ID: 1085302088

View in Genome Browser
Species Human (GRCh38)
Location 11:75464680-75464702
Sequence CAGGTTTAGGCTTGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 478}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085302078_1085302088 -1 Left 1085302078 11:75464658-75464680 CCCTGAGGCCCAGTATTTCTAGC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG 0: 1
1: 0
2: 6
3: 39
4: 478
1085302081_1085302088 -9 Left 1085302081 11:75464666-75464688 CCCAGTATTTCTAGCAGGTTTAG 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG 0: 1
1: 0
2: 6
3: 39
4: 478
1085302079_1085302088 -2 Left 1085302079 11:75464659-75464681 CCTGAGGCCCAGTATTTCTAGCA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG 0: 1
1: 0
2: 6
3: 39
4: 478
1085302082_1085302088 -10 Left 1085302082 11:75464667-75464689 CCAGTATTTCTAGCAGGTTTAGG 0: 1
1: 0
2: 4
3: 8
4: 181
Right 1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG 0: 1
1: 0
2: 6
3: 39
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085302088 Original CRISPR CAGGTTTAGGCTTGGGGAGG TGG Intronic
900105209 1:978167-978189 CAGGGTTAGGGTGGGGCAGGCGG - Intronic
900581895 1:3413513-3413535 CAGGGCTAGGCTTGGGGAGGGGG + Intronic
901468284 1:9437700-9437722 CAGGGTTGGGCTTGGAGGGGAGG - Intergenic
901500006 1:9646501-9646523 CAGTTTTAGGCTTCCAGAGGTGG + Intergenic
901501665 1:9656141-9656163 CAGGAGTAGGGTGGGGGAGGAGG + Intronic
902614400 1:17616006-17616028 CAGGCCGAGGCCTGGGGAGGCGG + Intronic
903466455 1:23555178-23555200 CAGGTTTAGCCTGGGGCATGGGG + Intergenic
904455289 1:30644116-30644138 CAGGGTTAGGCTCTGGCAGGTGG + Intergenic
904700375 1:32354439-32354461 CAGGTGTGGGGTTGGGGAGAGGG - Intronic
905202656 1:36324339-36324361 CAGGTTTAGCCTTGGGGTGGGGG - Intronic
905324898 1:37144971-37144993 GAGGTTTTGTCTTGGGGAGAAGG + Intergenic
905380338 1:37557267-37557289 CAGATTTAGGATGGGGAAGGAGG + Intronic
905438795 1:37979566-37979588 CAGGTTTAGGCCAGGTGTGGTGG + Intronic
905751701 1:40470546-40470568 AATGTTTAGGCTGGGTGAGGTGG - Intergenic
906316150 1:44787477-44787499 CAGGTGTAGGCTTGGGTTAGAGG + Intronic
907100151 1:51824938-51824960 CAGGTTTAGGCCAGGCGTGGTGG - Intronic
907310660 1:53537180-53537202 CAAGCTCTGGCTTGGGGAGGGGG + Intronic
908254724 1:62293858-62293880 CAGTTTCAATCTTGGGGAGGTGG - Intronic
908481782 1:64547652-64547674 CAGGCTTAGGCTGGGTGCGGTGG - Intronic
909922566 1:81400514-81400536 GAGGTTTGGGCCTGGGGAGTAGG + Intronic
910007476 1:82416336-82416358 CAGGTTTAGGCTGGGCGCGGTGG + Intergenic
910163052 1:84294426-84294448 CAGGCATGGGCATGGGGAGGTGG - Intergenic
910640573 1:89457106-89457128 CAGGTTTAGGATTGGCTAGCTGG + Intergenic
910870682 1:91830256-91830278 CAGGGTTATGCTTGGTGAAGAGG + Intronic
913089730 1:115468421-115468443 CAGCTTGAGGCTTGTGGAGGTGG - Intergenic
913133393 1:115863583-115863605 CAGGTAAAGGTTTGGGGATGTGG + Intergenic
914228665 1:145744324-145744346 CTGGTTTTGAATTGGGGAGGAGG - Exonic
914741644 1:150470936-150470958 CATTTCCAGGCTTGGGGAGGTGG - Exonic
914928564 1:151909556-151909578 CAGGGCGGGGCTTGGGGAGGAGG + Exonic
915107222 1:153542089-153542111 GAGGTTGTGGATTGGGGAGGGGG + Intergenic
915358757 1:155273126-155273148 CGGGGTTAGGCTTGGGTTGGGGG - Intronic
915490454 1:156247479-156247501 AAAGTTTTGGCCTGGGGAGGTGG - Intronic
916752020 1:167731723-167731745 CAGTTTTAGGCTGGGTGCGGTGG - Intronic
917217712 1:172695228-172695250 TAGGTATAGGGTTGGGCAGGGGG + Intergenic
917568276 1:176234609-176234631 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
917736610 1:177926887-177926909 AAGGTGGAGGCTTGGGAAGGAGG - Intronic
919753124 1:201050564-201050586 CAGGGTTAGGGTGGGGGAGCTGG + Intronic
919815269 1:201433509-201433531 CAGGCTTAGGCTGGGTGCGGTGG - Intergenic
919912457 1:202120043-202120065 CAGCTTTGGGCTGGGTGAGGTGG + Intergenic
920084254 1:203403518-203403540 GAGATTTAGGATTGGGCAGGAGG + Intergenic
920088379 1:203434489-203434511 CAGGTATAGGATTTGGGTGGTGG - Intergenic
920176885 1:204107639-204107661 CAGGCCTGTGCTTGGGGAGGGGG + Intronic
920179219 1:204122298-204122320 CATCTTCAGGCTTGGGGAGCTGG - Exonic
921212091 1:212909587-212909609 CAAGTTTAGACCTGGGGCGGTGG - Intergenic
921339993 1:214125118-214125140 CTGGTTTAGGCTAGGGGTGAGGG - Intergenic
921901936 1:220460629-220460651 AATGTTTAGGCATGAGGAGGTGG + Intergenic
921933851 1:220777952-220777974 GAGGTTTAGGCTGGGTGCGGTGG + Intronic
921944409 1:220877075-220877097 CAGGCTTGGGCCTGGGGAAGGGG + Intergenic
922153412 1:223023370-223023392 GAAGGTTAGGCTGGGGGAGGAGG - Intergenic
922473392 1:225890092-225890114 CAGGTCTAGGCTGGGGCAGGGGG + Intronic
922706198 1:227791653-227791675 CAGGGTTAGGGTTGGGGCGGTGG - Intergenic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923185178 1:231565436-231565458 CAAGTTTAGGCTGGGCGTGGTGG + Exonic
923495958 1:234525023-234525045 CAGTTTTAACCTTGGGGTGGGGG - Intergenic
923754601 1:236779702-236779724 CAAGTTTAGGCTGGGCGAGGTGG + Intergenic
924465881 1:244298918-244298940 CAGTTTTAGGCTGGGCGTGGTGG + Intergenic
1063208302 10:3855610-3855632 GAGGTTCAGGCTTTGGTAGGGGG - Intergenic
1063477126 10:6339209-6339231 CGGGTTCAGGCTGGGGCAGGAGG + Intergenic
1064331791 10:14401133-14401155 GAGTTTGGGGCTTGGGGAGGAGG - Intronic
1065203899 10:23340224-23340246 CAGGTTCAGGCTGGGTGTGGTGG + Intronic
1065605271 10:27412435-27412457 CAGTTTTAGGCTGGGTGTGGTGG - Intronic
1066305472 10:34136268-34136290 CAGGTTCAGGCTTAGGCAGCTGG - Intronic
1066307773 10:34163202-34163224 GAAGTTAAGTCTTGGGGAGGAGG + Intronic
1066694034 10:38062017-38062039 AAGGTTTGGCCTTTGGGAGGTGG + Intronic
1066998787 10:42587133-42587155 AAGGTTTGGCCTTTGGGAGGTGG - Intronic
1067006447 10:42668563-42668585 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1067442152 10:46314627-46314649 AAGGTTTAGGGGTGGGGTGGTGG + Intronic
1067784948 10:49238894-49238916 CAAGTTTAGGCTGGGCGTGGTGG - Intergenic
1069032800 10:63615830-63615852 CAAGTTTAGGCTGGGTGTGGTGG - Intronic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1069778384 10:70939969-70939991 CAGTTTCAGGCATGAGGAGGGGG + Intergenic
1069935442 10:71912553-71912575 CATGATTGGGGTTGGGGAGGGGG - Intergenic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1070786459 10:79165057-79165079 CAGGTTGTGGGTTGGGTAGGGGG + Intronic
1071900501 10:90115788-90115810 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1073194811 10:101681428-101681450 CAGGTCTAGGCTGGGCGCGGTGG + Intronic
1073503678 10:103966059-103966081 CAGGTTTACAGTTGTGGAGGTGG + Intergenic
1074063542 10:109991220-109991242 CAGCTGGGGGCTTGGGGAGGTGG - Intergenic
1075285022 10:121176311-121176333 GAGGTTTAGGCTGGGTGCGGTGG - Intergenic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075557947 10:123446980-123447002 CTGCCTTGGGCTTGGGGAGGAGG + Intergenic
1075950985 10:126477670-126477692 CATGTTTAGGCTTAGGGAAATGG - Intronic
1076402085 10:130190963-130190985 CCGGCCCAGGCTTGGGGAGGCGG - Intergenic
1077003962 11:342050-342072 GAGGTTTAGGCTGGGTGTGGTGG - Intergenic
1077151921 11:1076563-1076585 CAGGTGTGGGCATGGGCAGGTGG + Intergenic
1078356285 11:10634094-10634116 CAGAGTTAGGCTTGGGCTGGTGG + Intronic
1078406772 11:11077032-11077054 CAGGATGAGGCTGGGGGCGGTGG - Intergenic
1079434924 11:20438264-20438286 GAGGTTTGGGCTGGGGGAGCAGG + Intronic
1079590406 11:22176424-22176446 TAGGACTAGCCTTGGGGAGGAGG + Intergenic
1080494573 11:32804095-32804117 CAGGTTTAGGTTGGGTGTGGTGG - Intergenic
1080859021 11:36136976-36136998 GAGGTTTAGGCTGGGTGCGGTGG - Intronic
1081787974 11:45761416-45761438 CAGTTTTAGGCTGGGCGTGGTGG + Intergenic
1082954687 11:58857432-58857454 CAGGTCTAGGCAGTGGGAGGAGG - Intronic
1082971744 11:59030129-59030151 CAGGTCTAGGCAGTGGGAGGAGG - Intronic
1083508875 11:63188259-63188281 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
1084006280 11:66325170-66325192 GAGGAATAGGCTTGGGGAAGGGG + Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084389389 11:68865342-68865364 CAGGTGTAGGGCTGGAGAGGAGG - Intergenic
1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG + Exonic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1085680909 11:78574416-78574438 AAGGTTTGTGCTTGGGGAAGGGG + Exonic
1086257100 11:84890533-84890555 AATGTTTAGGGTTGGGGAGGGGG - Intronic
1087318590 11:96633633-96633655 CAGGTTTGGGCTGGGTGTGGTGG + Intergenic
1088439849 11:109857881-109857903 CATGTTTAGGATTGCTGAGGGGG + Intergenic
1088678042 11:112215421-112215443 GAGGTTTAGGCTGGGTGTGGTGG + Intronic
1090129923 11:124129693-124129715 CTGGTTTAGTCTTGGGGTGGGGG + Intronic
1090450809 11:126804577-126804599 CTGGTTTTTGGTTGGGGAGGAGG + Intronic
1090748754 11:129727992-129728014 CAGATTTTGGCTTGGGGAGGGGG - Intergenic
1091551243 12:1536463-1536485 CAGCTTTAGGCTGGGCAAGGTGG + Intronic
1092162804 12:6325183-6325205 CGGTTGTTGGCTTGGGGAGGGGG - Intronic
1092488272 12:8921704-8921726 CTGGTTGAGGGGTGGGGAGGTGG - Exonic
1092515253 12:9204806-9204828 CAGGTTCAGGCTGGGAGAAGTGG + Intronic
1092790364 12:12065579-12065601 GAGCTTTAGGCTTCTGGAGGTGG + Intronic
1092893450 12:12990996-12991018 CAGGTAGTGGCTTGGGGAGTGGG - Intronic
1094155293 12:27332553-27332575 CGGGGCTAGGGTTGGGGAGGAGG - Intergenic
1094391924 12:29960982-29961004 TAGGTTTAGACTTAGGGTGGTGG - Intergenic
1094446662 12:30538501-30538523 CAGGATTAGGCTGGGTGCGGTGG + Intergenic
1095458457 12:42415456-42415478 CAGGTTTTGGCTAGGGGCGGTGG - Intronic
1095989603 12:48025600-48025622 CAGGCTTGGGCTGGGGGCGGGGG - Intergenic
1096000682 12:48127410-48127432 CAGGTTTTGGTTTGGGCAGGTGG - Intronic
1096030056 12:48405884-48405906 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096640368 12:52989550-52989572 CAGGTTTAGGCTGGGTGCAGTGG + Intergenic
1096946589 12:55414305-55414327 CTGGTTGAGGGGTGGGGAGGTGG + Intergenic
1097191260 12:57220661-57220683 CAGGATCAGGCTGTGGGAGGGGG - Intronic
1097792645 12:63831057-63831079 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1097959426 12:65518115-65518137 CAGGTGTATGTTTGGGGAGTGGG + Intergenic
1098560324 12:71865371-71865393 AAGGTTTGGGCCTGGGGAGCAGG + Intronic
1098678623 12:73321917-73321939 GTGGTGTAGGCTTGGGGATGTGG - Intergenic
1098906341 12:76166594-76166616 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1098913612 12:76235246-76235268 CAGGCTTAGGCCTGATGAGGAGG - Intergenic
1099516037 12:83597730-83597752 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1100250180 12:92812712-92812734 AAGGTCTAGGCTAGGGGAGAAGG + Intronic
1101431709 12:104632571-104632593 CAGGGTTGGTCTGGGGGAGGAGG + Intronic
1101504413 12:105332395-105332417 CAGTTTTAGGGATGGGGAGGGGG + Intronic
1101521794 12:105490492-105490514 CAGGTGTAGATTTGGGGAAGTGG + Intergenic
1101527420 12:105544414-105544436 CAAGTCTAGGTTTGGGGAAGAGG + Intergenic
1102376494 12:112425978-112426000 GAGGTTTAGGCTGGGGGCAGTGG - Intronic
1102627555 12:114247523-114247545 CAGGTTCAGGGCTGGGGATGGGG + Intergenic
1102882125 12:116493677-116493699 CAGGATTAGGCTGGGCGCGGTGG - Intergenic
1103034829 12:117647994-117648016 CAGGGTTAGGCTGGGTGTGGTGG - Intronic
1103565440 12:121812973-121812995 CAGGTCTGGACTTGGGGTGGGGG - Intronic
1104465366 12:128985528-128985550 CATGTTTAGGCTGGGCGTGGTGG - Intergenic
1104685325 12:130781015-130781037 CAGGTTGTGGCTCAGGGAGGCGG + Intergenic
1104733786 12:131123532-131123554 CAGGTTCAGGCTGGGCGCGGTGG + Intronic
1105747365 13:23390913-23390935 CAGGTTTGGGCTGGAGAAGGAGG - Intronic
1105779028 13:23690376-23690398 CAGCCTTAGGCTTGGTGCGGTGG + Intergenic
1106535950 13:30643181-30643203 CATGTGTAGGCTTCTGGAGGTGG - Intronic
1106698200 13:32201012-32201034 CAGGATTTGCCCTGGGGAGGGGG - Intronic
1106784378 13:33092377-33092399 CAGGTTTAGGCTTTTGTATGTGG + Intergenic
1106817159 13:33421373-33421395 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1107316976 13:39143467-39143489 CTAGTTTAGTCTTGGGGGGGGGG - Intergenic
1107938549 13:45364945-45364967 CAGACTTAGGCTTGGAGGGGAGG + Intergenic
1108074486 13:46665664-46665686 CAGGTTTGGGGTAGGGGTGGGGG + Intronic
1109891518 13:68620507-68620529 CTGGTTTAGTCTTGGGGGGCGGG - Intergenic
1113681479 13:112247947-112247969 CAGGCCTTGGCGTGGGGAGGAGG - Intergenic
1114031146 14:18582438-18582460 TAAGTTTAGGGTTGGGGTGGGGG - Intergenic
1114415864 14:22543636-22543658 AAGGTTTAGGCCTGGCGTGGTGG + Intergenic
1115045358 14:28986045-28986067 CTGGATGAGGTTTGGGGAGGGGG + Intergenic
1116274346 14:42811267-42811289 CAGGTTTAGGCTTGTATAAGAGG - Intergenic
1117277720 14:54206535-54206557 CTGGGATTGGCTTGGGGAGGGGG + Intergenic
1117915148 14:60670277-60670299 CAGGTTTTGGCATGGTGCGGTGG - Intergenic
1119315771 14:73693119-73693141 CAGCTTTAGGCTGGGCGCGGTGG - Intronic
1119395496 14:74323294-74323316 CAGGTTCTGGCTGGGGGCGGTGG + Intronic
1119422435 14:74515542-74515564 CAGGTTTAGGCTGGGCGCGGTGG - Intronic
1121575299 14:94980084-94980106 CTGGCTTAGGCTTGGGGAGCCGG - Intergenic
1121654206 14:95583454-95583476 CAAGTTGAGATTTGGGGAGGGGG + Intergenic
1121908888 14:97771117-97771139 CAGAACCAGGCTTGGGGAGGGGG + Intergenic
1122966996 14:105135723-105135745 GAGGTTGAGGCTGGGGCAGGAGG + Intergenic
1123034503 14:105466436-105466458 CGGGGTCAGGCTTGGGGGGGCGG - Exonic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125407033 15:39363347-39363369 AAGCTTTTGGCTTTGGGAGGTGG + Intergenic
1125479183 15:40069108-40069130 GAGGCTTAGGCCTGAGGAGGGGG - Intergenic
1126766344 15:52015286-52015308 CAGGTGTAGGCTGGGTGCGGTGG - Intronic
1126937657 15:53729101-53729123 CAGATTTAGGGTTTGGGAGCTGG - Intronic
1127223268 15:56903108-56903130 CAGGTGCAGGCTTGGTGTGGTGG + Intronic
1127765544 15:62182884-62182906 CAGATTTAGGTTTGGGAAGTAGG - Intergenic
1127945706 15:63749772-63749794 CAGGTCTATGCTTGGGGCTGTGG - Exonic
1128328028 15:66737750-66737772 CAGCTTCAGGCCTGGGGAGGTGG + Intronic
1128827822 15:70736724-70736746 CAGGTTGAGGCTGGGTGCGGTGG - Intronic
1129250329 15:74305232-74305254 CAGGTTTAGGCCAGGCGTGGTGG - Intronic
1129325511 15:74798433-74798455 CAGGTACAGGCCTGGGGAAGTGG + Intronic
1129627192 15:77214327-77214349 GAGGTTTAGGCTGGGCGCGGTGG + Intronic
1129702983 15:77778565-77778587 CAGTTTTTGGCTTGGGCAGCTGG - Intronic
1129890558 15:79068988-79069010 CGGGCTTAGGCTTGGGGGTGGGG + Intronic
1130049077 15:80468271-80468293 GAGGTTCAGGGTTGGGGAGGAGG - Intronic
1130192719 15:81751742-81751764 GAGGTTTGGGGTGGGGGAGGGGG - Intergenic
1130839636 15:87685950-87685972 CTTATTTAGGCTTGGGGAGCAGG - Intergenic
1130880459 15:88051214-88051236 GAGGTGTAGGGTTGGGCAGGTGG - Intronic
1131227043 15:90632889-90632911 CATGGTTAGGCTGGGTGAGGTGG - Intronic
1132709175 16:1258887-1258909 CGGATTCAGGGTTGGGGAGGAGG - Exonic
1133362331 16:5184376-5184398 CAGGTAAAGGCTTGGGAAGTGGG + Intergenic
1134386378 16:13777327-13777349 CAGGCATAGGCTTGGGAAGCAGG - Intergenic
1134598002 16:15511225-15511247 CAGGCTGTGGCTTGGGGAGAGGG - Intronic
1134756845 16:16674636-16674658 CAGCTTTGGGAGTGGGGAGGTGG + Intergenic
1134773252 16:16829254-16829276 GAGGTTAAGGCTTGGGGATGGGG - Intergenic
1134989223 16:18684527-18684549 CAGCTTTGGGAGTGGGGAGGTGG - Intergenic
1135147206 16:19972919-19972941 CAGGTGGAGGCTGGGGGAGCTGG + Intergenic
1135157080 16:20061743-20061765 TAGGGTCAGGCGTGGGGAGGAGG - Intronic
1135285241 16:21187618-21187640 CTGGTTGAGGGTTGGGGCGGGGG - Intergenic
1135508562 16:23060667-23060689 ATGGTTTAGGGTTGGGGTGGGGG - Intergenic
1135522285 16:23186746-23186768 CAGATTTAGAACTGGGGAGGGGG - Intronic
1135576375 16:23589010-23589032 CAGGTTTAGGCTGGGCGCAGTGG + Intronic
1136089819 16:27910724-27910746 CAGGTCTAGGCTGGGTGTGGTGG + Intronic
1136203033 16:28701185-28701207 CAGTTTCAGGCTGGGTGAGGTGG - Intronic
1136453157 16:30365671-30365693 CTCGTTTGAGCTTGGGGAGGTGG - Intronic
1136468698 16:30463865-30463887 CAGATTTAGGCTGGGGGTGGTGG - Intergenic
1137343370 16:47632112-47632134 TAGGTTTGGGTTTGGGGAGGGGG - Intronic
1137719882 16:50621758-50621780 CAGCTTGGGGCTTTGGGAGGAGG + Intronic
1138430207 16:56963545-56963567 TAATTTTAGGCTTGGGGTGGGGG - Intronic
1139261476 16:65598697-65598719 CAGGCCTAGGGTTGGGGTGGGGG + Intergenic
1140058296 16:71545100-71545122 TAGGTTGAGGGTTGGGGATGGGG - Intronic
1140082882 16:71766676-71766698 CCCTTTTAGGCTTGGGGAGTAGG - Intronic
1140387993 16:74559454-74559476 GAGGGTAAGGCTGGGGGAGGAGG + Intronic
1140729583 16:77843851-77843873 GAGGTCTGGGCTTGTGGAGGAGG + Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142002599 16:87672021-87672043 CAGGTGTAGGGCTGGGCAGGTGG + Intronic
1142286484 16:89173493-89173515 CAGCTGGAGGCTGGGGGAGGTGG + Intronic
1143584082 17:7842820-7842842 CTGATTCAGGCTTGGGGTGGGGG - Intronic
1144706388 17:17371136-17371158 GAGGAGTAAGCTTGGGGAGGAGG - Intergenic
1145015812 17:19397554-19397576 CAAGTTTAGGCTGGGTGTGGTGG - Intergenic
1146659274 17:34653580-34653602 CCGGAATAGGCTAGGGGAGGGGG + Intergenic
1146720598 17:35120902-35120924 CAGCTTCAGGGGTGGGGAGGGGG - Intronic
1147166623 17:38596830-38596852 CAGGTTGAGGGTTGGGGGTGTGG - Intronic
1147231064 17:39018284-39018306 CATGCTTGGGCTTGGGCAGGGGG + Intergenic
1147337390 17:39735793-39735815 CAGGTCTGGGGTTGGGGAGGAGG - Intergenic
1147587105 17:41659006-41659028 CCTCTTCAGGCTTGGGGAGGGGG - Intergenic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147956466 17:44138058-44138080 TTGGGATAGGCTTGGGGAGGTGG + Intergenic
1148467706 17:47874906-47874928 CAGGTTTGGGCAGGTGGAGGGGG - Intergenic
1148520555 17:48270934-48270956 CAGGTTTAAGCGGGGGGAGGGGG + Intronic
1148612184 17:48971847-48971869 CAGGTTTGGGGTTGGGGGTGGGG + Intergenic
1148929856 17:51119966-51119988 AAGTTTTACCCTTGGGGAGGGGG - Intronic
1149100763 17:52903760-52903782 GAGATTTAGGCTTGGGGAGGTGG + Intergenic
1149103746 17:52937319-52937341 CAGGTAGAGGCTTGGGAAGTAGG - Intergenic
1149841173 17:59965997-59966019 AAGGTTTAGGCCTGGCGTGGTGG + Intronic
1150099201 17:62407412-62407434 CAGCTTTGGGGTTGGGGATGGGG + Intronic
1150128956 17:62656330-62656352 CAGGTGTAGGCTGGGCGTGGTGG - Intronic
1150219017 17:63485380-63485402 CAGGTTTGGGGGTGGGGAGGTGG - Intronic
1150687266 17:67330752-67330774 GAGGTTTAGGCTGGGTGTGGTGG - Intergenic
1151493222 17:74444682-74444704 CAGGTTCAGGCTCAGGGAGAGGG - Intronic
1152871677 17:82757331-82757353 CAGATTTTGGCTGGGGGTGGTGG + Intronic
1152920527 17:83064323-83064345 CAGGTCCAGGCCTGGGGAGCTGG + Intergenic
1153437363 18:5081919-5081941 CAGATTTAGATTTGGGGAAGAGG + Intergenic
1153792793 18:8595286-8595308 CAGGTATAGGCTTGGTCAGTTGG - Intergenic
1153902456 18:9629825-9629847 CATGTTTAGGCTAGGCGTGGTGG - Intergenic
1154935744 18:21054534-21054556 CAGATTTAGGGGTGGGGATGTGG - Intronic
1155341418 18:24818014-24818036 CAGTTTCAGGCATGGGGACGAGG + Intergenic
1155711682 18:28888152-28888174 AAGGTTTAAGCTAGGGGTGGTGG - Intergenic
1156258462 18:35422335-35422357 GAGGTTTGGGCCTGGGGAGAAGG + Intergenic
1157299275 18:46467919-46467941 CAGGTGTGTGGTTGGGGAGGGGG - Intergenic
1157859859 18:51131920-51131942 CAGATTTAGGGTGAGGGAGGTGG - Intergenic
1157984168 18:52418567-52418589 CAGGTTTTGGTTAGGGGAGATGG + Intronic
1158594855 18:58807169-58807191 CAGGTTTAGGATTGGCCAGTTGG - Intergenic
1159584098 18:70266578-70266600 CAATTTTAGGGTTGGGCAGGGGG - Intergenic
1159626507 18:70701330-70701352 CAGGTTAAGGCTAGGTGTGGTGG - Intergenic
1159898549 18:74020584-74020606 GAGGTTTAGGCTGGGTGCGGTGG + Intergenic
1161025500 19:2034922-2034944 CAGGTTTGGGCCTGGAAAGGCGG - Intergenic
1161724170 19:5918832-5918854 GTGGTCCAGGCTTGGGGAGGAGG - Intronic
1162012003 19:7822912-7822934 CATGTTTAGGCTGGGCGTGGTGG - Intergenic
1162549196 19:11349116-11349138 CAGGTCTGGACTGGGGGAGGGGG - Intronic
1163258831 19:16174270-16174292 AAGGTTTTGGCTGGGCGAGGTGG + Intergenic
1163406433 19:17125963-17125985 CAGGCTTGGGCTTGGGGGTGTGG + Intronic
1163485687 19:17584084-17584106 AAGGATTAGGCTGGGTGAGGTGG + Intergenic
1163491225 19:17618181-17618203 TAGGATTAGGCTTGGGGTAGAGG - Intronic
1163667936 19:18611832-18611854 CAGGTTTCGGCCTGGGAAGAGGG - Intronic
1163728951 19:18938938-18938960 CAGGGCCAGGCTGGGGGAGGTGG + Intronic
1165124983 19:33587712-33587734 TAGGGTTAGGGTTGGGGAGCAGG + Intergenic
1165167882 19:33870139-33870161 AAGGTTTGGATTTGGGGAGGAGG + Intergenic
1165699502 19:37926590-37926612 GTGGCTCAGGCTTGGGGAGGGGG + Intronic
1166667423 19:44689469-44689491 CAGGTTTGGGGTTGGAGAGCTGG - Intergenic
1166815405 19:45541850-45541872 CAGGTTCAGGCTGGGTGTGGTGG - Intronic
1167333037 19:48868005-48868027 CAGGGCTTGGCTTGGGGAGTTGG - Intronic
1168039298 19:53745400-53745422 CAGGTTTAGGTGGGGGGCGGAGG - Intergenic
928196554 2:29220571-29220593 CAACTTTAGGCTTGGACAGGGGG - Intronic
929154088 2:38773727-38773749 CAATTTTAGGCTGGGAGAGGTGG - Intronic
929223620 2:39490270-39490292 TAGCTTTAGGCTGGGCGAGGTGG + Intergenic
929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG + Intergenic
930152568 2:48073754-48073776 CAGGCTTGGGCTTGGGAGGGAGG + Intergenic
930618582 2:53620694-53620716 CAGGTTGAGGTTTTGGGAGTTGG + Intronic
931042215 2:58313325-58313347 GAGGTTTAGGCCAGGGGTGGTGG + Intergenic
931282680 2:60807921-60807943 CAGGTGAAAGCTGGGGGAGGTGG + Intergenic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932652174 2:73570128-73570150 CAGATTTTGGCTTGGGCAGTAGG + Intronic
932726097 2:74181064-74181086 CAGATTTAGGCCGGGCGAGGTGG + Intergenic
935034307 2:99353681-99353703 CAGGTGAGGGGTTGGGGAGGTGG - Intronic
935413037 2:102786098-102786120 CAGTTTTAGAATTGGGCAGGAGG + Intronic
935949309 2:108314453-108314475 CAGGAGCAGGCTTGGTGAGGCGG + Intergenic
936493969 2:113001634-113001656 CAGGGTTGGGGCTGGGGAGGTGG - Intergenic
936531306 2:113278530-113278552 AAGGATGAGGCCTGGGGAGGGGG - Exonic
936623979 2:114128299-114128321 AAGGTTGAGGCTTGGGGATGGGG + Intergenic
936905985 2:117536260-117536282 GAGGTTTGGGCCTGGGGAGCAGG + Intergenic
938310376 2:130285336-130285358 GAGGGCTGGGCTTGGGGAGGAGG + Intergenic
939459156 2:142476760-142476782 CAGATTTAGGCTGGGTGTGGTGG - Intergenic
940478905 2:154203127-154203149 CAGTGTGAGGCATGGGGAGGAGG + Intronic
940497640 2:154453613-154453635 CATGTTTGGGGCTGGGGAGGGGG - Exonic
940886274 2:158992073-158992095 CACGTTTAGGCTGGGTGTGGTGG + Intronic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
942570228 2:177306674-177306696 CAGCATTAGGCTTGTGGGGGTGG + Intronic
942813477 2:180023811-180023833 CTGGTTTGGGTTTGGGGTGGGGG + Intergenic
943731357 2:191306550-191306572 GAGGTTTAGGTTTAGGGACGTGG + Intronic
945102606 2:206275248-206275270 CGGGTCCGGGCTTGGGGAGGGGG + Intronic
946356004 2:219185352-219185374 CATGTTTATGTTAGGGGAGGAGG + Exonic
946861104 2:224001139-224001161 CTGTTGTGGGCTTGGGGAGGGGG + Intronic
947430764 2:230025624-230025646 CAGGTATAGGCTGGGCGCGGTGG - Intergenic
947642472 2:231714674-231714696 CAGGTTGAGGCCTTGGTAGGAGG + Intergenic
948639694 2:239367701-239367723 CATGTTTAGGCTGGGTGTGGTGG + Intronic
1169068879 20:2709640-2709662 CAGGTACAGGCTCAGGGAGGGGG + Exonic
1169237081 20:3938848-3938870 GAGGTTGAGGCTTGAGGAGCTGG - Intronic
1169501900 20:6168543-6168565 CAGATGTAGCCTTGGGGAGGTGG - Intergenic
1169664121 20:8015585-8015607 CAGGTTCAGTGTTGGGGAGCTGG - Intronic
1170220099 20:13932923-13932945 CAGCTTTAGGCTAGGCGGGGTGG + Intronic
1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG + Intergenic
1171113787 20:22507322-22507344 CTGGTTTAGGCTGGGGGAGCTGG - Intergenic
1171185430 20:23121144-23121166 CGGGTTTTGGCTGGGGGCGGGGG - Intergenic
1171387089 20:24777935-24777957 TAGTTTTAGGCTTGGGGAGGGGG - Intergenic
1173852012 20:46224719-46224741 CAGGACTAGGTTGGGGGAGGAGG - Intronic
1176342197 21:5709460-5709482 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1176474451 21:7141612-7141634 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1176502630 21:7614996-7615018 CAGGTCTAGGCTGGGCGATGAGG + Intergenic
1176524060 21:7851954-7851976 CAAGTCTAGGCCTGGTGAGGTGG + Intergenic
1176536518 21:8107529-8107551 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1178526266 21:33331799-33331821 GAGGTTTGGGCCTGGGGAGCAGG - Intronic
1178600504 21:33990447-33990469 CAGGTTGAGGCTGGGTGTGGTGG + Intergenic
1178658080 21:34481967-34481989 CAAGTCTAGGCCTGGTGAGGTGG + Intergenic
1179233054 21:39522865-39522887 CAGATTTAGGCTTGCGTGGGAGG - Intergenic
1180455257 22:15509496-15509518 TAAGTTTAGGGTTGGGGTGGGGG - Intergenic
1180611378 22:17100417-17100439 CAGGGATGGGCTTGGGCAGGTGG - Exonic
1181307209 22:21923528-21923550 GAGGTCTAGGCCTGGGTAGGTGG - Intronic
1181625034 22:24117485-24117507 CAGTTTTAGGCTGGGCGTGGTGG - Intronic
1181685018 22:24522382-24522404 CTGGTTTGGGCAAGGGGAGGGGG - Intronic
1182013004 22:27016276-27016298 CAGGTCTAGCCTTTGGGTGGTGG - Intergenic
1182753959 22:32663583-32663605 GAGGTTTAGGCTGGGCGTGGTGG - Intronic
1184092705 22:42300826-42300848 CAGGTCTTGGCAGGGGGAGGAGG - Intronic
1184227793 22:43139867-43139889 CAGAATTAGGCTTGGTGTGGTGG - Intronic
1184465750 22:44668367-44668389 CAGGTCGGGGCTTGGGGAGGGGG + Intergenic
1184747035 22:46462067-46462089 CAGGTGTGGGCTGTGGGAGGCGG + Intronic
1184922347 22:47614396-47614418 CCGTCGTAGGCTTGGGGAGGAGG + Intergenic
1203241463 22_KI270733v1_random:23940-23962 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
949206228 3:1441803-1441825 CAGACTTAGACTTGGAGAGGAGG + Intergenic
949231606 3:1756982-1757004 CTGGTCTAGGCTTGTGGTGGGGG - Intergenic
949421028 3:3866152-3866174 CTGGTTTAGTCTTGGGAGGGTGG - Intronic
949532389 3:4969179-4969201 CCGGTTTAGTCTTGGGAGGGTGG - Intergenic
949951464 3:9232415-9232437 GAGGTTTACCCTTGGGGACGAGG - Intronic
950061938 3:10078860-10078882 GAGGCTGAGGCATGGGGAGGAGG + Intronic
950409133 3:12823439-12823461 CAGGTGTAGGCTGGGCGCGGTGG + Intronic
952653481 3:35755314-35755336 CAGACTTAGGTTTGGGAAGGTGG - Intronic
952736632 3:36697698-36697720 CAGGTTTAGGGTCAGGGAGCAGG + Intergenic
953781890 3:45878494-45878516 CAGGGTGAGGCTGGGGGATGGGG + Intronic
954563250 3:51576561-51576583 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
954635368 3:52068236-52068258 CTGGCCCAGGCTTGGGGAGGGGG - Intergenic
957163679 3:76642637-76642659 CAGGTGTAGGCTGGGCGCGGTGG - Intronic
957588564 3:82164686-82164708 CAAGTTTAAGCCTGGAGAGGTGG - Intergenic
957765480 3:84619496-84619518 CACGTGTAAGCTTGGTGAGGTGG - Intergenic
958025080 3:88040244-88040266 CAGGTCTAGGCTTGAGGGTGGGG + Intergenic
958449715 3:94258807-94258829 CAGCTTAAGGCCTGGTGAGGAGG + Intergenic
959116079 3:102180160-102180182 CAGATCTAGGCTTTGGGAAGTGG - Intronic
959468199 3:106716045-106716067 GAGGTTTAGGCTGGGTGTGGTGG - Intergenic
959633536 3:108535978-108536000 CATGTTTAGGCAGGGCGAGGTGG + Intergenic
959687688 3:109165512-109165534 CCGGTTTTGGCTTGGTGTGGTGG + Intergenic
960057141 3:113283796-113283818 CAGACCTCGGCTTGGGGAGGAGG + Intronic
960987026 3:123287411-123287433 CAGGATTTAGCCTGGGGAGGAGG - Intronic
961824072 3:129589686-129589708 CAGGCCTGGGCTTGGGGATGGGG - Intronic
963063890 3:141247081-141247103 CAGGTTCATTCTTGGGGAGCAGG + Intronic
963273642 3:143309222-143309244 CAGTCTGAGGCTTGGGAAGGTGG + Intronic
965464163 3:169006224-169006246 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
966378051 3:179317179-179317201 CAGATTTAGGCTGGGCGTGGTGG - Intergenic
966795312 3:183707978-183708000 CTGGTTTAAAGTTGGGGAGGGGG - Intronic
968393084 4:208858-208880 CATGATTAGGTTTGGGGAGGAGG + Intergenic
968806146 4:2774041-2774063 CAGGTTTAGGCGAGGCGCGGTGG + Intergenic
969296738 4:6274682-6274704 AGGGTCTAGGCTGGGGGAGGGGG + Intronic
969315282 4:6377975-6377997 CTGGATTCGGCGTGGGGAGGAGG + Intronic
969855375 4:9994907-9994929 CAGGGTCTGGCTTGGGCAGGAGG + Intronic
971061803 4:22979489-22979511 CAGGTTTAGGCTTGCGCAAGAGG + Intergenic
971609144 4:28700021-28700043 CAGATTGAGGCCTGGGGCGGTGG + Intergenic
972200135 4:36704086-36704108 CAGAGTTAGGATTGGGAAGGAGG - Intergenic
972228696 4:37044979-37045001 CAGGTAGAGGCTTGGGAAGTGGG + Intergenic
972476942 4:39459180-39459202 CGGGTTTGGGCGTGGGGTGGGGG + Intronic
972876223 4:43364398-43364420 CAGGTTTTTATTTGGGGAGGTGG + Intergenic
975671851 4:76787935-76787957 GAGGTTTGGGCCTGGGGAGCAGG - Intergenic
976426139 4:84905417-84905439 CAGGTTTTGGCTTGAGCAGTTGG - Intronic
976561853 4:86511194-86511216 CAGGTTTCGGCTGGGTGTGGTGG + Intronic
976947251 4:90785314-90785336 CAGGTTTGGGCTGGGCGTGGTGG - Intronic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
981723413 4:147824030-147824052 CAGATTCAGGCTGGGCGAGGTGG + Intronic
983568280 4:169177069-169177091 GAGTTGTAGGCTGGGGGAGGTGG - Intronic
983754151 4:171312871-171312893 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
983777273 4:171623480-171623502 GAGGTTTAGGCTGGGTGGGGTGG - Intergenic
984236011 4:177159809-177159831 CATGTTGAGCCTTGGGGGGGCGG - Intergenic
984358567 4:178697617-178697639 AAGGTTTAGGCCAGGGGCGGTGG + Intergenic
984729918 4:183058431-183058453 CTGGTTTGGGCTGGGTGAGGTGG - Intergenic
985741789 5:1621780-1621802 CAGCTGAAGACTTGGGGAGGAGG - Intergenic
985870154 5:2548109-2548131 CACCTTTTGGCTTGGGAAGGGGG - Intergenic
987334649 5:16888180-16888202 CTGGTATATGATTGGGGAGGGGG - Intronic
987667938 5:20969096-20969118 CTGGTTTAGGCTGGGCGCGGTGG + Intergenic
988172568 5:27678804-27678826 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
988567728 5:32333039-32333061 CAGGTGTAGGCTGGGCGCGGTGG - Intergenic
989562307 5:42866226-42866248 CTGGTTTAGTCTTGGGAGGGTGG - Intronic
989583576 5:43056554-43056576 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
990369196 5:55099942-55099964 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
990416287 5:55590253-55590275 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
991609564 5:68436310-68436332 CAGGTGAAGGCTTTGGGGGGTGG + Intergenic
991921650 5:71663203-71663225 CATGTTGAGGCTTGGCCAGGTGG + Intergenic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
992624565 5:78625493-78625515 CAGGTTTGGGGGTGGGTAGGAGG - Intronic
993053018 5:82947439-82947461 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
994380022 5:99059507-99059529 AAGGTGTAGGCTGGGTGAGGTGG + Intergenic
994496403 5:100518246-100518268 CAGGTTTATGCTTGGACAAGAGG + Intergenic
995729996 5:115228584-115228606 CAGGTGTATGCTGGGGGTGGAGG + Intronic
997203453 5:132026760-132026782 CAGGTCTGGGCTGGGGGCGGTGG + Intergenic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
997659173 5:135576876-135576898 GAGTTTTAGGATTGTGGAGGGGG + Intronic
997949568 5:138231361-138231383 GAGGTTTGGGCTGGGGGAGGGGG - Intergenic
1000144592 5:158441509-158441531 CTGGTTTATTCTTGGGGCGGGGG + Intergenic
1000929391 5:167232656-167232678 GAGGTTTAGGCTGGGCGTGGTGG - Intergenic
1002404789 5:179021726-179021748 CAGGTTTTGGCCGGGGGTGGTGG - Intergenic
1003580614 6:7337033-7337055 CAGTTTTAGGCTGGGCAAGGTGG + Intronic
1004177062 6:13349243-13349265 CAGTTTTAGGCTGGGCGTGGTGG - Intergenic
1004239134 6:13902869-13902891 CAGGGTTAGGCTGGGGCTGGAGG - Intergenic
1005997865 6:30942491-30942513 CAGGTTGAGGCCAGGGGTGGAGG + Intronic
1006075409 6:31529331-31529353 GAGGTCTGGGCTGGGGGAGGTGG - Intronic
1006234485 6:32616663-32616685 CATCTTTAGTTTTGGGGAGGGGG - Intergenic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1006920100 6:37622134-37622156 CAGGTATTGGTTGGGGGAGGAGG - Intergenic
1006936014 6:37718769-37718791 CATTTTTAGGCTGGGTGAGGTGG + Intergenic
1007325893 6:41059301-41059323 CTGGATTAGACTTGGGGAGTGGG + Intronic
1008254461 6:49279189-49279211 CTGGTTTAGTCTTGGGATGGTGG - Intergenic
1009220968 6:60983660-60983682 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1009229973 6:61050119-61050141 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1009614864 6:65991038-65991060 CAGGTTCAGGCTTGCAGAAGAGG + Intergenic
1010130509 6:72487330-72487352 AAGGTTGAGGCATGGGGAGAAGG - Intergenic
1011641738 6:89422374-89422396 CATAGTTTGGCTTGGGGAGGGGG - Intergenic
1011651814 6:89513362-89513384 CAGGTTAAGGATTGGGAGGGGGG - Intronic
1012277985 6:97296775-97296797 CAGGTTTAGGCTGGGCGCAGTGG + Intergenic
1012443889 6:99289164-99289186 AATATTTAGGTTTGGGGAGGAGG - Intronic
1012445078 6:99298917-99298939 CAGGGTTGGGGTTGGGGATGGGG - Intronic
1014117948 6:117687598-117687620 CAGGCATGGGCTTGGGGAAGTGG + Intronic
1014163707 6:118200013-118200035 CAGTTTTGGGCTTGGGAAGGTGG + Intronic
1014397976 6:120950334-120950356 CAGCTTTAGGCTGGGCGTGGTGG + Intergenic
1016871896 6:148825937-148825959 CAGGAATAGGGTTGAGGAGGGGG + Intronic
1018048778 6:159989288-159989310 CTAGTTCAGGGTTGGGGAGGAGG + Intronic
1020227880 7:6294445-6294467 GAGGTTTAGGCTGGGTGCGGTGG - Intergenic
1020229559 7:6307368-6307390 CAGGTTTTGGCTGGGCGCGGTGG - Intergenic
1020622790 7:10537972-10537994 CAGGCTTTGATTTGGGGAGGAGG + Intergenic
1021585110 7:22199396-22199418 CAGGTTAAGGCTGGTGGAGATGG + Intronic
1021950646 7:25770963-25770985 CAGATTTAGGCTTTGGGAGATGG - Intergenic
1022025564 7:26444707-26444729 TAGGTGTAGGCTGGGGGTGGGGG - Intergenic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1023206618 7:37757662-37757684 CAGGTCAAGGCTGGGTGAGGTGG - Intronic
1026130989 7:67620864-67620886 CAGGTGTGGGCTTGGGAAGTGGG - Intergenic
1027197386 7:76040051-76040073 CAGGCTTAGGTTTGGGGACATGG - Intronic
1027679040 7:81196093-81196115 GTGGTTTAGGCTGGGGGCGGTGG + Intronic
1028653650 7:93177380-93177402 TAGGTTTAGGATTGAGCAGGAGG + Intergenic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1029609867 7:101621190-101621212 CAGCATTAGGCATGGGGTGGAGG - Intronic
1030088403 7:105836771-105836793 TAGGTTTAGGCTGGGTGTGGTGG + Intronic
1030250463 7:107438371-107438393 CAGTTTTAGGCTTCCAGAGGTGG - Intronic
1030482433 7:110120852-110120874 CAGAATTAGGCTTGAGAAGGTGG + Intergenic
1030730528 7:112982770-112982792 TATGTTTAGGCTGTGGGAGGTGG + Intergenic
1033284979 7:140033593-140033615 TTATTTTAGGCTTGGGGAGGTGG - Intronic
1033600473 7:142885338-142885360 GAGGTGCAGGCCTGGGGAGGTGG + Intronic
1033772651 7:144570042-144570064 GAAGTTTAGGCTAGGGGAGAAGG - Intronic
1035057328 7:156044217-156044239 CAGGTTTAGGCTGGGCATGGTGG + Intergenic
1036561371 8:9902881-9902903 CTGCTTGAGGTTTGGGGAGGAGG - Intergenic
1037372382 8:18193926-18193948 CAGGTTTAGGCCGGGTGTGGTGG - Intronic
1038099858 8:24361268-24361290 CAGGATTAGGCTGGAGGAGTTGG + Intergenic
1038225926 8:25657650-25657672 CTGGTTTAGTCTTGGGTGGGGGG + Intergenic
1038765950 8:30427826-30427848 CAGGTGTAGGCTTGTTGGGGTGG + Intronic
1039350042 8:36754350-36754372 CATGTTTGTGTTTGGGGAGGGGG - Intergenic
1040036551 8:42875860-42875882 CAGGTTTAGGCCGGGTGCGGTGG - Intronic
1040910592 8:52514651-52514673 CAAGTTTAGGCTGGGCGCGGTGG + Intergenic
1041477224 8:58279858-58279880 CATGTTAAGCCATGGGGAGGGGG + Intergenic
1043105819 8:76108760-76108782 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1044235153 8:89822074-89822096 CTGGTTTAGTCTTGGGAAGGGGG + Intergenic
1046314629 8:112483201-112483223 TAGGTTTAGGCTGGGCGCGGTGG + Intronic
1047341104 8:123981249-123981271 CAGGTTTGGGGTAGGGGAGTAGG - Intronic
1048018737 8:130519724-130519746 TCTGTTTAGGCTTGGGGTGGGGG + Intergenic
1048085035 8:131168084-131168106 GAGTTTTAGGCTTGGGGGTGGGG + Intergenic
1048470866 8:134702956-134702978 GAGGTTTAGGCTGGGTGCGGTGG - Intronic
1048548719 8:135413679-135413701 CTGGTATAGCCTAGGGGAGGAGG - Intergenic
1049009914 8:139880375-139880397 CAGCTGTAGCATTGGGGAGGGGG + Intronic
1051273977 9:15381494-15381516 CAGGTTTAGGCTTGGGCTGGCGG - Intergenic
1051506302 9:17831131-17831153 CAGGCTTCTCCTTGGGGAGGGGG + Intergenic
1052061234 9:23963415-23963437 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1052284179 9:26766070-26766092 GAGCTTTAGGCTGGGTGAGGTGG - Intergenic
1052432075 9:28379531-28379553 CTGGTTTTGTTTTGGGGAGGAGG - Intronic
1053601010 9:39609582-39609604 AAGGTTTCGGCTGGGGGTGGTGG + Intergenic
1055058595 9:72046305-72046327 CAGGTCTAGGCTGGGCGAGGAGG - Intergenic
1056862168 9:90195602-90195624 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1056938112 9:90933319-90933341 AAGGTGTGGGTTTGGGGAGGAGG + Intergenic
1057676668 9:97141311-97141333 GGGGTTTAGGCTGGGGGTGGGGG - Intergenic
1059673249 9:116511717-116511739 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
1059675420 9:116534075-116534097 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
1060059252 9:120444396-120444418 CTGGTGTGGGCTTGGGGAGGTGG - Intronic
1060305870 9:122411342-122411364 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1061055949 9:128223013-128223035 CAGGCTCCAGCTTGGGGAGGTGG + Intronic
1061075763 9:128340615-128340637 CAGGTTTGGGGTGCGGGAGGCGG + Intergenic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061879974 9:133563718-133563740 CAGGTTTTGGCTTTGGAAGAAGG + Intronic
1062006797 9:134242542-134242564 CATCTTTAGGCTAGAGGAGGCGG - Intergenic
1062038349 9:134392668-134392690 CATCTTTAGGCTGGGGGATGTGG + Intronic
1062408756 9:136410757-136410779 CAGGCTTCGGCCTGGGGCGGGGG + Intronic
1062486362 9:136778458-136778480 CAGTTTGAGGGTTGGGGAGCTGG - Intergenic
1062486387 9:136778556-136778578 CAGTTTGAGGGTTGGGGAGCTGG - Intergenic
1203457784 Un_GL000220v1:7014-7036 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1185657978 X:1701477-1701499 CAGGTTCAGGCTAGGGGCTGAGG + Intergenic
1186260924 X:7778634-7778656 TAGAGTTAGGCTTGGGGAGTGGG + Intergenic
1187869558 X:23753329-23753351 CAGGTTCAGGCTGGGCGTGGTGG + Intronic
1190048084 X:47128610-47128632 CAGTCTTAGGGTTGGGGAGTTGG - Intergenic
1190399393 X:50016735-50016757 GGGGTTTAGGGTGGGGGAGGGGG - Intronic
1190885641 X:54529378-54529400 AGGGTTTAGGCTTGAGGAAGAGG + Intergenic
1191762491 X:64661187-64661209 CAGAATTAGGCTTCGGAAGGTGG - Intergenic
1191787874 X:64935935-64935957 CAGAATTAGGCTTCGGAAGGTGG + Intronic
1193196637 X:78639691-78639713 CAGGTGTGGGGGTGGGGAGGTGG + Intergenic
1193972729 X:88076468-88076490 CAGGATTGTGTTTGGGGAGGGGG + Intergenic
1194156337 X:90393869-90393891 CAGGTTTGGGCTGGGCGTGGTGG - Intergenic
1195094989 X:101493576-101493598 GAGGATCAGGCTTGTGGAGGAGG + Exonic
1196794270 X:119489686-119489708 CAGGATTGGGTGTGGGGAGGTGG + Intergenic
1197063566 X:122212437-122212459 GAGGTTTTGGCTGGGGGCGGTGG + Intergenic
1197191394 X:123651726-123651748 CTGGTTTAGTCTTGGGGGGGGGG - Intronic
1197297513 X:124737119-124737141 CAGGTGCAGGCATGAGGAGGCGG + Exonic
1199830577 X:151545554-151545576 CAAGTTTAGGCCAGGCGAGGTGG - Intergenic
1201580441 Y:15506195-15506217 CTGGTTTAGTCTTGGGGGTGTGG - Intergenic