ID: 1085296951

View in Genome Browser
Species Human (GRCh38)
Location 11:75436688-75436710
Sequence GCACTGACACCAAGCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085296946_1085296951 -10 Left 1085296946 11:75436675-75436697 CCCACCAACCATGGCACTGACAC 0: 1
1: 1
2: 0
3: 7
4: 127
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296937_1085296951 6 Left 1085296937 11:75436659-75436681 CCCTACCCCACCCCTGCCCACCA 0: 1
1: 0
2: 15
3: 262
4: 1857
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296945_1085296951 -6 Left 1085296945 11:75436671-75436693 CCTGCCCACCAACCATGGCACTG 0: 1
1: 0
2: 1
3: 20
4: 179
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296943_1085296951 -4 Left 1085296943 11:75436669-75436691 CCCCTGCCCACCAACCATGGCAC 0: 1
1: 0
2: 0
3: 27
4: 659
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296935_1085296951 26 Left 1085296935 11:75436639-75436661 CCTTCAAAACAGACTCCTCTCCC 0: 1
1: 0
2: 0
3: 34
4: 268
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296938_1085296951 5 Left 1085296938 11:75436660-75436682 CCTACCCCACCCCTGCCCACCAA 0: 1
1: 2
2: 23
3: 251
4: 1892
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296936_1085296951 11 Left 1085296936 11:75436654-75436676 CCTCTCCCTACCCCACCCCTGCC 0: 1
1: 2
2: 71
3: 814
4: 6261
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296941_1085296951 -1 Left 1085296941 11:75436666-75436688 CCACCCCTGCCCACCAACCATGG 0: 1
1: 0
2: 2
3: 81
4: 554
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296939_1085296951 1 Left 1085296939 11:75436664-75436686 CCCCACCCCTGCCCACCAACCAT 0: 1
1: 0
2: 5
3: 87
4: 885
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296944_1085296951 -5 Left 1085296944 11:75436670-75436692 CCCTGCCCACCAACCATGGCACT 0: 1
1: 0
2: 2
3: 17
4: 216
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1085296940_1085296951 0 Left 1085296940 11:75436665-75436687 CCCACCCCTGCCCACCAACCATG 0: 1
1: 0
2: 3
3: 64
4: 602
Right 1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085296951 Original CRISPR GCACTGACACCAAGCCATGG TGG Intronic
902188665 1:14744837-14744859 GCACTGACATCAAGCAAAAGAGG + Intronic
903485197 1:23684697-23684719 GCACTGACATGAAGCCACAGTGG + Intergenic
904300199 1:29549237-29549259 GCACTAACACCCAGCTAGGGAGG - Intergenic
904752291 1:32748562-32748584 ACACTGACACCAGGCCCTGAGGG - Intronic
905626989 1:39495707-39495729 GCACTGGGGCCAAGGCATGGCGG - Intronic
905669947 1:39785064-39785086 GCACTGGGGCCAAGGCATGGCGG + Intronic
906920346 1:50057716-50057738 GCACTTACACAAAGCCTAGGTGG - Intronic
911051985 1:93679406-93679428 GCAAAGACACCAAGCCAAGTAGG + Intronic
911623207 1:100091015-100091037 GAACTGACAGCCAGGCATGGTGG + Intronic
1063102368 10:2961952-2961974 GCACAGACAGCAAGACATGTGGG + Intergenic
1064011745 10:11741772-11741794 GCAGTGACCCTAAGCCCTGGGGG + Intergenic
1067903012 10:50262062-50262084 GCATTCACACCCAGCCATGCTGG - Intergenic
1069662279 10:70131746-70131768 GCACTGAGCCCCAGCCAGGGTGG - Intronic
1069910284 10:71754566-71754588 GCACTGTCACCTGGCCAGGGTGG + Intronic
1071518521 10:86314895-86314917 GGACTAACACAAAGCCTTGGTGG - Intronic
1072529222 10:96302983-96303005 GCACAGACGGCCAGCCATGGTGG + Intergenic
1075478997 10:122763345-122763367 GACCTGACACCAGGCCGTGGGGG + Intergenic
1075854673 10:125619261-125619283 GCACTGAAGGCAAGCAATGGCGG + Intronic
1076461412 10:130649914-130649936 GCCCTGGCACCAGGCCATGCTGG + Intergenic
1076864897 10:133161645-133161667 GCACCGAATCCAGGCCATGGTGG - Intronic
1083348670 11:62012058-62012080 GCACTAGCACAGAGCCATGGTGG + Intergenic
1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG + Intronic
1089132701 11:116224773-116224795 GCACTGACTCGATGCCATCGTGG - Intergenic
1094413465 12:30192279-30192301 GGACTGACCCAAAGCCATGGGGG + Intergenic
1104919945 12:132285493-132285515 GCACTGAGGCAAAGCCGTGGCGG + Intronic
1105918473 13:24939338-24939360 GCCCCAACACCATGCCATGGGGG - Intergenic
1112037091 13:95506859-95506881 GCACTCACACCGATGCATGGGGG + Intronic
1115470568 14:33764668-33764690 ACAGTGACACTAAGCCATGAGGG + Intronic
1117911114 14:60638687-60638709 GCATTGACACCCAGCCAAGAAGG - Intergenic
1119480247 14:74954288-74954310 GCTCTGGCACCCAGCCAAGGCGG - Intronic
1126096618 15:45094989-45095011 GCACAGACACCAGGTCCTGGTGG + Exonic
1126108778 15:45163612-45163634 GCACAGACACCAGGTCCTGGTGG - Exonic
1127774680 15:62255565-62255587 GCAGTTACAGCAGGCCATGGAGG - Intergenic
1128367414 15:67014095-67014117 GAGCTGACCCCAGGCCATGGTGG - Intergenic
1129690013 15:77707820-77707842 GCACAGGCACCAATCCAAGGTGG + Intronic
1130178030 15:81595306-81595328 GTAATGATATCAAGCCATGGAGG - Intergenic
1130375386 15:83324388-83324410 GCTCAGAAACCAGGCCATGGAGG + Intergenic
1131282938 15:91035219-91035241 GCAGTTACAGCAGGCCATGGAGG - Intergenic
1132328785 15:100995961-100995983 GCACTGACACACAGACATGAAGG - Intronic
1132574771 16:659331-659353 GCACAGACGCCCAGCCGTGGTGG - Exonic
1132604367 16:787633-787655 GCATTGACAGCAAGGCGTGGCGG - Exonic
1134063258 16:11211515-11211537 GCACTGACAGCAAGCCAGGTGGG - Intergenic
1139638331 16:68272974-68272996 ACTCTGGCACCAAGCCATGCAGG - Intronic
1141399396 16:83733839-83733861 CCACTTACGCCAAGGCATGGTGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1143278169 17:5730220-5730242 GCACAGCCACGAAGCCATGTTGG - Intergenic
1143495333 17:7309035-7309057 GCACTTGCAACAAGCCAAGGGGG - Intronic
1144944112 17:18961081-18961103 TCACTGACACCCATCCTTGGGGG + Intronic
1151197036 17:72439062-72439084 GCCCAGACACCAACCCAGGGTGG - Intergenic
1151315050 17:73316816-73316838 GTGCTGACATCAAGCCATGGTGG - Intergenic
1151480424 17:74367331-74367353 TCACTGACACCACACCATGTAGG + Intergenic
1152929423 17:83102260-83102282 GGACAGGCACCAGGCCATGGTGG - Intergenic
1155352840 18:24923926-24923948 GGATTGAAACAAAGCCATGGAGG - Intergenic
1157731743 18:50010036-50010058 GAACTGAAACCAAGCCATTCAGG + Intronic
1158505302 18:58042372-58042394 GCACTGACTCCCATCCATGAGGG + Intergenic
1158957244 18:62551831-62551853 GCCCTGACCCTAAGCCATAGAGG - Intronic
1159637733 18:70825859-70825881 ACACTGGCAGCAACCCATGGAGG - Intergenic
1161744235 19:6045342-6045364 GCACTGAGACCTGTCCATGGTGG + Intronic
1162551215 19:11359512-11359534 CGACTGCCACCAAGCCAGGGCGG - Intronic
1163660556 19:18574654-18574676 GCACTGACCACGAGCCCTGGGGG - Intronic
1164977047 19:32581246-32581268 GCGCTGACGCCGAGCCATGGCGG + Exonic
1166970608 19:46564783-46564805 ACACTGACACCAAACCAGAGGGG - Intronic
1168319543 19:55500799-55500821 GCACTGGTACCAGGGCATGGCGG + Exonic
925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG + Intronic
926764602 2:16313305-16313327 TTACTGACACCAGGCTATGGGGG + Intergenic
930779203 2:55206646-55206668 GCACTTACAGCAAGCCATAGAGG + Intronic
933308962 2:80637017-80637039 GCACTGAGACCAAGCCAAGATGG + Intronic
934046834 2:88179309-88179331 GCACTGCCAGCCAGCCATAGCGG - Intronic
934117577 2:88811609-88811631 GCACAGGCACCAGGCCAAGGGGG - Intergenic
934784515 2:96995319-96995341 CTACTGACACCAGGACATGGTGG + Intronic
936277692 2:111114674-111114696 GGACTAACACCATGCCATGCTGG + Intronic
936979015 2:118246870-118246892 CCACTGAGAGCAAGCCACGGTGG - Intergenic
944201045 2:197107778-197107800 GGACTGACACCAGGCCCTAGGGG + Intronic
944537497 2:200725502-200725524 CCCCTGACACCAAGCCCTGGCGG + Intergenic
947142669 2:227033862-227033884 GCAGTGACCCCAAGCCTGGGAGG - Intronic
947619345 2:231578726-231578748 CCACTCACACCAGGCAATGGTGG + Intergenic
1170473480 20:16691130-16691152 TCAGTGACACCCATCCATGGGGG + Intergenic
1172414575 20:34754207-34754229 CCACAGACACAAAGGCATGGAGG - Intronic
1172673845 20:36653531-36653553 GGACAGACACCAGACCATGGAGG - Exonic
1176041619 20:63068748-63068770 GCATTGACACCCAGCAGTGGGGG + Intergenic
1176166752 20:63678325-63678347 GCGGTGTCACCAAGCCAGGGAGG + Exonic
1178435572 21:32555054-32555076 GCACCCCCACCAACCCATGGAGG + Intergenic
1178468454 21:32870571-32870593 GCTCTGAGACCAGGCCCTGGGGG - Intergenic
1181339618 22:22167125-22167147 TCACTGACACCAGGGCAGGGAGG - Intergenic
1181589353 22:23874087-23874109 GGACAGACACCAACCCAAGGAGG - Intronic
1183584719 22:38746273-38746295 GCAGTGACTCTCAGCCATGGCGG - Intronic
1183685580 22:39359664-39359686 GGACTGACACCAAGCTAGGGTGG - Intronic
1185070441 22:48652956-48652978 GCACGGACCCCAAGCCATGAGGG - Intronic
950653527 3:14422611-14422633 GCAATGACAGGAAGCCAAGGTGG - Intronic
954424985 3:50438487-50438509 CCACTTACACGGAGCCATGGGGG - Intronic
955693499 3:61612972-61612994 GCACAGACAGCAAGGAATGGAGG - Intronic
962399348 3:135043875-135043897 GCACTGAGATCAGGCCATGTTGG + Intronic
965407947 3:168293808-168293830 GCAGTGTCCCTAAGCCATGGTGG + Intergenic
969516094 4:7648979-7649001 GCACTGGCACCAGGACATGAGGG + Intronic
969563943 4:7966751-7966773 TCCCTGACACCAAGCCACAGCGG + Exonic
973018725 4:45172815-45172837 GCACTTCCACCGAGCCAGGGAGG - Intergenic
977441733 4:97076321-97076343 GAACTGAGAACAAGCTATGGCGG - Intergenic
978111014 4:104964041-104964063 CTACTGCCACCAAGGCATGGGGG - Intergenic
979499872 4:121427665-121427687 TCACTCAGGCCAAGCCATGGTGG + Intergenic
981213492 4:142136194-142136216 GCACTGGCACCCAGGCATGTTGG + Intronic
990062275 5:51666786-51666808 GCAATGACAGCAAGACGTGGTGG - Intergenic
993057895 5:83003423-83003445 GGATGGACACCAATCCATGGAGG - Intergenic
993822475 5:92635961-92635983 TCACTTACAATAAGCCATGGAGG + Intergenic
993857043 5:93089198-93089220 GGACTGGCAGGAAGCCATGGTGG - Intergenic
994644761 5:102454242-102454264 TCACTGTTACCAAGACATGGAGG + Intronic
997858007 5:137390737-137390759 GCCCTGACACCATGCCTTGCTGG - Intronic
998207371 5:140167728-140167750 GCTCCAACACCTAGCCATGGAGG - Intergenic
999150242 5:149421784-149421806 GCACTGCCACCAATCAGTGGGGG - Intergenic
1001037893 5:168311071-168311093 GAACTGACACCAACCCAGGTAGG - Intronic
1003136487 6:3438496-3438518 ACACAGACACCAAGCGCTGGAGG - Intronic
1003694642 6:8391333-8391355 GTACTGACACCAAAGAATGGGGG + Intergenic
1004074597 6:12333488-12333510 GCACTGAGAGCCAGGCATGGTGG + Intergenic
1008068606 6:47076352-47076374 ACCCTGACCCCAAACCATGGAGG + Intergenic
1010644800 6:78373747-78373769 CCACTACCACCAACCCATGGAGG - Intergenic
1014292136 6:119571005-119571027 CCACTAACACCACACCATGGGGG - Intergenic
1014430531 6:121365337-121365359 GCAGTGACTGCATGCCATGGAGG + Intergenic
1014775952 6:125510282-125510304 GAACTGAGACAAAGCCATGTAGG + Intergenic
1014951193 6:127558153-127558175 GCACAGACGCCAAGACTTGGTGG + Intronic
1015921550 6:138270959-138270981 CCACAGACTCCAAGCCAGGGTGG + Intronic
1016986351 6:149898502-149898524 GCACAGAAACCAAGCAATAGAGG - Intergenic
1017617312 6:156259064-156259086 GCACCCCCACCAACCCATGGAGG + Intergenic
1017876546 6:158529519-158529541 GCACTGCCAGCAAACCATGGAGG - Intergenic
1018758606 6:166871267-166871289 GCAGTGACCACAACCCATGGGGG + Intronic
1021094846 7:16524533-16524555 GCAATGGCAGCAAGCCAGGGAGG + Intronic
1022440206 7:30426873-30426895 GCACTTACACTAAGCCATGAAGG - Intronic
1023758213 7:43439918-43439940 GCAACAACAGCAAGCCATGGAGG + Intronic
1024246238 7:47472391-47472413 ACACTGACACCTAGCCTTGCAGG - Intronic
1030084864 7:105807417-105807439 ACACTGACACAAACCCATGCAGG + Intronic
1033280716 7:140004676-140004698 GCACTGAGACCCAGCCAGGGAGG + Intronic
1034003556 7:147443244-147443266 CCGCTGACACCCACCCATGGAGG - Intronic
1035445033 7:158935266-158935288 GGGCTGACACCAGGCCCTGGAGG - Intronic
1037786346 8:21905669-21905691 GCACTGACACCATTCTCTGGAGG + Intergenic
1042799384 8:72702321-72702343 CCACTGAGACCAAGACATAGAGG + Intronic
1043982692 8:86659320-86659342 GCAGTTACAGCAGGCCATGGAGG - Intronic
1057118708 9:92550830-92550852 TCACTGACACCAAAACATGGTGG + Intronic
1057188598 9:93073103-93073125 GGACTGACACCCAGAGATGGGGG - Intronic
1057527797 9:95818114-95818136 GCATTGACACCATGACATAGTGG + Intergenic
1058226633 9:102372026-102372048 TCACTGACACCTGCCCATGGAGG - Intergenic
1060507224 9:124207262-124207284 GAACTGAAGCCAAGCCAGGGAGG - Intergenic
1061063311 9:128261700-128261722 GCAGTTACAGCAGGCCATGGAGG - Exonic
1062130753 9:134891843-134891865 CCACTGACACCAAGGCCAGGAGG - Intergenic
1062175575 9:135160313-135160335 GCTCTGCCTCCCAGCCATGGGGG - Intergenic
1192676092 X:73198689-73198711 CAGCTGACACCCAGCCATGGAGG + Intergenic
1192934037 X:75839563-75839585 GCAGTGAGTCCAACCCATGGAGG - Intergenic
1193404391 X:81083762-81083784 GCAATGAGTCCAACCCATGGAGG + Intergenic
1196656371 X:118221913-118221935 TCACTGACACAAAGCCATTTAGG - Intergenic
1197139016 X:123096124-123096146 CAACTGACACCCACCCATGGTGG + Intergenic
1197759719 X:130019513-130019535 GAACTGGCAGCAAGCCAAGGGGG + Intronic
1198611840 X:138410645-138410667 GCACTCACTGAAAGCCATGGGGG + Intergenic
1199553488 X:149081198-149081220 GCACAGAAGCCATGCCATGGAGG + Intergenic