ID: 1085301544

View in Genome Browser
Species Human (GRCh38)
Location 11:75461869-75461891
Sequence CTTATCTGTCAGTAGAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085301535_1085301544 17 Left 1085301535 11:75461829-75461851 CCAGCTGTCCCCAACTGGCTGTG 0: 1
1: 0
2: 5
3: 26
4: 285
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301531_1085301544 24 Left 1085301531 11:75461822-75461844 CCAAGCCCCAGCTGTCCCCAACT 0: 1
1: 2
2: 4
3: 40
4: 439
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301538_1085301544 8 Left 1085301538 11:75461838-75461860 CCCAACTGGCTGTGTGACCTGGG 0: 1
1: 9
2: 49
3: 213
4: 821
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301540_1085301544 7 Left 1085301540 11:75461839-75461861 CCAACTGGCTGTGTGACCTGGGC 0: 1
1: 5
2: 37
3: 223
4: 824
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301533_1085301544 19 Left 1085301533 11:75461827-75461849 CCCCAGCTGTCCCCAACTGGCTG 0: 1
1: 0
2: 2
3: 32
4: 337
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301536_1085301544 9 Left 1085301536 11:75461837-75461859 CCCCAACTGGCTGTGTGACCTGG 0: 2
1: 2
2: 24
3: 159
4: 718
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301541_1085301544 -9 Left 1085301541 11:75461855-75461877 CCTGGGCCTGTTTCCTTATCTGT 0: 3
1: 6
2: 28
3: 148
4: 687
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1085301534_1085301544 18 Left 1085301534 11:75461828-75461850 CCCAGCTGTCCCCAACTGGCTGT 0: 1
1: 1
2: 3
3: 13
4: 186
Right 1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085301544 Original CRISPR CTTATCTGTCAGTAGAACCC TGG Intronic
900488697 1:2935658-2935680 CTTATCTGTCTGTAGAGCCCAGG - Intergenic
905537133 1:38731036-38731058 CTAATCTGTTAGTAGAACACAGG - Intergenic
905663369 1:39745632-39745654 CTTATCTGTTACTAGATCCCAGG - Intronic
907147212 1:52246155-52246177 CTGATGTATCAGTAGAGCCCAGG - Intronic
908940360 1:69424997-69425019 CTTTTATGTCAGGAGAACCCTGG - Intergenic
909740587 1:79025003-79025025 CTGATGTGACAGTAGAAACCAGG - Intergenic
910241422 1:85090751-85090773 CTAAGCTGTTAGTAGGACCCTGG + Intronic
912915418 1:113810196-113810218 CATAACAGGCAGTAGAACCCAGG - Intronic
915746263 1:158161025-158161047 CTTAGTTGTCAGAAGAACACAGG + Intergenic
916497397 1:165357443-165357465 CTTATCCGTCTGTATAGCCCAGG + Intergenic
918426487 1:184415403-184415425 ATTATCTGTTAGTAAAACCCAGG - Intronic
920675665 1:208037089-208037111 CTTATCTGTAAGTACAATCCTGG + Intronic
921061296 1:211587109-211587131 CTTATCTCTCAGTTGCCCCCTGG + Intergenic
1062860705 10:807154-807176 CTGATCTGTCATTAGGACCCTGG - Exonic
1063577612 10:7275809-7275831 CTTAGGTGTCAGTAAAATCCAGG + Intronic
1063990884 10:11561615-11561637 CTTATCTGTCAGTAGAAGAAAGG - Intronic
1064781528 10:18844435-18844457 TTTATCTGTCTGTATAACCCTGG + Intergenic
1064882584 10:20072623-20072645 CTGATCTGTCAGTGGAAGGCAGG + Intronic
1068804513 10:61180072-61180094 CTGTTCTGTCTTTAGAACCCTGG - Intergenic
1072142866 10:92605400-92605422 CTAATCTGCCAGTAGATACCTGG - Intronic
1074643526 10:115417420-115417442 CTTATCTTTCAGTAGTACCCAGG + Intronic
1076013493 10:127009394-127009416 CTGATTTGTGGGTAGAACCCAGG + Intronic
1078280584 11:9897113-9897135 CTTATCTGTCAACAGACACCTGG - Intronic
1080070466 11:28077961-28077983 CTTCTGGGTCAGTAGAACACTGG + Intronic
1081948778 11:47023840-47023862 CTTATCTGTCATTAGACACTAGG + Intronic
1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG + Intronic
1086137969 11:83461804-83461826 CTGAACTCTCAGGAGAACCCAGG + Intronic
1086355394 11:85992786-85992808 CCTATCTGTCAGTAGAACAGCGG - Intronic
1086578458 11:88368321-88368343 CTTCTCTGTCAGCTAAACCCTGG + Intergenic
1092733857 12:11560518-11560540 ATTATCAGTCAGTAGGAACCGGG - Intergenic
1094506684 12:31067956-31067978 CTTATCTGTCAATAGACACTTGG + Intergenic
1103213830 12:119186648-119186670 CTAACCTGCCAGTAGAACCCTGG - Intronic
1104488027 12:129168640-129168662 CTTAAATGTCTGTAGAGCCCAGG - Intronic
1105606286 13:21929163-21929185 CTTATCTGGTTGTAGGACCCAGG + Intergenic
1106344871 13:28866262-28866284 CTTAAATGTCAGTTGAACCATGG + Intronic
1107417912 13:40218495-40218517 CTTCTGTGTCAGTACAACCTGGG + Intergenic
1110570832 13:77001258-77001280 CATATCTATCTGTAGGACCCTGG - Exonic
1111349462 13:87007320-87007342 CTGTTCTGTCAGAAGAACTCAGG + Intergenic
1111825425 13:93261734-93261756 CTTATCTGTTTGTCCAACCCTGG - Intronic
1112484198 13:99805156-99805178 CTTATCTGTCAATAGACACTTGG + Intronic
1116301082 14:43184495-43184517 CTTATCTACCAGGAGAGCCCTGG + Intergenic
1127191851 15:56539598-56539620 TTTTTCTGTGAGGAGAACCCAGG - Intergenic
1127634546 15:60856978-60857000 CTAATCTGTGCGTAGAACACTGG + Intronic
1128765854 15:70250736-70250758 CTTTCCTCTCAGTAGGACCCAGG + Intergenic
1130108926 15:80949235-80949257 CTTTGCTGTCAGCACAACCCAGG - Exonic
1135403836 16:22184227-22184249 CTTACCTGTCAGGTAAACCCAGG - Exonic
1137810936 16:51351829-51351851 CTTATGTGGCAGTAGTATCCAGG + Intergenic
1138303710 16:55955677-55955699 CTTGACTGCCAGGAGAACCCAGG - Intronic
1140748735 16:78004136-78004158 CTTGTCTGCCTGTAGAACACTGG + Intergenic
1144804931 17:17958735-17958757 CTTATCTCTCAGGAGATTCCAGG - Intronic
1145362177 17:22221472-22221494 CGTCTGTGTCAGCAGAACCCAGG - Intergenic
1147625089 17:41895029-41895051 CTCATGTCTCAGCAGAACCCGGG - Intronic
1149379053 17:56074443-56074465 CTTAGCTCCTAGTAGAACCCAGG - Intergenic
1153398100 18:4648429-4648451 TTTATCTGTCAGTGGACCCTTGG + Intergenic
1154222470 18:12468641-12468663 CTAATCAGTCAGAAGAACCTGGG + Intronic
1157534351 18:48447527-48447549 CTTATCTTTCAAAACAACCCTGG - Intergenic
1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG + Intronic
925189874 2:1874443-1874465 CTTATCTCTCAGCTGCACCCTGG + Intronic
926759988 2:16270134-16270156 CTTAGTTGTCAGTAGAACCTGGG - Intergenic
927511548 2:23647160-23647182 CTTTTCTGTCAGGAGGACTCAGG + Intronic
929983534 2:46702595-46702617 CTTCTCTGCCAGTGGAACCATGG + Intronic
930112290 2:47688853-47688875 CTTAATTGTCAGTAGAGGCCAGG - Intergenic
933330066 2:80882075-80882097 CCTAGCTCTCAGTAAAACCCTGG - Intergenic
935353408 2:102176059-102176081 CTTTTATCTCAGTACAACCCTGG + Intronic
935435679 2:103029554-103029576 CTTCTCAGTCATCAGAACCCCGG + Intergenic
939642915 2:144662463-144662485 ATTATCTGTATGTAAAACCCAGG + Intergenic
941028696 2:160487306-160487328 CTTCTCAGTCACTAAAACCCAGG + Intronic
944978971 2:205092136-205092158 CTTATCTTTTAGTATCACCCTGG - Intronic
945851305 2:215011175-215011197 CTGAGCTGTCATTTGAACCCAGG - Intronic
946477490 2:220022377-220022399 CTTATCTGGCACTAGGACCAGGG - Intergenic
947393020 2:229658938-229658960 CATTTCTTTCAGTAGAAACCTGG - Intronic
948273185 2:236689237-236689259 CATTTCTGTCAGGAGAACACAGG - Intergenic
1171044984 20:21801989-21802011 CTTATCTGTTAGAAGAATTCTGG - Intergenic
1178282822 21:31298127-31298149 CTTGACTGTCATGAGAACCCAGG + Intronic
1179484809 21:41703397-41703419 CTTATTTGTCAGTGGACACCTGG - Intergenic
958906239 3:99945177-99945199 TTTATCAGTCTGAAGAACCCAGG - Intronic
961154801 3:124670491-124670513 CATCTCTGTAAGTAGAAGCCTGG - Intronic
961778781 3:129309075-129309097 CTTATCTGTCAATGGACCCTTGG + Intergenic
962060993 3:131927321-131927343 CTAATCTTTCAGTGGATCCCAGG + Intronic
965731465 3:171776367-171776389 CTTACCTGTAAATAGAAGCCTGG - Intronic
966699330 3:182828922-182828944 CTCTTCTCTCAGTAGAACCTGGG + Intronic
967269686 3:187722747-187722769 CTTATCTGTCGGCAGAAGCCCGG - Intronic
969984021 4:11188426-11188448 CTTACCTTTCAGCACAACCCAGG - Intergenic
972618361 4:40722232-40722254 CTTATCTTTTGGTAGAACCATGG - Intergenic
973176148 4:47208080-47208102 CTTATCTGTCAATAGATACTTGG - Intronic
975471025 4:74768354-74768376 TTAATCTGTCAGTAGACCCTTGG - Intronic
994794472 5:104278116-104278138 CTTATTTGTCAATAAAACCACGG + Intergenic
995257122 5:110059608-110059630 CTAAAATGTCAGTAGTACCCAGG + Intergenic
995532986 5:113109263-113109285 TTCATCTGTCAGTATACCCCTGG - Intronic
997856266 5:137375638-137375660 CTTACCTAACAGTAGAATCCTGG - Intronic
997978441 5:138454043-138454065 CTTATGTATCAGGACAACCCGGG - Intergenic
998159699 5:139806427-139806449 CGTAGCTGTCTCTAGAACCCAGG - Intronic
1001216052 5:169856801-169856823 CTTTTCTGTCAGCATAACCAGGG + Intronic
1004965234 6:20841783-20841805 TTAATCTGGCAGTATAACCCAGG - Intronic
1006360819 6:33586054-33586076 CCTCTCTGCCAGTAGAGCCCCGG + Intergenic
1009430353 6:63559071-63559093 CTTATCAGTCAAAAGAACACTGG + Intronic
1018310874 6:162507028-162507050 CTTCACTTTCAGAAGAACCCAGG - Intronic
1018331353 6:162731012-162731034 CTTCTCTGTCACCATAACCCTGG - Intronic
1019945570 7:4326198-4326220 TTTATCTGTCAGTGGACACCTGG + Intergenic
1020544073 7:9501182-9501204 CATACCTGTCAGTAGAAACGAGG - Intergenic
1029454705 7:100663136-100663158 CTTGTCTGCCAGAAAAACCCAGG - Intergenic
1034853138 7:154514780-154514802 TTTATCTGTCAATAGAATCTTGG + Intronic
1035130898 7:156652034-156652056 CTTCTCTGTCAGTAGCTCCCTGG + Intronic
1037493611 8:19418705-19418727 CTTTTCAGTCAGTACAATCCTGG - Exonic
1041168005 8:55110432-55110454 CTGATCTGTGAATAGAACCCAGG + Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1041866255 8:62577358-62577380 CTTTTCTGTCAGTAGATGCATGG - Intronic
1044767010 8:95587191-95587213 CTTCCCTGTCAGGAGGACCCAGG - Intergenic
1045971741 8:108086093-108086115 CTTCTCTGTAAACAGAACCCAGG - Intergenic
1050581763 9:7065018-7065040 TTTATCTTTCACTAGAACACTGG - Intronic
1051683726 9:19635044-19635066 GTTATCTGTCAATAGAACAACGG + Intronic
1056332666 9:85534634-85534656 CTCACATGTCAGCAGAACCCAGG + Intergenic
1057946641 9:99335953-99335975 TTCATCTTTCAGTAGAATCCGGG + Intergenic
1059493366 9:114688551-114688573 CTTATCTGTGAGTAGCATGCGGG - Intergenic
1062076507 9:134592823-134592845 CTTTGCTTTCAGGAGAACCCCGG - Intergenic
1203759312 EBV:3774-3796 CTTCTCTGTCATTCGATCCCAGG - Intergenic
1189502527 X:41576571-41576593 CTTATCTGACAATAGATCACTGG + Intronic
1198546764 X:137700781-137700803 CAGAGCTGGCAGTAGAACCCAGG + Intergenic