ID: 1085296359

View in Genome Browser
Species Human (GRCh38)
Location 11:75433932-75433954
Sequence GGGTGTGACCTGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085296359_1085296366 -2 Left 1085296359 11:75433932-75433954 CCCTTTTCCCTCAGGTCACACCC No data
Right 1085296366 11:75433953-75433975 CCATGACCAGGCAGACTCTCAGG No data
1085296359_1085296369 8 Left 1085296359 11:75433932-75433954 CCCTTTTCCCTCAGGTCACACCC No data
Right 1085296369 11:75433963-75433985 GCAGACTCTCAGGACAAAGAGGG No data
1085296359_1085296370 9 Left 1085296359 11:75433932-75433954 CCCTTTTCCCTCAGGTCACACCC No data
Right 1085296370 11:75433964-75433986 CAGACTCTCAGGACAAAGAGGGG No data
1085296359_1085296371 18 Left 1085296359 11:75433932-75433954 CCCTTTTCCCTCAGGTCACACCC No data
Right 1085296371 11:75433973-75433995 AGGACAAAGAGGGGAGTTACAGG No data
1085296359_1085296368 7 Left 1085296359 11:75433932-75433954 CCCTTTTCCCTCAGGTCACACCC No data
Right 1085296368 11:75433962-75433984 GGCAGACTCTCAGGACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085296359 Original CRISPR GGGTGTGACCTGAGGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr