCCCGCCGCCGCCCGGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041690085 8:60679355-60679377 CGCCCCCGCCGCCGCCGGCCCGG - Intronic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1043527353 8:81111655-81111677 GGCGCGCAGCGCCGCCGCCCCGG + Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048886485 8:138913984-138914006 GGCCAGCCCCGCCACTGCCCAGG + Exonic
1049044951 8:140142420-140142442 GGCCGGCACCGCAGCAGCCCCGG + Intronic
1049109421 8:140634411-140634433 GGCCTGCGCCGCCTGCGGCCCGG + Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049218297 8:141417685-141417707 GGCCGGGGGCGCTGCCGCCCGGG - Intronic
1049343041 8:142124002-142124024 GGCCAGGGCCCCAGCCACCCTGG + Intergenic
1049411910 8:142477328-142477350 GGCCACCGCCCCCGCTGCCCTGG - Intronic
1049585086 8:143429309-143429331 AGCCCGCGCCGCCGTCGCCGGGG - Exonic
1049643851 8:143727507-143727529 GGCCGTTGCCGCCGCTGCCCGGG + Exonic
1049656996 8:143803385-143803407 GGCCAGCACCGACGCAGCCCTGG - Exonic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1049989395 9:977282-977304 TGCCAGGGCCCCCGCCGCCGGGG + Exonic
1051171496 9:14322462-14322484 GGGCAGCCCCGCCGCGGGCCAGG - Intronic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1053163529 9:35829422-35829444 GTCCGGCCCCGCCCCCGCCCCGG + Intronic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054781992 9:69174194-69174216 GGCTGACGCCGCCGCCGCCGCGG + Intronic
1054798638 9:69325424-69325446 GGCCAGCGCGGCCGCAGCGGGGG - Intronic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1055514227 9:77020407-77020429 GGCCGCCGCCGCTGCCGCCGCGG + Exonic
1056386264 9:86099538-86099560 GTCCAGCGCCGCCGCGTCTCCGG + Exonic
1057245507 9:93451602-93451624 GCCCGGCGCGGACGCCGCCCAGG - Intronic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057436877 9:95048623-95048645 AGTCCGCGCTGCCGCCGCCCAGG + Intronic
1057483189 9:95461802-95461824 GGGCAGCGGCCCCGCAGCCCTGG + Intronic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057573144 9:96219166-96219188 GGGCAGCGCGGCCGCAGCGCGGG - Intergenic
1057623268 9:96655230-96655252 GGTTAGCGGCGCCGCCGCCCTGG - Exonic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1057934022 9:99221804-99221826 GCTCAGCGCCGCCCACGCCCAGG + Exonic
1059102396 9:111483513-111483535 GGCCGCCGCCTCCGCCTCCCAGG - Intronic
1059375254 9:113876228-113876250 CCCCAGCGCCCCCGCCCCCCCGG + Intergenic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1060139943 9:121201431-121201453 GGACACCTCCGCCCCCGCCCAGG + Intronic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1060832088 9:126723110-126723132 GGCCAGCTCGGCCCCCGCCTGGG - Intergenic
1061014728 9:127975105-127975127 GGCCAGAGCCTCCACCCCCCTGG - Intronic
1061028597 9:128066606-128066628 GGCCACCGCAGCCGCAGCCACGG - Exonic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061975830 9:134067724-134067746 CGCCACCGCCGCCGCGACCCCGG + Intronic
1061975941 9:134068098-134068120 GGCCCGCGCCGGGGCCGCCCAGG + Intronic
1062285185 9:135769685-135769707 GGCCAGGGCCTGCCCCGCCCTGG + Intronic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062396779 9:136355812-136355834 GGCCACGGCCGCCCCCACCCTGG + Exonic
1062554329 9:137107148-137107170 GCCCAGCGCTGCCTCGGCCCTGG - Intronic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185641539 X:1591724-1591746 GGCCAGCGGCGGCGGCGGCCTGG + Exonic
1186452926 X:9688135-9688157 AGCCGCCGCCGCCGCCGCACTGG - Exonic
1187172914 X:16869741-16869763 GGCGGGGGCCGCCTCCGCCCCGG + Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187281308 X:17860515-17860537 GGCCAGCCCCGCATCCCCCCCGG - Intronic
1187367303 X:18675648-18675670 GGCCAGGGCCGCTGCCACCCTGG - Intergenic
1189335732 X:40169819-40169841 GTGCAGCGCCGTCCCCGCCCTGG - Intronic
1189821629 X:44874028-44874050 GGCCGGCGCCGCGCTCGCCCCGG + Intronic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1192584157 X:72306757-72306779 GGCCGCCACCGCCACCGCCCCGG - Intronic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195200836 X:102548369-102548391 GTCCAGCGTCGCCGCATCCCCGG - Intergenic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196918254 X:120561151-120561173 GGGAAGCGCTGCAGCCGCCCGGG + Intronic
1198263846 X:134991142-134991164 AGACAGGGCCGCCGCCGCCATGG - Exonic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1198807225 X:140504334-140504356 GGCCGCCGCCGCCGCTGCCGCGG - Exonic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic